Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013006 Xanthomonas citri pv. malvacearum strain XcmN1003 chromosome, complete genome 5 crisprs DinG,DEDDh,WYL,csa3,cas3 0 4 10 0
NZ_CP013007 Xanthomonas citri pv. malvacearum strain XcmN1003 plasmid pXcmN, complete sequence 0 crisprs NA 0 0 6 0

Results visualization

1. NZ_CP013006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013006_1 42450-42748 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013006_2 313125-313207 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013006_3 2187203-2187297 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013006_4 4902826-4903010 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013006_5 5174699-5174774 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013006_5 5.1|5174724|26|NZ_CP013006|CRISPRCasFinder 5174724-5174749 26 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 281142-281167 4 0.846
NZ_CP013006_5 5.1|5174724|26|NZ_CP013006|CRISPRCasFinder 5174724-5174749 26 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 209772-209797 4 0.846
NZ_CP013006_1 1.5|42527|31|NZ_CP013006|CRISPRCasFinder 42527-42557 31 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 934481-934511 6 0.806
NZ_CP013006_1 1.7|42638|34|NZ_CP013006|CRISPRCasFinder 42638-42671 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1614842-1614875 6 0.824
NZ_CP013006_1 1.5|42527|31|NZ_CP013006|CRISPRCasFinder 42527-42557 31 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 150331-150361 7 0.774
NZ_CP013006_1 1.5|42527|31|NZ_CP013006|CRISPRCasFinder 42527-42557 31 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 81610-81640 7 0.774
NZ_CP013006_1 1.7|42638|34|NZ_CP013006|CRISPRCasFinder 42638-42671 34 MH271303 Microbacterium phage MementoMori, complete genome 20739-20772 8 0.765
NZ_CP013006_1 1.7|42638|34|NZ_CP013006|CRISPRCasFinder 42638-42671 34 MN813682 Microbacterium phage Matzah, complete genome 21015-21048 8 0.765
NZ_CP013006_1 1.7|42638|34|NZ_CP013006|CRISPRCasFinder 42638-42671 34 MK937591 Microbacterium phage Cinna, complete genome 21039-21072 8 0.765
NZ_CP013006_1 1.8|42695|31|NZ_CP013006|CRISPRCasFinder 42695-42725 31 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 380719-380749 8 0.742
NZ_CP013006_1 1.7|42638|34|NZ_CP013006|CRISPRCasFinder 42638-42671 34 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 72444-72477 11 0.676
NZ_CP013006_1 1.7|42638|34|NZ_CP013006|CRISPRCasFinder 42638-42671 34 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 22147-22180 12 0.647
NZ_CP013006_1 1.7|42638|34|NZ_CP013006|CRISPRCasFinder 42638-42671 34 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 116465-116498 12 0.647

1. spacer 5.1|5174724|26|NZ_CP013006|CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 4, identity: 0.846

gccgatgtggcgtcggacgactcgcc	CRISPR spacer
gccgatgcggcgtcggacgacgcgaa	Protospacer
*******.************* **  

2. spacer 5.1|5174724|26|NZ_CP013006|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 4, identity: 0.846

gccgatgtggcgtcggacgactcgcc	CRISPR spacer
accgacgtggcgtcggacgcctcgac	Protospacer
.****.************* **** *

3. spacer 1.5|42527|31|NZ_CP013006|CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 6, identity: 0.806

cgcatcggcgacaacgcgcgtaccg-gtggcg	CRISPR spacer
cgcagcggcgacaacgcgcgcaccatcttgc-	Protospacer
**** ***************.***.  * ** 

4. spacer 1.7|42638|34|NZ_CP013006|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ctcgccgagcgcggcagccagatcagtggcggcg-	CRISPR spacer
ttcgtcgagcgcggcagccagatca-tggggctgg	Protospacer
.***.******************** *** * .* 

5. spacer 1.5|42527|31|NZ_CP013006|CRISPRCasFinder matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.774

cgcatcggcgacaacgcgcgtaccggtggcg	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgccg	Protospacer
  **.***************.**** .* **

6. spacer 1.5|42527|31|NZ_CP013006|CRISPRCasFinder matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 7, identity: 0.774

cgcatcggcgacaacgcgcgtaccggtggcg	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgccg	Protospacer
  **.***************.**** .* **

7. spacer 1.7|42638|34|NZ_CP013006|CRISPRCasFinder matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

8. spacer 1.7|42638|34|NZ_CP013006|CRISPRCasFinder matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

9. spacer 1.7|42638|34|NZ_CP013006|CRISPRCasFinder matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

10. spacer 1.8|42695|31|NZ_CP013006|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 8, identity: 0.742

gggctggtgggaaccgagctcggcaagggca	CRISPR spacer
ctgctggtgggaatcgagttcggcaccgcaa	Protospacer
  ***********.****.******  *  *

11. spacer 1.7|42638|34|NZ_CP013006|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 11, identity: 0.676

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
ctcggcgagcgcggcggccagatcctcctccatc	Protospacer
**** **********.********  .  * .. 

12. spacer 1.7|42638|34|NZ_CP013006|CRISPRCasFinder matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 12, identity: 0.647

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtaga	Protospacer
 .**********.****** ******.    . .

13. spacer 1.7|42638|34|NZ_CP013006|CRISPRCasFinder matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 12, identity: 0.647

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtaga	Protospacer
 .**********.****** ******.    . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7532 : 37780 25 Burkholderia_virus(50.0%) integrase,protease,transposase attL 1920:1933|attR 38159:38172
DBSCAN-SWA_2 867140 : 878910 11 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_3 1143515 : 1194058 45 Stenotrophomonas_phage(38.1%) portal,head,transposase,tail,holin,capsid,protease,terminase NA
DBSCAN-SWA_4 1953272 : 1964050 7 Micromonas_pusilla_virus(16.67%) tRNA NA
DBSCAN-SWA_5 2120337 : 2207692 54 uncultured_Caudovirales_phage(47.62%) tRNA,transposase NA
DBSCAN-SWA_6 2287309 : 2345317 44 uncultured_Mediterranean_phage(12.5%) tRNA,transposase,protease NA
DBSCAN-SWA_7 2353245 : 2429231 49 Burkholderia_virus(20.0%) integrase,transposase attL 2354516:2354575|attR 2381017:2381142
DBSCAN-SWA_8 2802265 : 2851680 36 Acinetobacter_phage(20.0%) integrase,protease,tRNA,transposase attL 2825191:2825235|attR 2839340:2839384
DBSCAN-SWA_9 3141749 : 3210224 53 Acinetobacter_phage(13.33%) tRNA,transposase,protease NA
DBSCAN-SWA_10 3770417 : 3841445 59 Leptospira_phage(14.29%) integrase,tRNA,transposase attL 3782476:3782493|attR 3829378:3829395
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP013007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4274 2 Burkholderia_virus(100.0%) transposase NA
DBSCAN-SWA_2 14904 : 15992 1 Leptospira_phage(100.0%) transposase NA
DBSCAN-SWA_3 19868 : 25355 5 Enterobacteria_phage(66.67%) transposase NA
DBSCAN-SWA_4 32480 : 34287 2 Brevibacillus_phage(50.0%) NA NA
DBSCAN-SWA_5 38295 : 39383 1 Leptospira_phage(100.0%) transposase NA
DBSCAN-SWA_6 47527 : 48808 2 Aeromonas_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage