Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012881 Vibrio vulnificus NBRC 15645 = ATCC 27562 chromosome 1, complete sequence 1 crisprs DEDDh,cas5f,DinG,csa3,cas3,RT,WYL,csx1 1 0 4 0
NZ_CP012882 Vibrio vulnificus NBRC 15645 = ATCC 27562 chromosome 2, complete sequence 0 crisprs DEDDh,cas3,csa3,WYL 0 0 0 0

Results visualization

1. NZ_CP012881
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012881_1 1261577-1261734 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP012881_1 1.1|1261632|48|NZ_CP012881|CRISPRCasFinder 1261632-1261679 48 NZ_CP012881.1 1262467-1262514 0 1.0

1. spacer 1.1|1261632|48|NZ_CP012881|CRISPRCasFinder matches to position: 1262467-1262514, mismatch: 0, identity: 1.0

atggatccccgcgttcgcgaggatgacgaggtgagagagtagctaaat	CRISPR spacer
atggatccccgcgttcgcgaggatgacgaggtgagagagtagctaaat	Protospacer
************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 455876 : 500471 29 Bacillus_phage(28.57%) transposase,protease,integrase attL 485040:485055|attR 506788:506803
DBSCAN-SWA_2 787667 : 794375 7 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 873255 : 880309 9 Powai_lake_megavirus(16.67%) NA NA
DBSCAN-SWA_4 2050945 : 2062095 9 uncultured_Mediterranean_phage(25.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage