Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016629 Listeria monocytogenes strain FORC_049 chromosome, complete genome 1 crisprs DinG,cas3,WYL,casR,DEDDh,csa3 1 0 7 0

Results visualization

1. NZ_CP016629
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016629_1 521283-521867 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP016629_1 1.2|521400|39|NZ_CP016629|CRT 521400-521438 39 NZ_CP016629.1 2130599-2130637 0 1.0

1. spacer 1.2|521400|39|NZ_CP016629|CRT matches to position: 2130599-2130637, mismatch: 0, identity: 1.0

tcttacatgttttatgataatagaaaccttgaggtgctg	CRISPR spacer
tcttacatgttttatgataatagaaaccttgaggtgctg	Protospacer
***************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 82714 : 90559 9 Listeria_phage(87.5%) holin NA
DBSCAN-SWA_2 132170 : 138697 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_3 1132225 : 1161286 32 Streptococcus_phage(66.67%) transposase,integrase attL 1118080:1118094|attR 1143325:1143339
DBSCAN-SWA_4 1306504 : 1363354 56 Bacillus_virus(16.67%) protease,tRNA NA
DBSCAN-SWA_5 1854443 : 1862729 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 2539456 : 2547298 7 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_7 2828875 : 2838899 6 Tupanvirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage