Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017060 Bacillus cereus strain FORC_047 chromosome, complete genome 4 crisprs cas3,cas14k,csa3,WYL,c2c10_CAS-V-U3,DinG,cas14j,DEDDh,c2c9_V-U4 4 3 8 0
NZ_CP018742 Bacillus cereus strain FORC_047 plasmid pFORC47_2, complete sequence 1 crisprs csa3,cas14j 0 1 0 0
NZ_CP018741 Bacillus cereus strain FORC_047 plasmid pFORC47_1, complete sequence 0 crisprs cas14j,csa3 0 0 2 0

Results visualization

1. NZ_CP017060
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017060_1 1081179-1081288 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017060_2 1788533-1788608 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017060_3 2295375-2295468 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017060_4 3654118-3654396 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 NZ_CP017060.1 3654487-3654522 0 1.0
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 NZ_CP017060.1 3653704-3653739 1 0.972
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 NZ_CP017060.1 3654037-3654072 2 0.944
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 NZ_CP017060.1 3654694-3654729 2 0.944
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 NZ_CP017060.1 3655135-3655170 2 0.944
NZ_CP017060_4 4.2|3654226|18|NZ_CP017060|CRT 3654226-3654243 18 NZ_CP017060.1 3653614-3653631 0 1.0
NZ_CP017060_4 4.2|3654226|18|NZ_CP017060|CRT 3654226-3654243 18 NZ_CP017060.1 3653659-3653676 0 1.0
NZ_CP017060_4 4.2|3654226|18|NZ_CP017060|CRT 3654226-3654243 18 NZ_CP017060.1 3653767-3653784 0 1.0
NZ_CP017060_4 4.2|3654226|18|NZ_CP017060|CRT 3654226-3654243 18 NZ_CP017060.1 3653812-3653829 0 1.0
NZ_CP017060_4 4.2|3654226|18|NZ_CP017060|CRT 3654226-3654243 18 NZ_CP017060.1 3653857-3653874 0 1.0
NZ_CP017060_4 4.2|3654226|18|NZ_CP017060|CRT 3654226-3654243 18 NZ_CP017060.1 3654100-3654117 0 1.0
NZ_CP017060_4 4.2|3654226|18|NZ_CP017060|CRT 3654226-3654243 18 NZ_CP017060.1 3654433-3654450 0 1.0
NZ_CP017060_4 4.2|3654226|18|NZ_CP017060|CRT 3654226-3654243 18 NZ_CP017060.1 3654595-3654612 0 1.0
NZ_CP017060_4 4.2|3654226|18|NZ_CP017060|CRT 3654226-3654243 18 NZ_CP017060.1 3655000-3655017 0 1.0
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_CP017060.1 3653902-3653928 0 1.0
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_CP017060.1 3654055-3654081 0 1.0
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_CP017060.1 3654505-3654531 0 1.0
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_CP017060.1 3654640-3654666 0 1.0
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_CP017060.1 3653947-3653973 1 0.963
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_CP017060.1 3654712-3654738 1 0.963
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_CP017060.1 3653992-3654018 2 0.926
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_CP017060.1 3654793-3654819 2 0.926
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_CP017060.1 3654847-3654873 2 0.926
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_CP017060.1 3655036-3655062 2 0.926
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_CP017060.1 3655090-3655116 2 0.926
NZ_CP017060_4 4.4|3654343|18|NZ_CP017060|CRT 3654343-3654360 18 NZ_CP017060.1 3653614-3653631 1 0.944
NZ_CP017060_4 4.4|3654343|18|NZ_CP017060|CRT 3654343-3654360 18 NZ_CP017060.1 3653659-3653676 1 0.944
NZ_CP017060_4 4.4|3654343|18|NZ_CP017060|CRT 3654343-3654360 18 NZ_CP017060.1 3653767-3653784 1 0.944
NZ_CP017060_4 4.4|3654343|18|NZ_CP017060|CRT 3654343-3654360 18 NZ_CP017060.1 3653812-3653829 1 0.944
NZ_CP017060_4 4.4|3654343|18|NZ_CP017060|CRT 3654343-3654360 18 NZ_CP017060.1 3653857-3653874 1 0.944
NZ_CP017060_4 4.4|3654343|18|NZ_CP017060|CRT 3654343-3654360 18 NZ_CP017060.1 3654100-3654117 1 0.944
NZ_CP017060_4 4.4|3654343|18|NZ_CP017060|CRT 3654343-3654360 18 NZ_CP017060.1 3654433-3654450 1 0.944
NZ_CP017060_4 4.4|3654343|18|NZ_CP017060|CRT 3654343-3654360 18 NZ_CP017060.1 3654595-3654612 1 0.944
NZ_CP017060_4 4.4|3654343|18|NZ_CP017060|CRT 3654343-3654360 18 NZ_CP017060.1 3655000-3655017 1 0.944

1. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to position: 3654487-3654522, mismatch: 0, identity: 1.0

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctactggtgctactggacctca	Protospacer
************************************

2. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to position: 3653704-3653739, mismatch: 1, identity: 0.972

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctactggcgctactggacctca	Protospacer
*********************.**************

3. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to position: 3654037-3654072, mismatch: 2, identity: 0.944

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctaccggcgctactggtgctactggacctca	Protospacer
*********.**.***********************

4. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to position: 3654694-3654729, mismatch: 2, identity: 0.944

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctaccggcgctactggtgctactggacctca	Protospacer
*********.**.***********************

5. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to position: 3655135-3655170, mismatch: 2, identity: 0.944

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggcgctactggcgctactggacctca	Protospacer
************.********.**************

6. spacer 4.2|3654226|18|NZ_CP017060|CRT matches to position: 3653614-3653631, mismatch: 0, identity: 1.0

cggcgctactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
******************

7. spacer 4.2|3654226|18|NZ_CP017060|CRT matches to position: 3653659-3653676, mismatch: 0, identity: 1.0

cggcgctactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
******************

8. spacer 4.2|3654226|18|NZ_CP017060|CRT matches to position: 3653767-3653784, mismatch: 0, identity: 1.0

cggcgctactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
******************

9. spacer 4.2|3654226|18|NZ_CP017060|CRT matches to position: 3653812-3653829, mismatch: 0, identity: 1.0

cggcgctactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
******************

10. spacer 4.2|3654226|18|NZ_CP017060|CRT matches to position: 3653857-3653874, mismatch: 0, identity: 1.0

cggcgctactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
******************

11. spacer 4.2|3654226|18|NZ_CP017060|CRT matches to position: 3654100-3654117, mismatch: 0, identity: 1.0

cggcgctactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
******************

12. spacer 4.2|3654226|18|NZ_CP017060|CRT matches to position: 3654433-3654450, mismatch: 0, identity: 1.0

cggcgctactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
******************

13. spacer 4.2|3654226|18|NZ_CP017060|CRT matches to position: 3654595-3654612, mismatch: 0, identity: 1.0

cggcgctactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
******************

14. spacer 4.2|3654226|18|NZ_CP017060|CRT matches to position: 3655000-3655017, mismatch: 0, identity: 1.0

cggcgctactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
******************

15. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to position: 3653902-3653928, mismatch: 0, identity: 1.0

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcagggtgttca	Protospacer
***************************

16. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to position: 3654055-3654081, mismatch: 0, identity: 1.0

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcagggtgttca	Protospacer
***************************

17. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to position: 3654505-3654531, mismatch: 0, identity: 1.0

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcagggtgttca	Protospacer
***************************

18. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to position: 3654640-3654666, mismatch: 0, identity: 1.0

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcagggtgttca	Protospacer
***************************

19. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to position: 3653947-3653973, mismatch: 1, identity: 0.963

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcaaggtgttca	Protospacer
******************.********

20. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to position: 3654712-3654738, mismatch: 1, identity: 0.963

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcagggtgctca	Protospacer
***********************.***

21. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to position: 3653992-3654018, mismatch: 2, identity: 0.926

tggtgctactggacctcagggtgttca	CRISPR spacer
tggcgctactggacctcagggcgttca	Protospacer
***.*****************.*****

22. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to position: 3654793-3654819, mismatch: 2, identity: 0.926

tggtgctactggacctcagggtgttca	CRISPR spacer
tggcgctactggacctcaaggtgttca	Protospacer
***.**************.********

23. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to position: 3654847-3654873, mismatch: 2, identity: 0.926

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgccactggacctcaaggtgttca	Protospacer
******.***********.********

24. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to position: 3655036-3655062, mismatch: 2, identity: 0.926

tggtgctactggacctcagggtgttca	CRISPR spacer
tggcgctactggacctcaaggtgttca	Protospacer
***.**************.********

25. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to position: 3655090-3655116, mismatch: 2, identity: 0.926

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgccactggacctcaaggtgttca	Protospacer
******.***********.********

26. spacer 4.4|3654343|18|NZ_CP017060|CRT matches to position: 3653614-3653631, mismatch: 1, identity: 0.944

cggcactactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
****.*************

27. spacer 4.4|3654343|18|NZ_CP017060|CRT matches to position: 3653659-3653676, mismatch: 1, identity: 0.944

cggcactactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
****.*************

28. spacer 4.4|3654343|18|NZ_CP017060|CRT matches to position: 3653767-3653784, mismatch: 1, identity: 0.944

cggcactactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
****.*************

29. spacer 4.4|3654343|18|NZ_CP017060|CRT matches to position: 3653812-3653829, mismatch: 1, identity: 0.944

cggcactactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
****.*************

30. spacer 4.4|3654343|18|NZ_CP017060|CRT matches to position: 3653857-3653874, mismatch: 1, identity: 0.944

cggcactactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
****.*************

31. spacer 4.4|3654343|18|NZ_CP017060|CRT matches to position: 3654100-3654117, mismatch: 1, identity: 0.944

cggcactactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
****.*************

32. spacer 4.4|3654343|18|NZ_CP017060|CRT matches to position: 3654433-3654450, mismatch: 1, identity: 0.944

cggcactactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
****.*************

33. spacer 4.4|3654343|18|NZ_CP017060|CRT matches to position: 3654595-3654612, mismatch: 1, identity: 0.944

cggcactactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
****.*************

34. spacer 4.4|3654343|18|NZ_CP017060|CRT matches to position: 3655000-3655017, mismatch: 1, identity: 0.944

cggcactactggacctca	CRISPR spacer
cggcgctactggacctca	Protospacer
****.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 AP013411 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43 29813-29848 2 0.944
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 AP013669 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS *** 3657-3692 2 0.944
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 MN693405 Marine virus AFVG_25M416, complete genome 18961-18996 2 0.944
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 MN693333 Marine virus AFVG_25M417, complete genome 18961-18996 2 0.944
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP009695 Bacillus anthracis strain RA3 plasmid pXO2, complete sequence 62014-62043 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP009542 Bacillus anthracis strain BA1015 plasmid pXO2, complete sequence 87575-87604 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP010320 Bacillus anthracis strain Canadian Bison isolate A0369 plasmid 2, complete sequence 58751-58780 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP009326 Bacillus anthracis strain Vollum 1B plasmid 2, complete sequence 87544-87573 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP009979 Bacillus anthracis strain Ames isolate BACI008 plasmid unnamed2, complete sequence 31718-31747 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_KU525621 Bacillus anthracis strain P.NO2 plasmid pXO2, complete sequence 41548-41577 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NC_014332 Bacillus cereus biovar anthracis str. CI plasmid pCI-XO2, complete sequence 42285-42314 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NC_012577 Bacillus anthracis str. CDC 684 plasmid pX02, complete sequence 40191-40220 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP015778 Bacillus anthracis strain Tangail-1 plasmid pXO2, complete sequence 41763-41792 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP018905 Bacillus anthracis strain Tyrol 4675 plasmid pXO2, complete sequence 42117-42146 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP023003 Bacillus anthracis strain 14RA5914 plasmid pX02, complete sequence 71972-72001 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_AP019733 Bacillus anthracis strain PCr plasmid PCr-pXO2 77769-77798 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_AP018445 Bacillus anthracis strain CZC5 plasmid pXO2, complete sequence 41768-41797 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP029325 Bacillus anthracis strain 17OD930 plasmid pXO2, complete sequence 30062-30091 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NC_012655 Bacillus anthracis str. A0248 plasmid pXO2, complete sequence 42806-42835 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NC_007323 Bacillus anthracis str. 'Ames Ancestor' plasmid pXO2, complete sequence 41763-41792 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP010854 Bacillus anthracis strain A1144 plasmid pXO2, complete sequence 41931-41960 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP007617 Bacillus anthracis strain 2000031021 plasmid pXO2, complete sequence 17312-17341 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP008848 Bacillus anthracis strain HYU01 plasmid pX02, complete sequence 41696-41725 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP006744 Bacillus anthracis str. SVA11 plasmid pXO2, complete sequence 41728-41757 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_AP014835 Bacillus anthracis strain Shikan-NIID plasmid pXO2 41760-41789 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP029807 Bacillus anthracis strain London_499 plasmid pX02, complete sequence 41761-41790 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NC_002146 Bacillus anthracis plasmid pXO2, complete sequence 42261-42290 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NC_017727 Bacillus anthracis str. H9401 plasmid BAP2, complete sequence 41771-41800 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP009314 Bacillus anthracis str. Turkey32 strain 35 plasmid unnamed, complete sequence 48618-48647 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP014178 Bacillus anthracis strain Stendal plasmid pXO2, complete sequence 41763-41792 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP009475 Bacillus anthracis strain Pasteur plasmid pXO2, complete sequence 64277-64306 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP009900 Bacillus anthracis strain 2002013094 plasmid pXO2, complete sequence 26769-26798 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP009339 Bacillus anthracis strain Ohio ACB plasmid 2, complete sequence 61053-61082 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP009462 Bacillus anthracis strain SK-102 plasmid pXO2, complete sequence 69364-69393 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP009698 Bacillus anthracis strain BA1035 plasmid pXO2, complete sequence 38976-39005 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP009329 Bacillus anthracis strain K3 plasmid 2, complete sequence 76044-76073 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP001972 Bacillus anthracis str. A16 plasmid pXO2, complete sequence 41761-41790 4 0.867
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP047133 Bacillus anthracis str. BF1 plasmid pXO2, complete sequence 41704-41733 4 0.867
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 MN693092 Marine virus AFVG_25M37, complete genome 19117-19143 4 0.852
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 MN101228 Klebsiella phage KPN4, complete genome 23865-23891 4 0.852
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 MN694808 Marine virus AFVG_250M14, complete genome 26241-26267 4 0.852
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 MN693618 Marine virus AFVG_250M106, complete genome 26271-26297 4 0.852
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP053937 Bacillus thuringiensis strain FDAARGOS_792 plasmid unnamed, complete sequence 73751-73780 5 0.833
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP034684 Bacillus sp. BD59S plasmid pBTBD59S1, complete sequence 159656-159685 5 0.833
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP034685 Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence 179280-179309 5 0.833
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP042875 Bacillus cereus strain 09 plasmid unnamed1, complete sequence 128480-128509 5 0.833
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NZ_CP010087 Bacillus thuringiensis strain 97-27 plasmid unnamed, complete sequence 58552-58581 5 0.833
NZ_CP017060_2 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder 1788556-1788585 30 NC_006578 [Bacillus thuringiensis] serovar konkukian str. 97-27 plasmid pBT9727, complete sequence 36922-36951 5 0.833
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 76452-76478 5 0.815
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83700-83726 5 0.815
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 80957-80983 5 0.815
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88205-88231 5 0.815
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2031953-2031979 5 0.815
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1926-1961 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 MN693099 Marine virus AFVG_25M184, complete genome 13918-13953 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019095 Synechococcus phage ACG-2014f isolate Syn7803US34, complete genome 14786-14821 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019103 Synechococcus phage ACG-2014f isolate Syn7803US44, complete genome 15091-15126 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019066 Synechococcus phage ACG-2014f isolate Syn7803C9, complete genome 14554-14589 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019105 Synechococcus phage ACG-2014f isolate Syn7803US4, complete genome 14554-14589 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019098 Synechococcus phage ACG-2014f isolate Syn7803US39, complete genome 14557-14592 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019150 Synechococcus phage ACG-2014f isolate Syn7803C22, complete genome 14554-14589 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 NC_026927 Synechococcus phage ACG-2014f isolate Syn7803C90, complete genome 14554-14589 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019097 Synechococcus phage ACG-2014f isolate Syn7803US37, complete genome 14554-14589 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019045 Synechococcus phage ACG-2014f isolate Syn7803C6, complete genome 14554-14589 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019037 Synechococcus phage ACG-2014f isolate Syn7803C58, complete genome 14554-14589 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019053 Synechococcus phage ACG-2014f isolate Syn7803C80, complete genome 14557-14592 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019096 Synechococcus phage ACG-2014f isolate Syn7803US36, complete genome 15207-15242 6 0.833
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KJ019145 Synechococcus phage ACG-2014f isolate Syn7803C15, complete genome 14515-14550 6 0.833
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 13201-13227 6 0.778
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 HQ615693 Synechococcus phage S-CRM01, complete genome 25959-25985 6 0.778
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 13204-13230 6 0.778
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 13201-13227 6 0.778
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 GU323708 Lactobacillus phage phiPYB5, complete genome 19366-19392 6 0.778
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 MN693099 Marine virus AFVG_25M184, complete genome 13864-13890 6 0.778
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 MN163280 Klebsiella phage KpGranit, complete genome 83358-83384 6 0.778
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 MN163280 Klebsiella phage KpGranit, complete genome 84561-84587 6 0.778
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1962-1997 7 0.806
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 15013-15048 7 0.806
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 15016-15051 7 0.806
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 15013-15048 7 0.806
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 NC_011247 Borrelia duttonii Ly plasmid pl165, complete sequence 9165-9200 7 0.806
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 MN693189 Marine virus AFVG_25M326, complete genome 18918-18944 7 0.741
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 AP013669 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS *** 3984-4010 7 0.741
NZ_CP017060_4 4.3|3654280|27|NZ_CP017060|CRT 3654280-3654306 27 AP013411 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43 29495-29521 7 0.741
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 16723-16758 8 0.778
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 179507-179542 8 0.778
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 17641-17676 8 0.778
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 182004-182039 8 0.778
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 MH616795 Microviridae sp. isolate ctbh757, complete genome 1056-1091 8 0.778
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 MK521907 Klebsiella phage vB_KpnS_FZ41, complete genome 71434-71469 8 0.778
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 NC_021536 Synechococcus phage S-IOM18 genomic sequence 14771-14806 9 0.75
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 MN871511 UNVERIFIED: Vibrio phage vspsw1, complete genome 92878-92913 9 0.75
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 MN871505 UNVERIFIED: Vibrio phage ValDsh2, complete genome 111515-111550 9 0.75
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 MN871510 UNVERIFIED: Vibrio phage valsw3, complete genome 81443-81478 9 0.75
NZ_CP017060_4 4.1|3654154|36|NZ_CP017060|CRT 3654154-3654189 36 MH925094 UNVERIFIED: Vibrio phage VspSw_1, complete genome 111355-111390 9 0.75

1. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to AP013411 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43) position: , mismatch: 2, identity: 0.944

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
aggtgctactggtgctactggtgcaactggacctca	Protospacer
 *********************** ***********

2. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to AP013669 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 2, identity: 0.944

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
aggtgctactggtgctactggtgcaactggacctca	Protospacer
 *********************** ***********

3. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to MN693405 (Marine virus AFVG_25M416, complete genome) position: , mismatch: 2, identity: 0.944

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctactggagctactggccctca	Protospacer
********************* ******** *****

4. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to MN693333 (Marine virus AFVG_25M417, complete genome) position: , mismatch: 2, identity: 0.944

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctactggagctactggccctca	Protospacer
********************* ******** *****

5. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP009695 (Bacillus anthracis strain RA3 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

6. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP009542 (Bacillus anthracis strain BA1015 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

7. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP010320 (Bacillus anthracis strain Canadian Bison isolate A0369 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

8. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP009326 (Bacillus anthracis strain Vollum 1B plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

9. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP009979 (Bacillus anthracis strain Ames isolate BACI008 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

10. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_KU525621 (Bacillus anthracis strain P.NO2 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

11. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NC_014332 (Bacillus cereus biovar anthracis str. CI plasmid pCI-XO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

12. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NC_012577 (Bacillus anthracis str. CDC 684 plasmid pX02, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

13. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP015778 (Bacillus anthracis strain Tangail-1 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

14. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP018905 (Bacillus anthracis strain Tyrol 4675 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

15. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP023003 (Bacillus anthracis strain 14RA5914 plasmid pX02, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

16. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_AP019733 (Bacillus anthracis strain PCr plasmid PCr-pXO2) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

17. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_AP018445 (Bacillus anthracis strain CZC5 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

18. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP029325 (Bacillus anthracis strain 17OD930 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

19. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NC_012655 (Bacillus anthracis str. A0248 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

20. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NC_007323 (Bacillus anthracis str. 'Ames Ancestor' plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

21. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP010854 (Bacillus anthracis strain A1144 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

22. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP007617 (Bacillus anthracis strain 2000031021 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

23. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP008848 (Bacillus anthracis strain HYU01 plasmid pX02, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

24. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP006744 (Bacillus anthracis str. SVA11 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

25. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_AP014835 (Bacillus anthracis strain Shikan-NIID plasmid pXO2) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

26. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP029807 (Bacillus anthracis strain London_499 plasmid pX02, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

27. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NC_002146 (Bacillus anthracis plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

28. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NC_017727 (Bacillus anthracis str. H9401 plasmid BAP2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

29. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP009314 (Bacillus anthracis str. Turkey32 strain 35 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

30. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP014178 (Bacillus anthracis strain Stendal plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

31. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP009475 (Bacillus anthracis strain Pasteur plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

32. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP009900 (Bacillus anthracis strain 2002013094 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

33. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP009339 (Bacillus anthracis strain Ohio ACB plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

34. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP009462 (Bacillus anthracis strain SK-102 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

35. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP009698 (Bacillus anthracis strain BA1035 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

36. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP009329 (Bacillus anthracis strain K3 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

37. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP001972 (Bacillus anthracis str. A16 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

38. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP047133 (Bacillus anthracis str. BF1 plasmid pXO2, complete sequence) position: , mismatch: 4, identity: 0.867

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattgaataaaagcaata	Protospacer
********************.****..**.

39. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 4, identity: 0.852

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcaaggtgctac	Protospacer
******************.****.*  

40. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggtcctcagggtccaca	Protospacer
************ ********* . **

41. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to MN694808 (Marine virus AFVG_250M14, complete genome) position: , mismatch: 4, identity: 0.852

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggaactcagggtataga	Protospacer
************* ********.*  *

42. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to MN693618 (Marine virus AFVG_250M106, complete genome) position: , mismatch: 4, identity: 0.852

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggaactcagggtataga	Protospacer
************* ********.*  *

43. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP053937 (Bacillus thuringiensis strain FDAARGOS_792 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattaaataaaaggaata	Protospacer
****************.***.**** .**.

44. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP034684 (Bacillus sp. BD59S plasmid pBTBD59S1, complete sequence) position: , mismatch: 5, identity: 0.833

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattaaataaaaggaata	Protospacer
****************.***.**** .**.

45. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP034685 (Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence) position: , mismatch: 5, identity: 0.833

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattaaataaaaggaata	Protospacer
****************.***.**** .**.

46. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP042875 (Bacillus cereus strain 09 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattaaataaaaggaata	Protospacer
****************.***.**** .**.

47. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NZ_CP010087 (Bacillus thuringiensis strain 97-27 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattaaataaaaggaata	Protospacer
****************.***.**** .**.

48. spacer 2.1|1788556|30|NZ_CP017060|CRISPRCasFinder matches to NC_006578 ([Bacillus thuringiensis] serovar konkukian str. 97-27 plasmid pBT9727, complete sequence) position: , mismatch: 5, identity: 0.833

tatgacatatgcaattgaatgaaagtgatg	CRISPR spacer
tatgacatatgcaattaaataaaaggaata	Protospacer
****************.***.**** .**.

49. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 5, identity: 0.815

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggtcctcagggtaacaa	Protospacer
************ *********. . *

50. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 5, identity: 0.815

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggaccgcagggaccaca	Protospacer
*************** *****  . **

51. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 5, identity: 0.815

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggtcctcagggtaacaa	Protospacer
************ *********. . *

52. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 5, identity: 0.815

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggaccgcagggaccaca	Protospacer
*************** *****  . **

53. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcatgctgcccg	Protospacer
****************** * **..*.

54. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggcgctactggcgctactggcgctac	Protospacer
************.********.********  **  

55. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to MN693099 (Marine virus AFVG_25M184, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctactgggtctactggagcaac	Protospacer
*********************  ******** *   

56. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019095 (Synechococcus phage ACG-2014f isolate Syn7803US34, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

57. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019103 (Synechococcus phage ACG-2014f isolate Syn7803US44, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

58. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019066 (Synechococcus phage ACG-2014f isolate Syn7803C9, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

59. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019105 (Synechococcus phage ACG-2014f isolate Syn7803US4, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

60. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019098 (Synechococcus phage ACG-2014f isolate Syn7803US39, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

61. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019150 (Synechococcus phage ACG-2014f isolate Syn7803C22, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

62. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to NC_026927 (Synechococcus phage ACG-2014f isolate Syn7803C90, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

63. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019097 (Synechococcus phage ACG-2014f isolate Syn7803US37, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

64. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019045 (Synechococcus phage ACG-2014f isolate Syn7803C6, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

65. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019037 (Synechococcus phage ACG-2014f isolate Syn7803C58, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

66. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019053 (Synechococcus phage ACG-2014f isolate Syn7803C80, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

67. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019096 (Synechococcus phage ACG-2014f isolate Syn7803US36, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

68. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KJ019145 (Synechococcus phage ACG-2014f isolate Syn7803C15, complete genome) position: , mismatch: 6, identity: 0.833

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctgatggtgctactggttctac	Protospacer
****************. ************ .**  

69. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggtcctcaaggtgagtt	Protospacer
************ *****.****  . 

70. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to HQ615693 (Synechococcus phage S-CRM01, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctactggacctcagggtgttca	CRISPR spacer
aggtgatactggacctcaaggtgtaac	Protospacer
 **** ************.*****   

71. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggtcctcaaggtgagtt	Protospacer
************ *****.****  . 

72. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggtcctcaaggtgagtt	Protospacer
************ *****.****  . 

73. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to GU323708 (Lactobacillus phage phiPYB5, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggaccacaggggcctgt	Protospacer
*************** *****  .*  

74. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to MN693099 (Marine virus AFVG_25M184, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcaaggacctac	Protospacer
******************.**  .*  

75. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to MN163280 (Klebsiella phage KpGranit, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctactggacctcagggtgttca	CRISPR spacer
aggtgctactggtcctcagggtaacaa	Protospacer
 *********** *********. . *

76. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to MN163280 (Klebsiella phage KpGranit, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctactggacctcagggtgttca	CRISPR spacer
aggtgctactggtcctcagggtaacaa	Protospacer
 *********** *********. . *

77. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.806

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
cggtgctactggcgctactggcgctactggagatac	Protospacer
.***********.********.*********  *  

78. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 7, identity: 0.806

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
cgatcctggtggtgctactggtgctactggtcttca	Protospacer
.*.* **. ********************* *.***

79. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 7, identity: 0.806

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
cgatcctggtggtgctactggtgctactggtcttca	Protospacer
.*.* **. ********************* *.***

80. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 7, identity: 0.806

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
cgatcctggtggtgctactggtgctactggtcttca	Protospacer
.*.* **. ********************* *.***

81. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to NC_011247 (Borrelia duttonii Ly plasmid pl165, complete sequence) position: , mismatch: 7, identity: 0.806

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactgctgctcctggtgctactgctgttcc	Protospacer
*********** **** ************   .** 

82. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to MN693189 (Marine virus AFVG_25M326, complete genome) position: , mismatch: 7, identity: 0.741

tggtgctactggacctcagggtgttca	CRISPR spacer
aggtgctactggacctcaaggtccagc	Protospacer
 *****************.*** .   

83. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to AP013669 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.741

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcaaggaccagc	Protospacer
******************.**  .   

84. spacer 4.3|3654280|27|NZ_CP017060|CRT matches to AP013411 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43) position: , mismatch: 7, identity: 0.741

tggtgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcaaggaccagc	Protospacer
******************.**  .   

85. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 8, identity: 0.778

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
gggtgctactggggctactggagctactggaatgtt	Protospacer
 *********** ******** ********* . . 

86. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 8, identity: 0.778

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgcttctggtgctactggtcctaaaggtgacca	Protospacer
******* ************** ***  **   .**

87. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 8, identity: 0.778

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
gggtgctactggggctactggagctactggaatgtt	Protospacer
 *********** ******** ********* . . 

88. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 8, identity: 0.778

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgcttctggtgctactggtcctaaaggtgacca	Protospacer
******* ************** ***  **   .**

89. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to MH616795 (Microviridae sp. isolate ctbh757, complete genome) position: , mismatch: 8, identity: 0.778

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tggtgctactggtgctactggcactacttctccgtt	Protospacer
*********************..*****   ** . 

90. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to MK521907 (Klebsiella phage vB_KpnS_FZ41, complete genome) position: , mismatch: 8, identity: 0.778

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
cggcgagaaaggggctactggtgctactggtcctca	Protospacer
.**.*  *  ** ***************** *****

91. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 9, identity: 0.75

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
taacatcagtggtgttactggttctactggacctca	Protospacer
*......* *****.******* *************

92. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to MN871511 (UNVERIFIED: Vibrio phage vspsw1, complete genome) position: , mismatch: 9, identity: 0.75

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tgcccttactggtggtactggtgctcctggacaaga	Protospacer
** . .******** ********** ******   *

93. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to MN871505 (UNVERIFIED: Vibrio phage ValDsh2, complete genome) position: , mismatch: 9, identity: 0.75

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tgcccttactggtggtactggtgctcctggacaaga	Protospacer
** . .******** ********** ******   *

94. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to MN871510 (UNVERIFIED: Vibrio phage valsw3, complete genome) position: , mismatch: 9, identity: 0.75

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tgcccttactggtggtactggtgctcctggacaaga	Protospacer
** . .******** ********** ******   *

95. spacer 4.1|3654154|36|NZ_CP017060|CRT matches to MH925094 (UNVERIFIED: Vibrio phage VspSw_1, complete genome) position: , mismatch: 9, identity: 0.75

tggtgctactggtgctactggtgctactggacctca	CRISPR spacer
tgcccttactggtggtactggtgctcctggacaaga	Protospacer
** . .******** ********** ******   *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 254964 : 262915 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_2 306806 : 315182 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 1857001 : 1865820 8 Bacillus_phage(71.43%) NA NA
DBSCAN-SWA_4 2506271 : 2578151 85 Bacillus_phage(63.04%) capsid,bacteriocin,head,tail,terminase,integrase,holin,protease,portal attL 2517480:2517499|attR 2583563:2583582
DBSCAN-SWA_5 2585263 : 2590487 9 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_6 3634125 : 3644297 13 Bacillus_phage(50.0%) bacteriocin NA
DBSCAN-SWA_7 4432005 : 4439689 10 Staphylococcus_phage(16.67%) NA NA
DBSCAN-SWA_8 4832551 : 4874358 52 Prochlorococcus_phage(16.67%) coat,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP018742
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018742_1 109135-109233 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018742_1 1.1|109159|51|NZ_CP018742|CRISPRCasFinder 109159-109209 51 NZ_CP018742 Bacillus cereus strain FORC_047 plasmid pFORC47_2, complete sequence 109159-109209 0 1.0

1. spacer 1.1|109159|51|NZ_CP018742|CRISPRCasFinder matches to NZ_CP018742 (Bacillus cereus strain FORC_047 plasmid pFORC47_2, complete sequence) position: , mismatch: 0, identity: 1.0

caacgacctgattatatttctgttgatggaagcacaggattggttactctg	CRISPR spacer
caacgacctgattatatttctgttgatggaagcacaggattggttactctg	Protospacer
***************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP018741
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 24331 : 89606 57 Bacillus_phage(40.0%) transposase,integrase attL 18160:18175|attR 42740:42755
DBSCAN-SWA_2 149090 : 179702 24 Bacillus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage