Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016278 Diaphorobacter polyhydroxybutyrativorans strain SL-205 chromosome, complete genome 1 crisprs DEDDh,csa3,DinG,WYL 0 1 4 0

Results visualization

1. NZ_CP016278
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016278_1 1080310-1080387 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016278_1 1.1|1080334|30|NZ_CP016278|CRISPRCasFinder 1080334-1080363 30 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 452784-452813 5 0.833
NZ_CP016278_1 1.1|1080334|30|NZ_CP016278|CRISPRCasFinder 1080334-1080363 30 NZ_CP044989 Deinococcus sp. AJ005 plasmid p380k, complete sequence 71268-71297 6 0.8
NZ_CP016278_1 1.1|1080334|30|NZ_CP016278|CRISPRCasFinder 1080334-1080363 30 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 39322-39351 7 0.767

1. spacer 1.1|1080334|30|NZ_CP016278|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 5, identity: 0.833

----gattcctgcacctgcacgccccagtcggtg	CRISPR spacer
cggagatt----cacctccacgccccagtcggtg	Protospacer
    ****    ***** ****************

2. spacer 1.1|1080334|30|NZ_CP016278|CRISPRCasFinder matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 6, identity: 0.8

-gattcctgcacctgcacgccccagtcggtg	CRISPR spacer
cggatgttg-acctccacgccccagtcggtg	Protospacer
 *. * .** **** ****************

3. spacer 1.1|1080334|30|NZ_CP016278|CRISPRCasFinder matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 7, identity: 0.767

gattcctgcacctgcacgccccagtcggtg	CRISPR spacer
cgctcgagcgcctgcacgccccagtcggcg	Protospacer
 ..**  **.******************.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1823283 : 1831815 11 Ralstonia_virus(66.67%) NA NA
DBSCAN-SWA_2 2464533 : 2473500 7 Roseobacter_phage(16.67%) NA NA
DBSCAN-SWA_3 2868443 : 2881248 11 Acinetobacter_phage(37.5%) NA NA
DBSCAN-SWA_4 3446867 : 3474518 41 Burkholderia_phage(33.33%) integrase,head,transposase attL 3440239:3440255|attR 3473483:3473499
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage