Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022140 Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP022141 Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP022139 Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K chromosome, complete genome 2 crisprs PD-DExK,WYL,csa3,cas3,cas1,DEDDh,DinG 13 38 8 2

Results visualization

1. NZ_CP022141
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP022140
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17666 : 67280 32 uncultured_virus(23.08%) transposase,bacteriocin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP022139
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022139_1 1045037-1047079 Orphan I-E
33 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022139_2 1055126-1055703 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP022139_1 1.12|1045736|33|NZ_CP022139|PILER-CR 1045736-1045768 33 NZ_CP022141.1 27378-27410 0 1.0
NZ_CP022139_1 1.25|1046530|33|NZ_CP022139|PILER-CR 1046530-1046562 33 NZ_CP022139.1 1662710-1662742 0 1.0
NZ_CP022139_1 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT 1045737-1045768 32 NZ_CP022141.1 27379-27410 0 1.0
NZ_CP022139_1 1.57|1046531|32|NZ_CP022139|CRISPRCasFinder,CRT 1046531-1046562 32 NZ_CP022139.1 1662711-1662742 0 1.0
NZ_CP022139_1 1.65|1047019|32|NZ_CP022139|CRISPRCasFinder,CRT 1047019-1047050 32 NZ_CP022139.1 4655754-4655785 0 1.0
NZ_CP022139_2 2.1|1055154|33|NZ_CP022139|PILER-CR 1055154-1055186 33 NZ_CP022139.1 2562345-2562377 0 1.0
NZ_CP022139_2 2.5|1055398|33|NZ_CP022139|PILER-CR 1055398-1055430 33 NZ_CP022141.1 56955-56987 0 1.0
NZ_CP022139_2 2.8|1055581|33|NZ_CP022139|PILER-CR 1055581-1055613 33 NZ_CP022141.1 53621-53653 0 1.0
NZ_CP022139_2 2.10|1055155|32|NZ_CP022139|CRISPRCasFinder,CRT 1055155-1055186 32 NZ_CP022139.1 2562346-2562377 0 1.0
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 NZ_CP022141.1 56955-56986 0 1.0
NZ_CP022139_2 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT 1055582-1055613 32 NZ_CP022141.1 53621-53652 0 1.0
NZ_CP022139_1 1.26|1046591|33|NZ_CP022139|PILER-CR 1046591-1046623 33 NZ_CP022139.1 1649667-1649699 2 0.939
NZ_CP022139_1 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT 1046592-1046623 32 NZ_CP022139.1 1649668-1649699 2 0.938

1. spacer 1.12|1045736|33|NZ_CP022139|PILER-CR matches to position: 27378-27410, mismatch: 0, identity: 1.0

gggactaaatcgcagatactgctgtccagagca	CRISPR spacer
gggactaaatcgcagatactgctgtccagagca	Protospacer
*********************************

2. spacer 1.25|1046530|33|NZ_CP022139|PILER-CR matches to position: 1662710-1662742, mismatch: 0, identity: 1.0

gttttcgcgccgtcctgaattgaaatggaaaca	CRISPR spacer
gttttcgcgccgtcctgaattgaaatggaaaca	Protospacer
*********************************

3. spacer 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT matches to position: 27379-27410, mismatch: 0, identity: 1.0

ggactaaatcgcagatactgctgtccagagca	CRISPR spacer
ggactaaatcgcagatactgctgtccagagca	Protospacer
********************************

4. spacer 1.57|1046531|32|NZ_CP022139|CRISPRCasFinder,CRT matches to position: 1662711-1662742, mismatch: 0, identity: 1.0

ttttcgcgccgtcctgaattgaaatggaaaca	CRISPR spacer
ttttcgcgccgtcctgaattgaaatggaaaca	Protospacer
********************************

5. spacer 1.65|1047019|32|NZ_CP022139|CRISPRCasFinder,CRT matches to position: 4655754-4655785, mismatch: 0, identity: 1.0

cacgaagggtccggttgtttttggatgccccc	CRISPR spacer
cacgaagggtccggttgtttttggatgccccc	Protospacer
********************************

6. spacer 2.1|1055154|33|NZ_CP022139|PILER-CR matches to position: 2562345-2562377, mismatch: 0, identity: 1.0

gatcttgcgccaatgcttttttactcttccctt	CRISPR spacer
gatcttgcgccaatgcttttttactcttccctt	Protospacer
*********************************

7. spacer 2.5|1055398|33|NZ_CP022139|PILER-CR matches to position: 56955-56987, mismatch: 0, identity: 1.0

gcgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
gcgcaaacactcgcagagctgcttggtatcaca	Protospacer
*********************************

8. spacer 2.8|1055581|33|NZ_CP022139|PILER-CR matches to position: 53621-53653, mismatch: 0, identity: 1.0

gcagataacgctcagataccaccaaagcaggta	CRISPR spacer
gcagataacgctcagataccaccaaagcaggta	Protospacer
*********************************

9. spacer 2.10|1055155|32|NZ_CP022139|CRISPRCasFinder,CRT matches to position: 2562346-2562377, mismatch: 0, identity: 1.0

atcttgcgccaatgcttttttactcttccctt	CRISPR spacer
atcttgcgccaatgcttttttactcttccctt	Protospacer
********************************

10. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to position: 56955-56986, mismatch: 0, identity: 1.0

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
cgcaaacactcgcagagctgcttggtatcaca	Protospacer
********************************

11. spacer 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT matches to position: 53621-53652, mismatch: 0, identity: 1.0

cagataacgctcagataccaccaaagcaggta	CRISPR spacer
cagataacgctcagataccaccaaagcaggta	Protospacer
********************************

12. spacer 1.26|1046591|33|NZ_CP022139|PILER-CR matches to position: 1649667-1649699, mismatch: 2, identity: 0.939

gatgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
gatgcgcctgccttttttccacatcaggctcgg	Protospacer
**********.*********** **********

13. spacer 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT matches to position: 1649668-1649699, mismatch: 2, identity: 0.938

atgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
atgcgcctgccttttttccacatcaggctcgg	Protospacer
*********.*********** **********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022139_1 1.12|1045736|33|NZ_CP022139|PILER-CR 1045736-1045768 33 NZ_CP029996 Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence 74677-74709 0 1.0
NZ_CP022139_1 1.12|1045736|33|NZ_CP022139|PILER-CR 1045736-1045768 33 NZ_LS997975 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1 42401-42433 0 1.0
NZ_CP022139_1 1.12|1045736|33|NZ_CP022139|PILER-CR 1045736-1045768 33 CP053317 Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence 87656-87688 0 1.0
NZ_CP022139_1 1.12|1045736|33|NZ_CP022139|PILER-CR 1045736-1045768 33 NC_019335 Salmonella sp. 14 plasmid p14-95A, complete sequence 1679-1711 0 1.0
NZ_CP022139_1 1.12|1045736|33|NZ_CP022139|PILER-CR 1045736-1045768 33 NC_019336 Salmonella sp. 40 plasmid p40-95A, complete sequence 74535-74567 0 1.0
NZ_CP022139_1 1.12|1045736|33|NZ_CP022139|PILER-CR 1045736-1045768 33 CP034708 Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence 4747-4779 0 1.0
NZ_CP022139_1 1.12|1045736|33|NZ_CP022139|PILER-CR 1045736-1045768 33 NZ_CP022141 Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence 27378-27410 0 1.0
NZ_CP022139_1 1.12|1045736|33|NZ_CP022139|PILER-CR 1045736-1045768 33 NZ_CP022136 Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence 18081-18113 0 1.0
NZ_CP022139_1 1.12|1045736|33|NZ_CP022139|PILER-CR 1045736-1045768 33 NZ_CP022036 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence 1312-1344 0 1.0
NZ_CP022139_1 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT 1045737-1045768 32 CP034708 Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence 4748-4779 0 1.0
NZ_CP022139_1 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT 1045737-1045768 32 NZ_CP022141 Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence 27379-27410 0 1.0
NZ_CP022139_1 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT 1045737-1045768 32 NZ_CP022136 Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence 18082-18113 0 1.0
NZ_CP022139_1 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT 1045737-1045768 32 NZ_CP029996 Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence 74677-74708 0 1.0
NZ_CP022139_1 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT 1045737-1045768 32 NZ_LS997975 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1 42401-42432 0 1.0
NZ_CP022139_1 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT 1045737-1045768 32 NZ_CP022036 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence 1313-1344 0 1.0
NZ_CP022139_1 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT 1045737-1045768 32 CP053317 Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence 87656-87687 0 1.0
NZ_CP022139_1 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT 1045737-1045768 32 NC_019335 Salmonella sp. 14 plasmid p14-95A, complete sequence 1679-1710 0 1.0
NZ_CP022139_1 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT 1045737-1045768 32 NC_019336 Salmonella sp. 40 plasmid p40-95A, complete sequence 74535-74566 0 1.0
NZ_CP022139_2 2.5|1055398|33|NZ_CP022139|PILER-CR 1055398-1055430 33 CP034708 Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence 33190-33222 0 1.0
NZ_CP022139_2 2.5|1055398|33|NZ_CP022139|PILER-CR 1055398-1055430 33 NZ_CP022141 Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence 56955-56987 0 1.0
NZ_CP022139_2 2.5|1055398|33|NZ_CP022139|PILER-CR 1055398-1055430 33 NZ_CP022136 Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence 50373-50405 0 1.0
NZ_CP022139_2 2.5|1055398|33|NZ_CP022139|PILER-CR 1055398-1055430 33 NZ_CP029996 Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence 42585-42617 0 1.0
NZ_CP022139_2 2.5|1055398|33|NZ_CP022139|PILER-CR 1055398-1055430 33 NZ_LS997975 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1 13275-13307 0 1.0
NZ_CP022139_2 2.5|1055398|33|NZ_CP022139|PILER-CR 1055398-1055430 33 NZ_CP022036 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence 33404-33436 0 1.0
NZ_CP022139_2 2.5|1055398|33|NZ_CP022139|PILER-CR 1055398-1055430 33 CP053317 Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence 130672-130704 0 1.0
NZ_CP022139_2 2.5|1055398|33|NZ_CP022139|PILER-CR 1055398-1055430 33 NC_019335 Salmonella sp. 14 plasmid p14-95A, complete sequence 57702-57734 0 1.0
NZ_CP022139_2 2.5|1055398|33|NZ_CP022139|PILER-CR 1055398-1055430 33 NC_019336 Salmonella sp. 40 plasmid p40-95A, complete sequence 42244-42276 0 1.0
NZ_CP022139_2 2.8|1055581|33|NZ_CP022139|PILER-CR 1055581-1055613 33 CP034708 Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence 29853-29885 0 1.0
NZ_CP022139_2 2.8|1055581|33|NZ_CP022139|PILER-CR 1055581-1055613 33 NZ_CP022141 Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence 53621-53653 0 1.0
NZ_CP022139_2 2.8|1055581|33|NZ_CP022139|PILER-CR 1055581-1055613 33 NZ_CP022136 Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence 47036-47068 0 1.0
NZ_CP022139_2 2.8|1055581|33|NZ_CP022139|PILER-CR 1055581-1055613 33 NZ_CP022036 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence 30069-30101 0 1.0
NZ_CP022139_2 2.8|1055581|33|NZ_CP022139|PILER-CR 1055581-1055613 33 NZ_CP029996 Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence 45920-45952 0 1.0
NZ_CP022139_2 2.8|1055581|33|NZ_CP022139|PILER-CR 1055581-1055613 33 NZ_LS997975 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1 16611-16643 0 1.0
NZ_CP022139_2 2.8|1055581|33|NZ_CP022139|PILER-CR 1055581-1055613 33 CP053317 Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence 134008-134040 0 1.0
NZ_CP022139_2 2.8|1055581|33|NZ_CP022139|PILER-CR 1055581-1055613 33 NC_019335 Salmonella sp. 14 plasmid p14-95A, complete sequence 61037-61069 0 1.0
NZ_CP022139_2 2.8|1055581|33|NZ_CP022139|PILER-CR 1055581-1055613 33 NC_019336 Salmonella sp. 40 plasmid p40-95A, complete sequence 45581-45613 0 1.0
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 CP034708 Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence 33190-33221 0 1.0
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 NZ_CP022141 Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence 56955-56986 0 1.0
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 NZ_CP022136 Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence 50373-50404 0 1.0
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 NZ_CP029996 Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence 42586-42617 0 1.0
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 NZ_LS997975 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1 13276-13307 0 1.0
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 NZ_CP022036 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence 33404-33435 0 1.0
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 CP053317 Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence 130673-130704 0 1.0
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 NC_019335 Salmonella sp. 14 plasmid p14-95A, complete sequence 57703-57734 0 1.0
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 NC_019336 Salmonella sp. 40 plasmid p40-95A, complete sequence 42245-42276 0 1.0
NZ_CP022139_2 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT 1055582-1055613 32 CP034708 Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence 29853-29884 0 1.0
NZ_CP022139_2 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT 1055582-1055613 32 NZ_CP022141 Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence 53621-53652 0 1.0
NZ_CP022139_2 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT 1055582-1055613 32 NZ_CP022136 Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence 47036-47067 0 1.0
NZ_CP022139_2 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT 1055582-1055613 32 NZ_CP029996 Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence 45921-45952 0 1.0
NZ_CP022139_2 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT 1055582-1055613 32 NZ_LS997975 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1 16612-16643 0 1.0
NZ_CP022139_2 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT 1055582-1055613 32 NZ_CP022036 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence 30069-30100 0 1.0
NZ_CP022139_2 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT 1055582-1055613 32 CP053317 Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence 134009-134040 0 1.0
NZ_CP022139_2 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT 1055582-1055613 32 NC_019335 Salmonella sp. 14 plasmid p14-95A, complete sequence 61038-61069 0 1.0
NZ_CP022139_2 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT 1055582-1055613 32 NC_019336 Salmonella sp. 40 plasmid p40-95A, complete sequence 45582-45613 0 1.0
NZ_CP022139_1 1.21|1046286|33|NZ_CP022139|PILER-CR 1046286-1046318 33 MT261384 Salmonella virus PAT1, complete genome 17895-17927 2 0.939
NZ_CP022139_1 1.21|1046286|33|NZ_CP022139|PILER-CR 1046286-1046318 33 MT580116 Salmonella phage 65FD, complete genome 25088-25120 2 0.939
NZ_CP022139_1 1.21|1046286|33|NZ_CP022139|PILER-CR 1046286-1046318 33 MT580117 Salmonella phage 66FD, complete genome 15926-15958 2 0.939
NZ_CP022139_1 1.22|1046347|33|NZ_CP022139|PILER-CR 1046347-1046379 33 LR597649 Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1 1967-1999 2 0.939
NZ_CP022139_1 1.22|1046347|33|NZ_CP022139|PILER-CR 1046347-1046379 33 NC_049393 Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1 1745-1777 2 0.939
NZ_CP022139_1 1.22|1046347|33|NZ_CP022139|PILER-CR 1046347-1046379 33 LR597637 Escherichia phage ESSI2_ev239 genome assembly, chromosome: 1 2037-2069 2 0.939
NZ_CP022139_1 1.22|1046347|33|NZ_CP022139|PILER-CR 1046347-1046379 33 NC_049394 Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1 1962-1994 2 0.939
NZ_CP022139_1 1.23|1046408|33|NZ_CP022139|PILER-CR 1046408-1046440 33 LR597637 Escherichia phage ESSI2_ev239 genome assembly, chromosome: 1 22166-22198 2 0.939
NZ_CP022139_1 1.53|1046287|32|NZ_CP022139|CRISPRCasFinder,CRT 1046287-1046318 32 MT261384 Salmonella virus PAT1, complete genome 17896-17927 2 0.938
NZ_CP022139_1 1.53|1046287|32|NZ_CP022139|CRISPRCasFinder,CRT 1046287-1046318 32 MT580116 Salmonella phage 65FD, complete genome 25088-25119 2 0.938
NZ_CP022139_1 1.53|1046287|32|NZ_CP022139|CRISPRCasFinder,CRT 1046287-1046318 32 MT580117 Salmonella phage 66FD, complete genome 15926-15957 2 0.938
NZ_CP022139_1 1.54|1046348|32|NZ_CP022139|CRISPRCasFinder,CRT 1046348-1046379 32 LR597649 Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1 1967-1998 2 0.938
NZ_CP022139_1 1.54|1046348|32|NZ_CP022139|CRISPRCasFinder,CRT 1046348-1046379 32 NC_049393 Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1 1745-1776 2 0.938
NZ_CP022139_1 1.54|1046348|32|NZ_CP022139|CRISPRCasFinder,CRT 1046348-1046379 32 LR597637 Escherichia phage ESSI2_ev239 genome assembly, chromosome: 1 2037-2068 2 0.938
NZ_CP022139_1 1.54|1046348|32|NZ_CP022139|CRISPRCasFinder,CRT 1046348-1046379 32 NC_049394 Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1 1962-1993 2 0.938
NZ_CP022139_1 1.55|1046409|32|NZ_CP022139|CRISPRCasFinder,CRT 1046409-1046440 32 LR597637 Escherichia phage ESSI2_ev239 genome assembly, chromosome: 1 22166-22197 2 0.938
NZ_CP022139_1 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT 1046592-1046623 32 NZ_CP022925 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B 18380-18411 4 0.875
NZ_CP022139_1 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT 1046592-1046623 32 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 4077-4108 4 0.875
NZ_CP022139_1 1.26|1046591|33|NZ_CP022139|PILER-CR 1046591-1046623 33 NZ_CP022925 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B 18379-18411 5 0.848
NZ_CP022139_1 1.26|1046591|33|NZ_CP022139|PILER-CR 1046591-1046623 33 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 4076-4108 5 0.848
NZ_CP022139_1 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT 1046592-1046623 32 KU052037 Escherichia phage Rac-SA53, complete genome 8231-8262 5 0.844
NZ_CP022139_1 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT 1046592-1046623 32 MK448237 Klebsiella phage ST974-OXA48phi18.2, complete genome 15482-15513 5 0.844
NZ_CP022139_1 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT 1046592-1046623 32 KY271399 Klebsiella phage 5 LV-2017, complete genome 8191-8222 5 0.844
NZ_CP022139_1 1.26|1046591|33|NZ_CP022139|PILER-CR 1046591-1046623 33 KU052037 Escherichia phage Rac-SA53, complete genome 8230-8262 6 0.818
NZ_CP022139_1 1.26|1046591|33|NZ_CP022139|PILER-CR 1046591-1046623 33 MK448237 Klebsiella phage ST974-OXA48phi18.2, complete genome 15481-15513 6 0.818
NZ_CP022139_1 1.26|1046591|33|NZ_CP022139|PILER-CR 1046591-1046623 33 KY271399 Klebsiella phage 5 LV-2017, complete genome 8190-8222 6 0.818
NZ_CP022139_1 1.42|1045615|32|NZ_CP022139|CRISPRCasFinder,CRT 1045615-1045646 32 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 89499-89530 6 0.812
NZ_CP022139_1 1.42|1045615|32|NZ_CP022139|CRISPRCasFinder,CRT 1045615-1045646 32 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 122051-122082 6 0.812
NZ_CP022139_1 1.5|1045309|33|NZ_CP022139|PILER-CR 1045309-1045341 33 CP024689 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-5-125K, complete sequence 120737-120769 7 0.788
NZ_CP022139_1 1.10|1045614|33|NZ_CP022139|PILER-CR 1045614-1045646 33 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 89499-89531 7 0.788
NZ_CP022139_1 1.10|1045614|33|NZ_CP022139|PILER-CR 1045614-1045646 33 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 122051-122083 7 0.788
NZ_CP022139_1 1.34|1045127|32|NZ_CP022139|CRISPRCasFinder,CRT 1045127-1045158 32 MH572385 Microviridae sp. isolate SD_SF_10, complete genome 1534-1565 7 0.781
NZ_CP022139_1 1.34|1045127|32|NZ_CP022139|CRISPRCasFinder,CRT 1045127-1045158 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2187363-2187394 7 0.781
NZ_CP022139_1 1.37|1045310|32|NZ_CP022139|CRISPRCasFinder,CRT 1045310-1045341 32 CP024689 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-5-125K, complete sequence 120737-120768 7 0.781
NZ_CP022139_1 1.42|1045615|32|NZ_CP022139|CRISPRCasFinder,CRT 1045615-1045646 32 MT889376 Arthrobacter phage Phives, complete genome 39969-40000 7 0.781
NZ_CP022139_1 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT 1046592-1046623 32 MK448904 Streptococcus phage Javan316, complete genome 17047-17078 7 0.781
NZ_CP022139_1 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT 1046592-1046623 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 944815-944846 7 0.781
NZ_CP022139_2 2.13|1055338|32|NZ_CP022139|CRISPRCasFinder,CRT 1055338-1055369 32 NZ_CP045276 Bacillus megaterium strain FDU301 plasmid pFDU301D, complete sequence 23779-23810 7 0.781
NZ_CP022139_1 1.2|1045126|33|NZ_CP022139|PILER-CR 1045126-1045158 33 MH572385 Microviridae sp. isolate SD_SF_10, complete genome 1534-1566 8 0.758
NZ_CP022139_1 1.8|1045492|33|NZ_CP022139|PILER-CR 1045492-1045524 33 KX397366 Erwinia phage vB_EamM_ChrisDB, complete genome 127539-127571 8 0.758
NZ_CP022139_1 1.10|1045614|33|NZ_CP022139|PILER-CR 1045614-1045646 33 MT889376 Arthrobacter phage Phives, complete genome 39969-40001 8 0.758
NZ_CP022139_1 1.39|1045432|32|NZ_CP022139|CRISPRCasFinder,CRT 1045432-1045463 32 NZ_CP042276 Agrobacterium tumefaciens strain 186 plasmid pAt, complete sequence 68235-68266 8 0.75
NZ_CP022139_1 1.39|1045432|32|NZ_CP022139|CRISPRCasFinder,CRT 1045432-1045463 32 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 316197-316228 8 0.75
NZ_CP022139_1 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT 1045493-1045524 32 NZ_KX443401 Rhodococcus hoagii strain PAM1572 plasmid pVAPN1572, complete sequence 94851-94882 8 0.75
NZ_CP022139_1 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT 1045493-1045524 32 NZ_KX443399 Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence 99103-99134 8 0.75
NZ_CP022139_1 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT 1045493-1045524 32 NZ_KX443400 Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence 99128-99159 8 0.75
NZ_CP022139_1 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT 1045493-1045524 32 NZ_KX443398 Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence 99116-99147 8 0.75
NZ_CP022139_1 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT 1045493-1045524 32 NZ_KP851975 Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence 99242-99273 8 0.75
NZ_CP022139_1 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT 1045493-1045524 32 NZ_KF439868 Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence 98244-98275 8 0.75
NZ_CP022139_1 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT 1045493-1045524 32 KX397366 Erwinia phage vB_EamM_ChrisDB, complete genome 127539-127570 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_KU130396 Escherichia coli strain S68 plasmid pS68, complete sequence 27756-27787 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP010130 Escherichia coli strain C9 plasmid A, complete genome 56485-56516 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP010233 Escherichia coli strain S30 plasmid B, complete sequence 99317-99348 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP032445 Salmonella enterica subsp. enterica serovar Fresno strain USMARC-69835 plasmid pSFR1-USMARC-69835, complete sequence 40880-40911 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP033963 Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence 59132-59163 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP020547 Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence 75629-75660 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 MN915010 Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence 154313-154344 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 MN915012 Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence 43979-44010 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 MN915013 Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence 81762-81793 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP045189 Escherichia coli strain NT1F31 plasmid pNT1F31-96kb, complete sequence 93554-93585 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP027327 Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence 67662-67693 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP045756 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence 2717-2748 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP025239 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence 54028-54059 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 MK181565 Escherichia coli plasmid pESBL20140131, complete sequence 64926-64957 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 MK181566 Escherichia coli plasmid p15078279, complete sequence 64186-64217 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 CP034251 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence 177385-177416 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 CP034252 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence 64169-64200 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NC_024980 Escherichia coli strain ESBL-315 plasmid pESBL-315, complete sequence 57041-57072 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NC_024978 Escherichia coli strain ESBL-283 plasmid pESBL-283, complete sequence 67128-67159 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP040548 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-p3, complete sequence 55970-56001 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NC_019043 Escherichia coli plasmid pND11_107, complete sequence 61093-61124 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP022734 Escherichia coli strain SA186 plasmid pSA186_5, complete sequence 24794-24825 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP039490 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid pCFSAN000752, complete sequence 86140-86171 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP031615 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence 28479-28510 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP024976 Escherichia coli strain CV839-15 plasmid pCV839-15-p2, complete sequence 65031-65062 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP030191 Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence 65433-65464 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 MG516908 Escherichia coli plasmid pEc42, complete sequence 69857-69888 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 CP010831 Shigella sonnei strain FORC_011 plasmid pFORC11.2, complete sequence 25742-25773 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP025751 Escherichia coli strain CV839-06 plasmid pCV839-06-p1, complete sequence 74889-74920 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 CP051282 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-95663.1B, complete sequence 36632-36663 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP032495 Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence 74847-74878 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP040542 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-p3, complete sequence 55975-56006 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 MN419435 Escherichia coli strain 2016-40-14263 plasmid p14263, complete sequence 2574-2605 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NC_019111 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934a, complete sequence 44795-44826 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NC_016904 Escherichia coli KO11FL plasmid pEKO1101, complete sequence 42670-42701 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NC_017665 Escherichia coli W plasmid pRK1, complete sequence 16504-16535 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP032888 Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence 65806-65837 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP041441 Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence 78600-78631 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_MH674341 Escherichia coli strain EC07 plasmid pUR-EC07, complete sequence 62085-62116 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_MN241905 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM96, complete sequence 44892-44923 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP041394 Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2 21916-21947 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 MN262643 Escherichia coli strain EC009 plasmid pEC009.2, complete sequence 70864-70895 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 MN124285 Escherichia coli strain RKI3099 plasmid pRKI3099a, complete sequence 71674-71705 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_KY748189 Escherichia coli strain EC007 plasmid pEC007, complete sequence 63151-63182 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_KY865323 Escherichia coli strain SY286M plasmid pECM13, complete sequence 67593-67624 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_KY748188 Escherichia coli strain EC006 plasmid pEC006, complete sequence 63151-63182 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_KY748190 Escherichia coli strain EC008 plasmid pEC008, complete sequence 80383-80414 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_MG948333 Escherichia coli strain 2454 plasmid p2454, complete sequence 44386-44417 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NC_023326 Escherichia coli ACN001 plasmid pACN001-F, complete sequence 75514-75545 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NC_019104 Salmonella enterica subsp. enterica serovar Kentucky plasmid pCS0010A_95, complete sequence 52666-52697 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 70214-70245 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP048361 Escherichia coli strain 53 plasmid p53_B, complete sequence 44471-44502 8 0.75
NZ_CP022139_1 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT 1045859-1045890 32 NZ_CP040536 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-p3, complete sequence 55970-56001 8 0.75
NZ_CP022139_1 1.54|1046348|32|NZ_CP022139|CRISPRCasFinder,CRT 1046348-1046379 32 GU323318 Enterobacteria phage CC31, complete genome 163051-163082 8 0.75
NZ_CP022139_1 1.62|1046836|32|NZ_CP022139|CRISPRCasFinder,CRT 1046836-1046867 32 MH884512 Bacillus phage vB_BpsS-140, complete genome 35801-35832 8 0.75
NZ_CP022139_1 1.64|1046958|32|NZ_CP022139|CRISPRCasFinder,CRT 1046958-1046989 32 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 282732-282763 8 0.75
NZ_CP022139_2 2.1|1055154|33|NZ_CP022139|PILER-CR 1055154-1055186 33 NZ_CP038614 Arsenophonus nasoniae strain FIN plasmid pArsFIN2, complete sequence 49331-49363 8 0.758
NZ_CP022139_2 2.10|1055155|32|NZ_CP022139|CRISPRCasFinder,CRT 1055155-1055186 32 NZ_CP038614 Arsenophonus nasoniae strain FIN plasmid pArsFIN2, complete sequence 49332-49363 8 0.75
NZ_CP022139_1 1.8|1045492|33|NZ_CP022139|PILER-CR 1045492-1045524 33 NZ_KX443401 Rhodococcus hoagii strain PAM1572 plasmid pVAPN1572, complete sequence 94851-94883 9 0.727
NZ_CP022139_1 1.8|1045492|33|NZ_CP022139|PILER-CR 1045492-1045524 33 NZ_KX443399 Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence 99103-99135 9 0.727
NZ_CP022139_1 1.8|1045492|33|NZ_CP022139|PILER-CR 1045492-1045524 33 NZ_KX443400 Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence 99128-99160 9 0.727
NZ_CP022139_1 1.8|1045492|33|NZ_CP022139|PILER-CR 1045492-1045524 33 NZ_KX443398 Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence 99116-99148 9 0.727
NZ_CP022139_1 1.8|1045492|33|NZ_CP022139|PILER-CR 1045492-1045524 33 NZ_KP851975 Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence 99242-99274 9 0.727
NZ_CP022139_1 1.8|1045492|33|NZ_CP022139|PILER-CR 1045492-1045524 33 NZ_KF439868 Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence 98244-98276 9 0.727
NZ_CP022139_1 1.22|1046347|33|NZ_CP022139|PILER-CR 1046347-1046379 33 GU323318 Enterobacteria phage CC31, complete genome 163050-163082 9 0.727
NZ_CP022139_1 1.30|1046835|33|NZ_CP022139|PILER-CR 1046835-1046867 33 MH884512 Bacillus phage vB_BpsS-140, complete genome 35800-35832 9 0.727
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 NC_047733 Synechococcus phage S-RIM8 isolate RW_22_0300, complete genome 34842-34873 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 JF974289 Synechococcus phage S-RIM8 A.HR3, complete genome 34841-34872 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 MK493323 Synechococcus phage S-RIM8 isolate RW_03_0617, complete genome 34839-34870 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 MK493325 Synechococcus phage S-RIM8 isolate RW_62_0316, complete genome 35091-35122 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 MK493322 Synechococcus phage S-RIM8 isolate RW_01_0115_WH8101, complete genome 35091-35122 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 KX349288 Synechococcus phage S-RIM8 isolate RW_08_0711, complete genome 35091-35122 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 NC_020486 Synechococcus phage S-RIM8 A.HR1, complete genome 34841-34872 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 KX349286 Synechococcus phage S-RIM8 isolate RW_03_0807_WH8101, complete genome 35422-35453 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 HQ317385 Synechococcus phage S-RIM8 A.HR5, complete genome 34841-34872 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 MK493324 Synechococcus phage S-RIM8 isolate RW_22_0214, complete genome 35091-35122 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 KX349290 Synechococcus phage S-RIM8 isolate RW_25_1112, complete genome 35091-35122 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 KX349285 Synechococcus phage S-RIM8 isolate RW_01_0212_WH8101, complete genome 34839-34870 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 KX349287 Synechococcus phage S-RIM8 isolate RW_06_0613, complete genome 35091-35122 9 0.719
NZ_CP022139_1 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT 1045249-1045280 32 JF974293 Cyanophage KBS-M-1A genomic sequence 11249-11280 9 0.719
NZ_CP022139_1 1.51|1046165|32|NZ_CP022139|CRISPRCasFinder,CRT 1046165-1046196 32 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 344536-344567 9 0.719
NZ_CP022139_2 2.13|1055338|32|NZ_CP022139|CRISPRCasFinder,CRT 1055338-1055369 32 NZ_CP031268 Staphylococcus warneri strain 16A plasmid unnamed2 39204-39235 9 0.719
NZ_CP022139_2 2.13|1055338|32|NZ_CP022139|CRISPRCasFinder,CRT 1055338-1055369 32 NZ_CP031268 Staphylococcus warneri strain 16A plasmid unnamed2 74364-74395 9 0.719
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 JF974293 Cyanophage KBS-M-1A genomic sequence 11248-11280 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 NC_047733 Synechococcus phage S-RIM8 isolate RW_22_0300, complete genome 34842-34874 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 JF974289 Synechococcus phage S-RIM8 A.HR3, complete genome 34841-34873 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 MK493323 Synechococcus phage S-RIM8 isolate RW_03_0617, complete genome 34839-34871 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 MK493325 Synechococcus phage S-RIM8 isolate RW_62_0316, complete genome 35091-35123 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 MK493322 Synechococcus phage S-RIM8 isolate RW_01_0115_WH8101, complete genome 35091-35123 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 KX349288 Synechococcus phage S-RIM8 isolate RW_08_0711, complete genome 35091-35123 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 NC_020486 Synechococcus phage S-RIM8 A.HR1, complete genome 34841-34873 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 KX349286 Synechococcus phage S-RIM8 isolate RW_03_0807_WH8101, complete genome 35422-35454 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 HQ317385 Synechococcus phage S-RIM8 A.HR5, complete genome 34841-34873 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 MK493324 Synechococcus phage S-RIM8 isolate RW_22_0214, complete genome 35091-35123 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 KX349290 Synechococcus phage S-RIM8 isolate RW_25_1112, complete genome 35091-35123 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 KX349285 Synechococcus phage S-RIM8 isolate RW_01_0212_WH8101, complete genome 34839-34871 10 0.697
NZ_CP022139_1 1.4|1045248|33|NZ_CP022139|PILER-CR 1045248-1045280 33 KX349287 Synechococcus phage S-RIM8 isolate RW_06_0613, complete genome 35091-35123 10 0.697
NZ_CP022139_1 1.35|1045188|32|NZ_CP022139|CRISPRCasFinder,CRT 1045188-1045219 32 NZ_CP033873 Caulobacter sp. FWC26 plasmid p1, complete sequence 262167-262198 10 0.688
NZ_CP022139_1 1.38|1045371|32|NZ_CP022139|CRISPRCasFinder,CRT 1045371-1045402 32 NZ_CP041067 Bacillus megaterium strain KNU-01 plasmid pKNU_01_3, complete sequence 47029-47060 10 0.688
NZ_CP022139_1 1.52|1046226|32|NZ_CP022139|CRISPRCasFinder,CRT 1046226-1046257 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 239891-239922 10 0.688
NZ_CP022139_1 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT 1046592-1046623 32 NZ_CP025946 Escherichia coli strain SCEC020023 plasmid p2_020023, complete sequence 6361-6392 10 0.688
NZ_CP022139_1 1.60|1046714|32|NZ_CP022139|CRISPRCasFinder,CRT 1046714-1046745 32 NZ_CP013109 Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence 521518-521549 10 0.688
NZ_CP022139_1 1.60|1046714|32|NZ_CP022139|CRISPRCasFinder,CRT 1046714-1046745 32 NZ_CP013053 Sinorhizobium americanum CCGM7 plasmid B, complete sequence 482097-482128 10 0.688
NZ_CP022139_2 2.13|1055338|32|NZ_CP022139|CRISPRCasFinder,CRT 1055338-1055369 32 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 43285-43316 10 0.688
NZ_CP022139_1 1.37|1045310|32|NZ_CP022139|CRISPRCasFinder,CRT 1045310-1045341 32 AP017993 Planktothrix agardhii NIES-204 plasmid plasmid2 DNA, complete sequence 71103-71134 11 0.656
NZ_CP022139_1 1.60|1046714|32|NZ_CP022139|CRISPRCasFinder,CRT 1046714-1046745 32 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 354209-354240 11 0.656
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 NC_048647 UNVERIFIED: Klebsiella phage KNP2 genomic sequence 12556-12587 11 0.656
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 MK024806 Proteus phage Mydo, complete genome 132169-132200 11 0.656
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 KX452695 UNVERIFIED: Klebsiella phage KPN2 genomic sequence 12556-12587 11 0.656
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 NC_048656 Klebsiella phage vB_KpnM_BIS47, complete genome 5274-5305 11 0.656
NZ_CP022139_2 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT 1055399-1055430 32 NC_028659 Klebsiella phage vB_KpnM_KB57, complete genome 23048-23079 11 0.656
NZ_CP022139_2 2.18|1055643|32|NZ_CP022139|CRISPRCasFinder,CRT 1055643-1055674 32 MN047793 Xanthomonas phage Xoo-sp13, complete genome 111968-111999 11 0.656

1. spacer 1.12|1045736|33|NZ_CP022139|PILER-CR matches to NZ_CP029996 (Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence) position: , mismatch: 0, identity: 1.0

gggactaaatcgcagatactgctgtccagagca	CRISPR spacer
gggactaaatcgcagatactgctgtccagagca	Protospacer
*********************************

2. spacer 1.12|1045736|33|NZ_CP022139|PILER-CR matches to NZ_LS997975 (Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1) position: , mismatch: 0, identity: 1.0

gggactaaatcgcagatactgctgtccagagca	CRISPR spacer
gggactaaatcgcagatactgctgtccagagca	Protospacer
*********************************

3. spacer 1.12|1045736|33|NZ_CP022139|PILER-CR matches to CP053317 (Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gggactaaatcgcagatactgctgtccagagca	CRISPR spacer
gggactaaatcgcagatactgctgtccagagca	Protospacer
*********************************

4. spacer 1.12|1045736|33|NZ_CP022139|PILER-CR matches to NC_019335 (Salmonella sp. 14 plasmid p14-95A, complete sequence) position: , mismatch: 0, identity: 1.0

gggactaaatcgcagatactgctgtccagagca	CRISPR spacer
gggactaaatcgcagatactgctgtccagagca	Protospacer
*********************************

5. spacer 1.12|1045736|33|NZ_CP022139|PILER-CR matches to NC_019336 (Salmonella sp. 40 plasmid p40-95A, complete sequence) position: , mismatch: 0, identity: 1.0

gggactaaatcgcagatactgctgtccagagca	CRISPR spacer
gggactaaatcgcagatactgctgtccagagca	Protospacer
*********************************

6. spacer 1.12|1045736|33|NZ_CP022139|PILER-CR matches to CP034708 (Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence) position: , mismatch: 0, identity: 1.0

gggactaaatcgcagatactgctgtccagagca	CRISPR spacer
gggactaaatcgcagatactgctgtccagagca	Protospacer
*********************************

7. spacer 1.12|1045736|33|NZ_CP022139|PILER-CR matches to NZ_CP022141 (Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gggactaaatcgcagatactgctgtccagagca	CRISPR spacer
gggactaaatcgcagatactgctgtccagagca	Protospacer
*********************************

8. spacer 1.12|1045736|33|NZ_CP022139|PILER-CR matches to NZ_CP022136 (Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gggactaaatcgcagatactgctgtccagagca	CRISPR spacer
gggactaaatcgcagatactgctgtccagagca	Protospacer
*********************************

9. spacer 1.12|1045736|33|NZ_CP022139|PILER-CR matches to NZ_CP022036 (Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gggactaaatcgcagatactgctgtccagagca	CRISPR spacer
gggactaaatcgcagatactgctgtccagagca	Protospacer
*********************************

10. spacer 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT matches to CP034708 (Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence) position: , mismatch: 0, identity: 1.0

ggactaaatcgcagatactgctgtccagagca	CRISPR spacer
ggactaaatcgcagatactgctgtccagagca	Protospacer
********************************

11. spacer 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP022141 (Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggactaaatcgcagatactgctgtccagagca	CRISPR spacer
ggactaaatcgcagatactgctgtccagagca	Protospacer
********************************

12. spacer 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP022136 (Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggactaaatcgcagatactgctgtccagagca	CRISPR spacer
ggactaaatcgcagatactgctgtccagagca	Protospacer
********************************

13. spacer 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP029996 (Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence) position: , mismatch: 0, identity: 1.0

ggactaaatcgcagatactgctgtccagagca	CRISPR spacer
ggactaaatcgcagatactgctgtccagagca	Protospacer
********************************

14. spacer 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_LS997975 (Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1) position: , mismatch: 0, identity: 1.0

ggactaaatcgcagatactgctgtccagagca	CRISPR spacer
ggactaaatcgcagatactgctgtccagagca	Protospacer
********************************

15. spacer 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP022036 (Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggactaaatcgcagatactgctgtccagagca	CRISPR spacer
ggactaaatcgcagatactgctgtccagagca	Protospacer
********************************

16. spacer 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT matches to CP053317 (Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggactaaatcgcagatactgctgtccagagca	CRISPR spacer
ggactaaatcgcagatactgctgtccagagca	Protospacer
********************************

17. spacer 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_019335 (Salmonella sp. 14 plasmid p14-95A, complete sequence) position: , mismatch: 0, identity: 1.0

ggactaaatcgcagatactgctgtccagagca	CRISPR spacer
ggactaaatcgcagatactgctgtccagagca	Protospacer
********************************

18. spacer 1.44|1045737|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_019336 (Salmonella sp. 40 plasmid p40-95A, complete sequence) position: , mismatch: 0, identity: 1.0

ggactaaatcgcagatactgctgtccagagca	CRISPR spacer
ggactaaatcgcagatactgctgtccagagca	Protospacer
********************************

19. spacer 2.5|1055398|33|NZ_CP022139|PILER-CR matches to CP034708 (Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
gcgcaaacactcgcagagctgcttggtatcaca	Protospacer
*********************************

20. spacer 2.5|1055398|33|NZ_CP022139|PILER-CR matches to NZ_CP022141 (Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
gcgcaaacactcgcagagctgcttggtatcaca	Protospacer
*********************************

21. spacer 2.5|1055398|33|NZ_CP022139|PILER-CR matches to NZ_CP022136 (Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
gcgcaaacactcgcagagctgcttggtatcaca	Protospacer
*********************************

22. spacer 2.5|1055398|33|NZ_CP022139|PILER-CR matches to NZ_CP029996 (Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
gcgcaaacactcgcagagctgcttggtatcaca	Protospacer
*********************************

23. spacer 2.5|1055398|33|NZ_CP022139|PILER-CR matches to NZ_LS997975 (Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1) position: , mismatch: 0, identity: 1.0

gcgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
gcgcaaacactcgcagagctgcttggtatcaca	Protospacer
*********************************

24. spacer 2.5|1055398|33|NZ_CP022139|PILER-CR matches to NZ_CP022036 (Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
gcgcaaacactcgcagagctgcttggtatcaca	Protospacer
*********************************

25. spacer 2.5|1055398|33|NZ_CP022139|PILER-CR matches to CP053317 (Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
gcgcaaacactcgcagagctgcttggtatcaca	Protospacer
*********************************

26. spacer 2.5|1055398|33|NZ_CP022139|PILER-CR matches to NC_019335 (Salmonella sp. 14 plasmid p14-95A, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
gcgcaaacactcgcagagctgcttggtatcaca	Protospacer
*********************************

27. spacer 2.5|1055398|33|NZ_CP022139|PILER-CR matches to NC_019336 (Salmonella sp. 40 plasmid p40-95A, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
gcgcaaacactcgcagagctgcttggtatcaca	Protospacer
*********************************

28. spacer 2.8|1055581|33|NZ_CP022139|PILER-CR matches to CP034708 (Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence) position: , mismatch: 0, identity: 1.0

gcagataacgctcagataccaccaaagcaggta	CRISPR spacer
gcagataacgctcagataccaccaaagcaggta	Protospacer
*********************************

29. spacer 2.8|1055581|33|NZ_CP022139|PILER-CR matches to NZ_CP022141 (Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gcagataacgctcagataccaccaaagcaggta	CRISPR spacer
gcagataacgctcagataccaccaaagcaggta	Protospacer
*********************************

30. spacer 2.8|1055581|33|NZ_CP022139|PILER-CR matches to NZ_CP022136 (Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagataacgctcagataccaccaaagcaggta	CRISPR spacer
gcagataacgctcagataccaccaaagcaggta	Protospacer
*********************************

31. spacer 2.8|1055581|33|NZ_CP022139|PILER-CR matches to NZ_CP022036 (Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagataacgctcagataccaccaaagcaggta	CRISPR spacer
gcagataacgctcagataccaccaaagcaggta	Protospacer
*********************************

32. spacer 2.8|1055581|33|NZ_CP022139|PILER-CR matches to NZ_CP029996 (Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagataacgctcagataccaccaaagcaggta	CRISPR spacer
gcagataacgctcagataccaccaaagcaggta	Protospacer
*********************************

33. spacer 2.8|1055581|33|NZ_CP022139|PILER-CR matches to NZ_LS997975 (Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1) position: , mismatch: 0, identity: 1.0

gcagataacgctcagataccaccaaagcaggta	CRISPR spacer
gcagataacgctcagataccaccaaagcaggta	Protospacer
*********************************

34. spacer 2.8|1055581|33|NZ_CP022139|PILER-CR matches to CP053317 (Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gcagataacgctcagataccaccaaagcaggta	CRISPR spacer
gcagataacgctcagataccaccaaagcaggta	Protospacer
*********************************

35. spacer 2.8|1055581|33|NZ_CP022139|PILER-CR matches to NC_019335 (Salmonella sp. 14 plasmid p14-95A, complete sequence) position: , mismatch: 0, identity: 1.0

gcagataacgctcagataccaccaaagcaggta	CRISPR spacer
gcagataacgctcagataccaccaaagcaggta	Protospacer
*********************************

36. spacer 2.8|1055581|33|NZ_CP022139|PILER-CR matches to NC_019336 (Salmonella sp. 40 plasmid p40-95A, complete sequence) position: , mismatch: 0, identity: 1.0

gcagataacgctcagataccaccaaagcaggta	CRISPR spacer
gcagataacgctcagataccaccaaagcaggta	Protospacer
*********************************

37. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to CP034708 (Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence) position: , mismatch: 0, identity: 1.0

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
cgcaaacactcgcagagctgcttggtatcaca	Protospacer
********************************

38. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP022141 (Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
cgcaaacactcgcagagctgcttggtatcaca	Protospacer
********************************

39. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP022136 (Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
cgcaaacactcgcagagctgcttggtatcaca	Protospacer
********************************

40. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP029996 (Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
cgcaaacactcgcagagctgcttggtatcaca	Protospacer
********************************

41. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_LS997975 (Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1) position: , mismatch: 0, identity: 1.0

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
cgcaaacactcgcagagctgcttggtatcaca	Protospacer
********************************

42. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP022036 (Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
cgcaaacactcgcagagctgcttggtatcaca	Protospacer
********************************

43. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to CP053317 (Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
cgcaaacactcgcagagctgcttggtatcaca	Protospacer
********************************

44. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_019335 (Salmonella sp. 14 plasmid p14-95A, complete sequence) position: , mismatch: 0, identity: 1.0

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
cgcaaacactcgcagagctgcttggtatcaca	Protospacer
********************************

45. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_019336 (Salmonella sp. 40 plasmid p40-95A, complete sequence) position: , mismatch: 0, identity: 1.0

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
cgcaaacactcgcagagctgcttggtatcaca	Protospacer
********************************

46. spacer 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT matches to CP034708 (Salmonella enterica subsp. enterica serovar Waycross strain RSE24 plasmid pRSE24, complete sequence) position: , mismatch: 0, identity: 1.0

cagataacgctcagataccaccaaagcaggta	CRISPR spacer
cagataacgctcagataccaccaaagcaggta	Protospacer
********************************

47. spacer 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP022141 (Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cagataacgctcagataccaccaaagcaggta	CRISPR spacer
cagataacgctcagataccaccaaagcaggta	Protospacer
********************************

48. spacer 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP022136 (Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cagataacgctcagataccaccaaagcaggta	CRISPR spacer
cagataacgctcagataccaccaaagcaggta	Protospacer
********************************

49. spacer 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP029996 (Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence) position: , mismatch: 0, identity: 1.0

cagataacgctcagataccaccaaagcaggta	CRISPR spacer
cagataacgctcagataccaccaaagcaggta	Protospacer
********************************

50. spacer 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_LS997975 (Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pBT1) position: , mismatch: 0, identity: 1.0

cagataacgctcagataccaccaaagcaggta	CRISPR spacer
cagataacgctcagataccaccaaagcaggta	Protospacer
********************************

51. spacer 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP022036 (Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cagataacgctcagataccaccaaagcaggta	CRISPR spacer
cagataacgctcagataccaccaaagcaggta	Protospacer
********************************

52. spacer 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT matches to CP053317 (Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cagataacgctcagataccaccaaagcaggta	CRISPR spacer
cagataacgctcagataccaccaaagcaggta	Protospacer
********************************

53. spacer 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_019335 (Salmonella sp. 14 plasmid p14-95A, complete sequence) position: , mismatch: 0, identity: 1.0

cagataacgctcagataccaccaaagcaggta	CRISPR spacer
cagataacgctcagataccaccaaagcaggta	Protospacer
********************************

54. spacer 2.17|1055582|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_019336 (Salmonella sp. 40 plasmid p40-95A, complete sequence) position: , mismatch: 0, identity: 1.0

cagataacgctcagataccaccaaagcaggta	CRISPR spacer
cagataacgctcagataccaccaaagcaggta	Protospacer
********************************

55. spacer 1.21|1046286|33|NZ_CP022139|PILER-CR matches to MT261384 (Salmonella virus PAT1, complete genome) position: , mismatch: 2, identity: 0.939

gcggtaacgcaaattcttggttcgaccttgtac	CRISPR spacer
gcggtaacgcaaatacatggttcgaccttgtac	Protospacer
************** * ****************

56. spacer 1.21|1046286|33|NZ_CP022139|PILER-CR matches to MT580116 (Salmonella phage 65FD, complete genome) position: , mismatch: 2, identity: 0.939

gcggtaacgcaaattcttggttcgaccttgtac	CRISPR spacer
gcggtaacgcaaatacatggttcgaccttgtac	Protospacer
************** * ****************

57. spacer 1.21|1046286|33|NZ_CP022139|PILER-CR matches to MT580117 (Salmonella phage 66FD, complete genome) position: , mismatch: 2, identity: 0.939

gcggtaacgcaaattcttggttcgaccttgtac	CRISPR spacer
gcggtaacgcaaatacatggttcgaccttgtac	Protospacer
************** * ****************

58. spacer 1.22|1046347|33|NZ_CP022139|PILER-CR matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.939

gaaaaactgacgtggtttgaacgcagggtgctg	CRISPR spacer
gaaaaactgacgtggtttgaacgcaaagtgctg	Protospacer
*************************..******

59. spacer 1.22|1046347|33|NZ_CP022139|PILER-CR matches to NC_049393 (Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.939

gaaaaactgacgtggtttgaacgcagggtgctg	CRISPR spacer
gaaaaactgacgtggtttgaacgcaaagtgctg	Protospacer
*************************..******

60. spacer 1.22|1046347|33|NZ_CP022139|PILER-CR matches to LR597637 (Escherichia phage ESSI2_ev239 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.939

gaaaaactgacgtggtttgaacgcagggtgctg	CRISPR spacer
gaaaaactgacgtggtttgaacgcaaagtgctg	Protospacer
*************************..******

61. spacer 1.22|1046347|33|NZ_CP022139|PILER-CR matches to NC_049394 (Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.939

gaaaaactgacgtggtttgaacgcagggtgctg	CRISPR spacer
gaaaaactgacgtggtttgaacgcaaagtgctg	Protospacer
*************************..******

62. spacer 1.23|1046408|33|NZ_CP022139|PILER-CR matches to LR597637 (Escherichia phage ESSI2_ev239 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.939

agtcattcccgtttctggaaatcgtgggggaac	CRISPR spacer
agtctttcccgtttcttgaaatcgtgggggaac	Protospacer
**** *********** ****************

63. spacer 1.53|1046287|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MT261384 (Salmonella virus PAT1, complete genome) position: , mismatch: 2, identity: 0.938

cggtaacgcaaattcttggttcgaccttgtac	CRISPR spacer
cggtaacgcaaatacatggttcgaccttgtac	Protospacer
************* * ****************

64. spacer 1.53|1046287|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MT580116 (Salmonella phage 65FD, complete genome) position: , mismatch: 2, identity: 0.938

cggtaacgcaaattcttggttcgaccttgtac	CRISPR spacer
cggtaacgcaaatacatggttcgaccttgtac	Protospacer
************* * ****************

65. spacer 1.53|1046287|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MT580117 (Salmonella phage 66FD, complete genome) position: , mismatch: 2, identity: 0.938

cggtaacgcaaattcttggttcgaccttgtac	CRISPR spacer
cggtaacgcaaatacatggttcgaccttgtac	Protospacer
************* * ****************

66. spacer 1.54|1046348|32|NZ_CP022139|CRISPRCasFinder,CRT matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.938

aaaaactgacgtggtttgaacgcagggtgctg	CRISPR spacer
aaaaactgacgtggtttgaacgcaaagtgctg	Protospacer
************************..******

67. spacer 1.54|1046348|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_049393 (Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.938

aaaaactgacgtggtttgaacgcagggtgctg	CRISPR spacer
aaaaactgacgtggtttgaacgcaaagtgctg	Protospacer
************************..******

68. spacer 1.54|1046348|32|NZ_CP022139|CRISPRCasFinder,CRT matches to LR597637 (Escherichia phage ESSI2_ev239 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.938

aaaaactgacgtggtttgaacgcagggtgctg	CRISPR spacer
aaaaactgacgtggtttgaacgcaaagtgctg	Protospacer
************************..******

69. spacer 1.54|1046348|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_049394 (Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.938

aaaaactgacgtggtttgaacgcagggtgctg	CRISPR spacer
aaaaactgacgtggtttgaacgcaaagtgctg	Protospacer
************************..******

70. spacer 1.55|1046409|32|NZ_CP022139|CRISPRCasFinder,CRT matches to LR597637 (Escherichia phage ESSI2_ev239 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.938

gtcattcccgtttctggaaatcgtgggggaac	CRISPR spacer
gtctttcccgtttcttgaaatcgtgggggaac	Protospacer
*** *********** ****************

71. spacer 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP022925 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B) position: , mismatch: 4, identity: 0.875

atgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
atttgcctgtcttttcaccacttcaggctcgg	Protospacer
** .***********. ***************

72. spacer 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 4, identity: 0.875

atgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
atttgcctgtcttttcaccacttcaggctcgg	Protospacer
** .***********. ***************

73. spacer 1.26|1046591|33|NZ_CP022139|PILER-CR matches to NZ_CP022925 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B) position: , mismatch: 5, identity: 0.848

gatgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
tatttgcctgtcttttcaccacttcaggctcgg	Protospacer
 ** .***********. ***************

74. spacer 1.26|1046591|33|NZ_CP022139|PILER-CR matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 5, identity: 0.848

gatgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
tatttgcctgtcttttcaccacttcaggctcgg	Protospacer
 ** .***********. ***************

75. spacer 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT matches to KU052037 (Escherichia phage Rac-SA53, complete genome) position: , mismatch: 5, identity: 0.844

atgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
gtatgcctgtctttttaccactttaggctcgg	Protospacer
.*..************ ******.********

76. spacer 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MK448237 (Klebsiella phage ST974-OXA48phi18.2, complete genome) position: , mismatch: 5, identity: 0.844

atgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
gtttgcctgtcttttaaccacttcaggctcgg	Protospacer
.* .***********  ***************

77. spacer 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT matches to KY271399 (Klebsiella phage 5 LV-2017, complete genome) position: , mismatch: 5, identity: 0.844

atgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
gtatgcctgtcttttaaccacttcaggctcgg	Protospacer
.*..***********  ***************

78. spacer 1.26|1046591|33|NZ_CP022139|PILER-CR matches to KU052037 (Escherichia phage Rac-SA53, complete genome) position: , mismatch: 6, identity: 0.818

gatgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
tgtatgcctgtctttttaccactttaggctcgg	Protospacer
 .*..************ ******.********

79. spacer 1.26|1046591|33|NZ_CP022139|PILER-CR matches to MK448237 (Klebsiella phage ST974-OXA48phi18.2, complete genome) position: , mismatch: 6, identity: 0.818

gatgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
tgtttgcctgtcttttaaccacttcaggctcgg	Protospacer
 .* .***********  ***************

80. spacer 1.26|1046591|33|NZ_CP022139|PILER-CR matches to KY271399 (Klebsiella phage 5 LV-2017, complete genome) position: , mismatch: 6, identity: 0.818

gatgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
tgtatgcctgtcttttaaccacttcaggctcgg	Protospacer
 .*..***********  ***************

81. spacer 1.42|1045615|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgacggcgtagagcttgccttgggtacgcc	CRISPR spacer
ggcgagggcgtcgagcttgccttgggtctgtg	Protospacer
***** ***** *************** .*. 

82. spacer 1.42|1045615|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgacggcgtagagcttgccttgggtacgcc	CRISPR spacer
ggcgagggcgtcgagcttgccttgggtctgtg	Protospacer
***** ***** *************** .*. 

83. spacer 1.5|1045309|33|NZ_CP022139|PILER-CR matches to CP024689 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-5-125K, complete sequence) position: , mismatch: 7, identity: 0.788

tcaggtactctatcctgataatgttcttcagcc	CRISPR spacer
tatgcgactctatcatgataatgtttttcagct	Protospacer
*  *  ******** **********.******.

84. spacer 1.10|1045614|33|NZ_CP022139|PILER-CR matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 7, identity: 0.788

gggcgacggcgtagagcttgccttgggtacgcc	CRISPR spacer
tggcgagggcgtcgagcttgccttgggtctgtg	Protospacer
 ***** ***** *************** .*. 

85. spacer 1.10|1045614|33|NZ_CP022139|PILER-CR matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 7, identity: 0.788

gggcgacggcgtagagcttgccttgggtacgcc	CRISPR spacer
tggcgagggcgtcgagcttgccttgggtctgtg	Protospacer
 ***** ***** *************** .*. 

86. spacer 1.34|1045127|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MH572385 (Microviridae sp. isolate SD_SF_10, complete genome) position: , mismatch: 7, identity: 0.781

aattagaaatgatcgatgtagccaggaacgga	CRISPR spacer
acctagaaatgatcgattaagccaggaacact	Protospacer
* .**************  **********.  

87. spacer 1.34|1045127|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.781

aattagaaa---tgatcgatgtagccaggaacgga	CRISPR spacer
---ccgaaatcgtgatcgatggcgccaggaacgga	Protospacer
   . ****   *********  ************

88. spacer 1.37|1045310|32|NZ_CP022139|CRISPRCasFinder,CRT matches to CP024689 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-5-125K, complete sequence) position: , mismatch: 7, identity: 0.781

caggtactctatcctgataatgttcttcagcc	CRISPR spacer
atgcgactctatcatgataatgtttttcagct	Protospacer
  *  ******** **********.******.

89. spacer 1.42|1045615|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MT889376 (Arthrobacter phage Phives, complete genome) position: , mismatch: 7, identity: 0.781

ggcgacggcgtagagcttgccttgggtacgcc	CRISPR spacer
ggcggcggcgtagagcttgccttcggcgatct	Protospacer
****.****************** **..  *.

90. spacer 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MK448904 (Streptococcus phage Javan316, complete genome) position: , mismatch: 7, identity: 0.781

atgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
aagcgcctgtctttttaccacttcaatctaac	Protospacer
* ************** ********. ** . 

91. spacer 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.781

atgcgcctgtcttttttccacttca--ggctcgg	CRISPR spacer
atgggcctgtcatttttccacttgaacgactt--	Protospacer
*** ******* *********** *  *.**.  

92. spacer 2.13|1055338|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP045276 (Bacillus megaterium strain FDU301 plasmid pFDU301D, complete sequence) position: , mismatch: 7, identity: 0.781

---aggatatttaaatatggtaactaaaatatatt	CRISPR spacer
ttttgaata---aactatggtaaataaaatatatt	Protospacer
    *.***   ** ******** ***********

93. spacer 1.2|1045126|33|NZ_CP022139|PILER-CR matches to MH572385 (Microviridae sp. isolate SD_SF_10, complete genome) position: , mismatch: 8, identity: 0.758

gaattagaaatgatcgatgtagccaggaacgga	CRISPR spacer
cacctagaaatgatcgattaagccaggaacact	Protospacer
 * .**************  **********.  

94. spacer 1.8|1045492|33|NZ_CP022139|PILER-CR matches to KX397366 (Erwinia phage vB_EamM_ChrisDB, complete genome) position: , mismatch: 8, identity: 0.758

gcggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
ggcgttccggtcgtgtcgtcgccgtacaccgcc	Protospacer
*  **.   ****.****** ************

95. spacer 1.10|1045614|33|NZ_CP022139|PILER-CR matches to MT889376 (Arthrobacter phage Phives, complete genome) position: , mismatch: 8, identity: 0.758

gggcgacggcgtagagcttgccttgggtacgcc	CRISPR spacer
cggcggcggcgtagagcttgccttcggcgatct	Protospacer
 ****.****************** **..  *.

96. spacer 1.39|1045432|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP042276 (Agrobacterium tumefaciens strain 186 plasmid pAt, complete sequence) position: , mismatch: 8, identity: 0.75

ttaactgcgtcaatatcggtgatgataactct	CRISPR spacer
atgacatcgtcaagatcggtgatgatagctac	Protospacer
 *.**  ****** *************.** .

97. spacer 1.39|1045432|32|NZ_CP022139|CRISPRCasFinder,CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.75

ttaactgcgtcaatatcggtgatgataactct	CRISPR spacer
aaagttccgtccatatcggtgacgataacttt	Protospacer
  *..* **** **********.*******.*

98. spacer 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_KX443401 (Rhodococcus hoagii strain PAM1572 plasmid pVAPN1572, complete sequence) position: , mismatch: 8, identity: 0.75

cggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
cggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
*******************  ***  .* .* 

99. spacer 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 8, identity: 0.75

cggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
cggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
*******************  ***  .* .* 

100. spacer 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 8, identity: 0.75

cggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
cggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
*******************  ***  .* .* 

101. spacer 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 8, identity: 0.75

cggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
cggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
*******************  ***  .* .* 

102. spacer 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 8, identity: 0.75

cggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
cggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
*******************  ***  .* .* 

103. spacer 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 8, identity: 0.75

cggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
cggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
*******************  ***  .* .* 

104. spacer 1.40|1045493|32|NZ_CP022139|CRISPRCasFinder,CRT matches to KX397366 (Erwinia phage vB_EamM_ChrisDB, complete genome) position: , mismatch: 8, identity: 0.75

cggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
gcgttccggtcgtgtcgtcgccgtacaccgcc	Protospacer
  **.   ****.****** ************

105. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_KU130396 (Escherichia coli strain S68 plasmid pS68, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

106. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP010130 (Escherichia coli strain C9 plasmid A, complete genome) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

107. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP010233 (Escherichia coli strain S30 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

108. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP032445 (Salmonella enterica subsp. enterica serovar Fresno strain USMARC-69835 plasmid pSFR1-USMARC-69835, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

109. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP033963 (Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

110. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP020547 (Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

111. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MN915010 (Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

112. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MN915012 (Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

113. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MN915013 (Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

114. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP045189 (Escherichia coli strain NT1F31 plasmid pNT1F31-96kb, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

115. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP027327 (Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

116. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP045756 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

117. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP025239 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

118. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MK181565 (Escherichia coli plasmid pESBL20140131, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

119. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MK181566 (Escherichia coli plasmid p15078279, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

120. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

121. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to CP034252 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

122. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_024980 (Escherichia coli strain ESBL-315 plasmid pESBL-315, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

123. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_024978 (Escherichia coli strain ESBL-283 plasmid pESBL-283, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

124. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP040548 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-p3, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

125. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_019043 (Escherichia coli plasmid pND11_107, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

126. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

127. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP039490 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid pCFSAN000752, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

128. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP031615 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

129. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP024976 (Escherichia coli strain CV839-15 plasmid pCV839-15-p2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

130. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

131. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MG516908 (Escherichia coli plasmid pEc42, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

132. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to CP010831 (Shigella sonnei strain FORC_011 plasmid pFORC11.2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

133. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP025751 (Escherichia coli strain CV839-06 plasmid pCV839-06-p1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

134. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to CP051282 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-95663.1B, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

135. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP032495 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

136. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP040542 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-p3, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

137. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MN419435 (Escherichia coli strain 2016-40-14263 plasmid p14263, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

138. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_019111 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934a, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

139. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_016904 (Escherichia coli KO11FL plasmid pEKO1101, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

140. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_017665 (Escherichia coli W plasmid pRK1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

141. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP032888 (Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

142. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP041441 (Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

143. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_MH674341 (Escherichia coli strain EC07 plasmid pUR-EC07, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

144. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_MN241905 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM96, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

145. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP041394 (Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

146. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MN262643 (Escherichia coli strain EC009 plasmid pEC009.2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

147. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MN124285 (Escherichia coli strain RKI3099 plasmid pRKI3099a, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

148. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_KY748189 (Escherichia coli strain EC007 plasmid pEC007, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

149. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_KY865323 (Escherichia coli strain SY286M plasmid pECM13, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

150. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_KY748188 (Escherichia coli strain EC006 plasmid pEC006, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

151. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_KY748190 (Escherichia coli strain EC008 plasmid pEC008, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

152. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_MG948333 (Escherichia coli strain 2454 plasmid p2454, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

153. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_023326 (Escherichia coli ACN001 plasmid pACN001-F, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

154. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_019104 (Salmonella enterica subsp. enterica serovar Kentucky plasmid pCS0010A_95, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

155. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

156. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP048361 (Escherichia coli strain 53 plasmid p53_B, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

157. spacer 1.46|1045859|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP040536 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-p3, complete sequence) position: , mismatch: 8, identity: 0.75

ttcccgctgtttatatccggtgtattgcagga	CRISPR spacer
tcttccatttttatatccggagtatagcagga	Protospacer
*...*  * *********** **** ******

158. spacer 1.54|1046348|32|NZ_CP022139|CRISPRCasFinder,CRT matches to GU323318 (Enterobacteria phage CC31, complete genome) position: , mismatch: 8, identity: 0.75

aaaaactgacgtggtttgaacgcagggtgctg	CRISPR spacer
catagatgacgttgtttgaacgcatggtgcga	Protospacer
 * *. ****** *********** ***** .

159. spacer 1.62|1046836|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MH884512 (Bacillus phage vB_BpsS-140, complete genome) position: , mismatch: 8, identity: 0.75

tgtccgattattttatcgctatttgtgaaact	CRISPR spacer
tggaagattattttattgctattggtgaaggc	Protospacer
**   ***********.****** *****. .

160. spacer 1.64|1046958|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 8, identity: 0.75

acagggggaaccgggagcctccgcaagcttga	CRISPR spacer
aacgcgggaaccggaaacctccgcaagcgtcg	Protospacer
*  * *********.*.*********** * .

161. spacer 2.1|1055154|33|NZ_CP022139|PILER-CR matches to NZ_CP038614 (Arsenophonus nasoniae strain FIN plasmid pArsFIN2, complete sequence) position: , mismatch: 8, identity: 0.758

gatcttgcgccaatgcttttttactcttccctt	CRISPR spacer
gatcttccgccaaggcttttttacgcataatct	Protospacer
****** ****** ********** * *  ..*

162. spacer 2.10|1055155|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP038614 (Arsenophonus nasoniae strain FIN plasmid pArsFIN2, complete sequence) position: , mismatch: 8, identity: 0.75

atcttgcgccaatgcttttttactcttccctt	CRISPR spacer
atcttccgccaaggcttttttacgcataatct	Protospacer
***** ****** ********** * *  ..*

163. spacer 1.8|1045492|33|NZ_CP022139|PILER-CR matches to NZ_KX443401 (Rhodococcus hoagii strain PAM1572 plasmid pVAPN1572, complete sequence) position: , mismatch: 9, identity: 0.727

gcggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
ccggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
 *******************  ***  .* .* 

164. spacer 1.8|1045492|33|NZ_CP022139|PILER-CR matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.727

gcggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
ccggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
 *******************  ***  .* .* 

165. spacer 1.8|1045492|33|NZ_CP022139|PILER-CR matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.727

gcggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
ccggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
 *******************  ***  .* .* 

166. spacer 1.8|1045492|33|NZ_CP022139|PILER-CR matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.727

gcggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
ccggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
 *******************  ***  .* .* 

167. spacer 1.8|1045492|33|NZ_CP022139|PILER-CR matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.727

gcggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
ccggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
 *******************  ***  .* .* 

168. spacer 1.8|1045492|33|NZ_CP022139|PILER-CR matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.727

gcggtcgatgtcgcgtcgtccccgtacaccgcc	CRISPR spacer
ccggtcgatgtcgcgtcgtcgacgtcggcgacg	Protospacer
 *******************  ***  .* .* 

169. spacer 1.22|1046347|33|NZ_CP022139|PILER-CR matches to GU323318 (Enterobacteria phage CC31, complete genome) position: , mismatch: 9, identity: 0.727

gaaaaactgacgtggtttgaacgcagggtgctg	CRISPR spacer
tcatagatgacgttgtttgaacgcatggtgcga	Protospacer
  * *. ****** *********** ***** .

170. spacer 1.30|1046835|33|NZ_CP022139|PILER-CR matches to MH884512 (Bacillus phage vB_BpsS-140, complete genome) position: , mismatch: 9, identity: 0.727

gtgtccgattattttatcgctatttgtgaaact	CRISPR spacer
atggaagattattttattgctattggtgaaggc	Protospacer
.**   ***********.****** *****. .

171. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_047733 (Synechococcus phage S-RIM8 isolate RW_22_0300, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

172. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to JF974289 (Synechococcus phage S-RIM8 A.HR3, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

173. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MK493323 (Synechococcus phage S-RIM8 isolate RW_03_0617, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

174. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MK493325 (Synechococcus phage S-RIM8 isolate RW_62_0316, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

175. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MK493322 (Synechococcus phage S-RIM8 isolate RW_01_0115_WH8101, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

176. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to KX349288 (Synechococcus phage S-RIM8 isolate RW_08_0711, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

177. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_020486 (Synechococcus phage S-RIM8 A.HR1, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

178. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to KX349286 (Synechococcus phage S-RIM8 isolate RW_03_0807_WH8101, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

179. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to HQ317385 (Synechococcus phage S-RIM8 A.HR5, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

180. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MK493324 (Synechococcus phage S-RIM8 isolate RW_22_0214, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

181. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to KX349290 (Synechococcus phage S-RIM8 isolate RW_25_1112, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

182. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to KX349285 (Synechococcus phage S-RIM8 isolate RW_01_0212_WH8101, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

183. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to KX349287 (Synechococcus phage S-RIM8 isolate RW_06_0613, complete genome) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

184. spacer 1.36|1045249|32|NZ_CP022139|CRISPRCasFinder,CRT matches to JF974293 (Cyanophage KBS-M-1A genomic sequence) position: , mismatch: 9, identity: 0.719

ccttcatgttcgatgataactgttttattact	CRISPR spacer
atacaatcttcgatgataacggttttattcat	Protospacer
 . . ** ************ ********  *

185. spacer 1.51|1046165|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 9, identity: 0.719

ggaaccgtcctcggggagatgttcgttatcgt	CRISPR spacer
ggaaccgtcctcggggagaggttatgaacgac	Protospacer
******************* ***    *. ..

186. spacer 2.13|1055338|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP031268 (Staphylococcus warneri strain 16A plasmid unnamed2) position: , mismatch: 9, identity: 0.719

aggatatttaaatatggtaactaaaatatatt	CRISPR spacer
ttattatttaaatatggtaaatcaaatttttc	Protospacer
  . **************** * **** * *.

187. spacer 2.13|1055338|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP031268 (Staphylococcus warneri strain 16A plasmid unnamed2) position: , mismatch: 9, identity: 0.719

aggatatttaaatatggtaactaaaatatatt	CRISPR spacer
ttattatttaaatatggtaaatcaaatttttc	Protospacer
  . **************** * **** * *.

188. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to JF974293 (Cyanophage KBS-M-1A genomic sequence) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

189. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to NC_047733 (Synechococcus phage S-RIM8 isolate RW_22_0300, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

190. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to JF974289 (Synechococcus phage S-RIM8 A.HR3, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

191. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to MK493323 (Synechococcus phage S-RIM8 isolate RW_03_0617, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

192. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to MK493325 (Synechococcus phage S-RIM8 isolate RW_62_0316, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

193. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to MK493322 (Synechococcus phage S-RIM8 isolate RW_01_0115_WH8101, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

194. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to KX349288 (Synechococcus phage S-RIM8 isolate RW_08_0711, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

195. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to NC_020486 (Synechococcus phage S-RIM8 A.HR1, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

196. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to KX349286 (Synechococcus phage S-RIM8 isolate RW_03_0807_WH8101, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

197. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to HQ317385 (Synechococcus phage S-RIM8 A.HR5, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

198. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to MK493324 (Synechococcus phage S-RIM8 isolate RW_22_0214, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

199. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to KX349290 (Synechococcus phage S-RIM8 isolate RW_25_1112, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

200. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to KX349285 (Synechococcus phage S-RIM8 isolate RW_01_0212_WH8101, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

201. spacer 1.4|1045248|33|NZ_CP022139|PILER-CR matches to KX349287 (Synechococcus phage S-RIM8 isolate RW_06_0613, complete genome) position: , mismatch: 10, identity: 0.697

gccttcatgttcgatgataactgttttattact	CRISPR spacer
catacaatcttcgatgataacggttttattcat	Protospacer
  . . ** ************ ********  *

202. spacer 1.35|1045188|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

caggcctaactcaacggcccgggcgaaatttt	CRISPR spacer
gtcgccgaactcaacggccagggcgaggtcgc	Protospacer
   *** ************ ******..*. .

203. spacer 1.38|1045371|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP041067 (Bacillus megaterium strain KNU-01 plasmid pKNU_01_3, complete sequence) position: , mismatch: 10, identity: 0.688

gaattacgagagagaaatgaaaactttagtta	CRISPR spacer
gaataacgatagagaaatgaaaaaatggcgcc	Protospacer
**** **** *************  * .  . 

204. spacer 1.52|1046226|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 10, identity: 0.688

acctataccgccagcgaactggctattgggct	CRISPR spacer
ctgtcgctcgccagcgaaccggcgattgggcc	Protospacer
 . *   .***********.*** *******.

205. spacer 1.58|1046592|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP025946 (Escherichia coli strain SCEC020023 plasmid p2_020023, complete sequence) position: , mismatch: 10, identity: 0.688

atgcgcctgtcttttttccacttcaggctcgg	CRISPR spacer
agtagcctgtattttttccacttgaggggaaa	Protospacer
*   ****** ************ ***   ..

206. spacer 1.60|1046714|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.688

tttacccgccgcgaggttctctttggtattga	CRISPR spacer
gacggccgccgcgagcttttctttggtaggaa	Protospacer
  .. ********** **.*********  .*

207. spacer 1.60|1046714|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.688

tttacccgccgcgaggttctctttggtattga	CRISPR spacer
gacggccgccgcgagcttttctttggtaggaa	Protospacer
  .. ********** **.*********  .*

208. spacer 2.13|1055338|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 10, identity: 0.688

aggatatttaaatatggtaactaaaatatatt	CRISPR spacer
aatgcatttgaatattgtaactaaaatagggg	Protospacer
*. ..****.***** ************ .  

209. spacer 1.37|1045310|32|NZ_CP022139|CRISPRCasFinder,CRT matches to AP017993 (Planktothrix agardhii NIES-204 plasmid plasmid2 DNA, complete sequence) position: , mismatch: 11, identity: 0.656

caggtactctatcctgataatgttcttcagcc	CRISPR spacer
ggctggatctatcctgataatgatcttgagtt	Protospacer
 .   . *************** **** **..

210. spacer 1.60|1046714|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 11, identity: 0.656

tttacccgccgcgaggttctctttggtattga	CRISPR spacer
ttgacccgccgcgaagttctcttctcccgctt	Protospacer
** ***********.********.  .  .  

211. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_048647 (UNVERIFIED: Klebsiella phage KNP2 genomic sequence) position: , mismatch: 11, identity: 0.656

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
attctgttttcgcagagctgcttggtgtaaca	Protospacer
  .  .. .*****************.* ***

212. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MK024806 (Proteus phage Mydo, complete genome) position: , mismatch: 11, identity: 0.656

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
attctgttttcgcagagctgcttggtgtaaca	Protospacer
  .  .. .*****************.* ***

213. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to KX452695 (UNVERIFIED: Klebsiella phage KPN2 genomic sequence) position: , mismatch: 11, identity: 0.656

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
attctgttttcgcagagctgcttggtgtaaca	Protospacer
  .  .. .*****************.* ***

214. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_048656 (Klebsiella phage vB_KpnM_BIS47, complete genome) position: , mismatch: 11, identity: 0.656

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
attctgttttcgcagagctgcttggtgtaaca	Protospacer
  .  .. .*****************.* ***

215. spacer 2.14|1055399|32|NZ_CP022139|CRISPRCasFinder,CRT matches to NC_028659 (Klebsiella phage vB_KpnM_KB57, complete genome) position: , mismatch: 11, identity: 0.656

cgcaaacactcgcagagctgcttggtatcaca	CRISPR spacer
attctgttttcgcagagctgcttggtgtaaca	Protospacer
  .  .. .*****************.* ***

216. spacer 2.18|1055643|32|NZ_CP022139|CRISPRCasFinder,CRT matches to MN047793 (Xanthomonas phage Xoo-sp13, complete genome) position: , mismatch: 11, identity: 0.656

agggggatatgattattacatggattgattca	CRISPR spacer
caatccatatgattatcatatggattgataat	Protospacer
 ..   **********.*.**********   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1205658 : 1219473 15 Enterobacteria_phage(88.89%) integrase attL 1214873:1214888|attR 1222087:1222102
DBSCAN-SWA_2 1644607 : 1661662 31 Salmonella_phage(47.62%) NA NA
DBSCAN-SWA_3 1665087 : 1687441 28 Salmonella_phage(31.82%) head,terminase,portal,capsid,plate,tail,protease NA
DBSCAN-SWA_4 1762249 : 1770816 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_5 2529643 : 2576488 66 Burkholderia_phage(24.39%) integrase,terminase,tail attL 2549377:2549393|attR 2584394:2584410
DBSCAN-SWA_6 2961781 : 2969415 9 Morganella_phage(28.57%) NA NA
DBSCAN-SWA_7 3648067 : 3686957 30 Enterobacteria_phage(28.57%) transposase,integrase,plate attL 3640457:3640472|attR 3665537:3665552
DBSCAN-SWA_8 4453364 : 4500337 46 Burkholderia_phage(47.06%) tRNA,tail,plate NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP022139.1|WP_080227991.1|1662852_1663044_-|hypothetical-protein 1662852_1663044_- 63 aa aa 68 NA NA No NA
NZ_CP022139.1|WP_080226504.1|2571437_2571734_+|hypothetical-protein 2571437_2571734_+ 98 aa aa NA NA NA 2529643-2576488 yes