1. spacer 2.14|964669|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
gccgggtgccatgatataccggaatctggttc CRISPR spacer
gccgggtgccatgatataccggtatctggttc Protospacer
********************** *********
2. spacer 2.19|964974|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.969
aacgacaaaacccactggattatttttgtgaa CRISPR spacer
aacgataaaacccactggattatttttgtgaa Protospacer
*****.**************************
3. spacer 2.19|964974|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to JQ806764 (Salmonella phage vB_SosS_Oslo, complete genome) position: , mismatch: 1, identity: 0.969
aacgacaaaacccactggattatttttgtgaa CRISPR spacer
aacgataaaacccactggattatttttgtgaa Protospacer
*****.**************************
4. spacer 2.19|964974|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP051279 (Salmonella phage ST-35, complete genome) position: , mismatch: 1, identity: 0.969
aacgacaaaacccactggattatttttgtgaa CRISPR spacer
aacgataaaacccactggattatttttgtgaa Protospacer
*****.**************************
5. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010173 (Escherichia coli strain H8 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.938
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgccgggatattgcgccgagccgaaaa Protospacer
*********************** *****.**
6. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021729 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence) position: , mismatch: 2, identity: 0.938
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgccgggatattgcgccgagccgaaaa Protospacer
*********************** *****.**
7. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046005 (Escherichia coli strain 1919D3 plasmid p1919D3-2, complete sequence) position: , mismatch: 2, identity: 0.938
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgccgggatattgcgccgagccgaaaa Protospacer
*********************** *****.**
8. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MG592476 (Vibrio phage 1.104.O._10N.286.49.A12, partial genome) position: , mismatch: 2, identity: 0.938
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgcagggatattgcgccgagccgagaa Protospacer
******** ************** ********
9. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MG592538 (Vibrio phage 1.171.O._10N.261.52.F12, partial genome) position: , mismatch: 2, identity: 0.938
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgccgggatactgcgccgagccgagaa Protospacer
***************.******* ********
10. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MG592428 (Vibrio phage 1.046.O._10N.286.52.E3, partial genome) position: , mismatch: 2, identity: 0.938
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgcagggatattgcgccgagccgagaa Protospacer
******** ************** ********
11. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP054337 (Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence) position: , mismatch: 4, identity: 0.875
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgccgggatattgcgccgagcagaggc Protospacer
*********************** ** ***.
12. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021537 (Escherichia coli strain AR_0119 plasmid unitig_3, complete sequence) position: , mismatch: 4, identity: 0.875
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgccgggatattgcgccgagcagaggc Protospacer
*********************** ** ***.
13. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026938 (Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence) position: , mismatch: 4, identity: 0.875
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgccgggatattgcgccgagcagaggc Protospacer
*********************** ** ***.
14. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH844525 (Escherichia coli strain SCEC128 plasmid pSCEC128, complete sequence) position: , mismatch: 4, identity: 0.875
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgccgggatattgcgccgagcagaggc Protospacer
*********************** ** ***.
15. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH580301 (Escherichia coli strain 1107 plasmid p1107-99K, complete sequence) position: , mismatch: 4, identity: 0.875
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgccgggatattgcgccgagcagaggc Protospacer
*********************** ** ***.
16. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042508 (Leclercia adecarboxylata strain E1 plasmid pE1_003, complete sequence) position: , mismatch: 4, identity: 0.875
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgccgggatattacgccgcgcagtcaa Protospacer
*****************.******** * **
17. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040893 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_2, complete sequence) position: , mismatch: 4, identity: 0.875
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
gcgtgcgccgggatattacgccgcgcagtcaa Protospacer
*****************.******** * **
18. spacer 2.19|964974|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045829 (Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_02, complete sequence) position: , mismatch: 5, identity: 0.844
aacgacaaaacccactggattatttttgtgaa CRISPR spacer
ggtgacaagacccactggattatttttatgaa Protospacer
...*****.******************.****
19. spacer 2.19|964974|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_019522 (Pectobacterium phage ZF40, complete genome) position: , mismatch: 5, identity: 0.844
aacgacaaaacccactggattatttttgtgaa CRISPR spacer
ggtgacaaaacccattggattatttttgttaa Protospacer
...***********.************** **
20. spacer 3.31|983939|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to AP014117 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C36-MedDCM-OCT-S25-C108, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.844
attgacttgaatagtatcaaacatggattaac-- CRISPR spacer
attgacttgaatagtatcagtcatgg--taagta Protospacer
*******************. ***** ***
21. spacer 3.33|984061|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 5, identity: 0.844
-cgccgccactggtcggccgcgtgaatcagttt CRISPR spacer
tcgccgtc-ctggtcggccgagtgaagcagttc Protospacer
*****.* *********** ***** *****.
22. spacer 3.40|984489|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
ggcgcaaag-gccatcgacggacaagaaaaccc CRISPR spacer
-gagcaaggcgccatcgacgggcaggaaaaccc Protospacer
* ****.* ***********.**.********
23. spacer 3.40|984489|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.844
ggcgcaaag-gccatcgacggacaagaaaaccc CRISPR spacer
-gagcaaggcgccatcgacgggcaggaaaaccc Protospacer
* ****.* ***********.**.********
24. spacer 3.2|982169|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 6, identity: 0.812
cgccaccacctgcgcctccggcccc-gccttac CRISPR spacer
ggccaccacctgcacccccggcccctggcata- Protospacer
************.**.******** * * **
25. spacer 3.15|982962|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP027408 (Roseobacter denitrificans strain FDAARGOS_309 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
gcagttacggcgctggtgctggggcagaacat CRISPR spacer
gccccttcggcgctggtgctgggggataacat Protospacer
** .* ***************** * *****
26. spacer 3.15|982962|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_008387 (Roseobacter denitrificans OCh 114 plasmid pTB2, complete sequence) position: , mismatch: 6, identity: 0.812
gcagttacggcgctggtgctggggcagaacat CRISPR spacer
gccccttcggcgctggtgctgggggataacat Protospacer
** .* ***************** * *****
27. spacer 3.30|983878|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 6, identity: 0.812
--tcagcgtgatatcgcccgtcagcgccttgttg CRISPR spacer
catcgccgagata--gcccgtcagcgccttgtcg Protospacer
**. ** **** *****************.*
28. spacer 3.40|984489|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ggcgcaaag-gccatcgacggacaagaaaaccc CRISPR spacer
-gaacaaggcgccatcgacgggcaggaaaaccc Protospacer
* .***.* ***********.**.********
29. spacer 2.15|964730|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040784 (Bacillus thuringiensis strain HM-311 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
aacgtcgtatacatcgttctattttggtcatt CRISPR spacer
aaggtcgtataaatcgttctattcaattgatt Protospacer
** ******** ***********. . * ***
30. spacer 2.16|964791|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045400 (Halomonas sp. THAF12 plasmid pTHAF12_a, complete sequence) position: , mismatch: 7, identity: 0.781
cgcgcgatcaggtcgctgaaccggtcaaaatt CRISPR spacer
tccgcgatcaggtcgttgatccggtcaatgtg Protospacer
. *************.*** ******** .*
31. spacer 2.19|964974|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MG592461 (Vibrio phage 1.086.O._10N.222.51.F8, partial genome) position: , mismatch: 7, identity: 0.781
aacgacaaaacccactggattatttttgtgaa CRISPR spacer
agcgcagatacccactggattatgtttatgaa Protospacer
*.** .* ************** ***.****
32. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtg-cgccgggatattgcgccgcgccgagaa CRISPR spacer
-catgccgccgcgatattgccccgcgccgccag Protospacer
*.** ***** ******** ******** *.
33. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtg-cgccgggatattgcgccgcgccgagaa CRISPR spacer
-catgccgccgcgatattgccccgcgccgccag Protospacer
*.** ***** ******** ******** *.
34. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtg-cgccgggatattgcgccgcgccgagaa CRISPR spacer
-catgccgccgcgatattgccccgcgccgccag Protospacer
*.** ***** ******** ******** *.
35. spacer 2.23|965218|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012899 (Burkholderia sp. CCGE1001 plasmid pCCGE1001a, complete sequence) position: , mismatch: 7, identity: 0.781
cgctgacgaggtcgcgcgcgtggctgctgcgc CRISPR spacer
ctccgagcagctcgcgcgcgtggcggctgcgt Protospacer
* *.** ** ************* ******.
36. spacer 2.23|965218|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.781
cgctgacgaggtcgcgcgcgtggctgctgcgc CRISPR spacer
cgccgacgatgtcgcgcgcgtggtggccgaac Protospacer
***.***** *************. **.* .*
37. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP039495 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
38. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KY709687 (Salmonella phage 29485, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
39. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to AJ011580 (Bacteriophage PS34 lysis genes 13, 19, 15, antiterminator gene 23, and packaging gene 3, complete cds) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
40. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KU927496 (Salmonella phage 101962B_sal5, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
41. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KU927491 (Salmonella phage 146851_sal5, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
42. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MG969415 (UNVERIFIED: Salmonella phage GE_vB_TR, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
43. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KU927495 (Salmonella phage 103203_sal4, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
44. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KU927498 (Salmonella phage 64795_sal4, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
45. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KU927492 (Salmonella phage 146851_sal4, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
46. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_030919 (Salmonella phage 118970_sal4, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
47. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_028696 (Salmonella phage SEN22, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
48. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_018275 (Salmonella phage vB_SemP_Emek, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
49. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to JQ806764 (Salmonella phage vB_SosS_Oslo, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
50. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
51. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_017985 (Salmonella phage SPN9CC, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
52. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_042346 (Salmonella virus BTP1 genome assembly, chromosome: BTP1) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
53. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
54. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
55. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MT932212 (Salmonella phage VSe13, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
56. spacer 3.35|984184|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034088 (Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence) position: , mismatch: 7, identity: 0.781
-gcgatcacaaacgacgacgccgattttattga CRISPR spacer
atccgtca-gaacgacgacgccgatttttgtga Protospacer
* .*** .****************** ***
57. spacer 3.40|984489|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 7, identity: 0.781
ggcgcaaaggccatcgacggacaagaaaaccc CRISPR spacer
atcgggaaggctatcgacggacaaaaaaacac Protospacer
. ** .*****.************.***** *
58. spacer 3.40|984489|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 7, identity: 0.781
ggcgcaaag-gccatcgacggacaagaaaaccc CRISPR spacer
-gaacagggcgccatcgacgggcaggaaaaccc Protospacer
* .**..* ***********.**.********
59. spacer 2.8|964303|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_008739 (Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence) position: , mismatch: 8, identity: 0.75
taatcgtgatgagttgccatgcacgcagctgc CRISPR spacer
gaacagtgatgagttgtcatgcacacagtgcc Protospacer
**. ***********.*******.***. *
60. spacer 2.19|964974|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MK905543 (Vibrio phage USC-1, complete genome) position: , mismatch: 8, identity: 0.75
aacgacaaaacccactggattatttttgtgaa CRISPR spacer
taaaacaaaacccactggattagttttacaat Protospacer
* .****************** ****...*
61. spacer 2.19|964974|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MK358448 (Vibrio phage 5, complete genome) position: , mismatch: 8, identity: 0.75
aacgacaaaacccactggattatttttgtgaa CRISPR spacer
taaaacaaaacccactggattagttttacaat Protospacer
* .****************** ****...*
62. spacer 2.23|965218|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041350 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pB, complete sequence) position: , mismatch: 8, identity: 0.75
cgctgacg-aggtcgcgcgcgtggctgctgcgc CRISPR spacer
-gcatatacaggtggagcgcgtggctgctgcgg Protospacer
** *.. **** * ****************
63. spacer 3.2|982169|32|NZ_CP022138|CRISPRCasFinder,CRT matches to CP021183 (Sphingomonas wittichii DC-6 plasmid pDC02, complete sequence) position: , mismatch: 8, identity: 0.75
cgccaccacctgcgcctccggccccgccttac CRISPR spacer
ccgcgccgcccgcgcctccggccccgccggtc Protospacer
* *.**.**.***************** *
64. spacer 3.6|982413|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_007595 (Synechococcus elongatus PCC 7942 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
gtgaacgcgagaaaataaaaaggccaacatag CRISPR spacer
gtgaaaccgagaaaataaaaagggaatctaaa Protospacer
***** **************** * * *.
65. spacer 3.6|982413|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_004073 (Synechococcus elongatus PCC 7942 plasmid pANL, complete sequence) position: , mismatch: 8, identity: 0.75
gtgaacgcgagaaaataaaaaggccaacatag CRISPR spacer
gtgaaaccgagaaaataaaaagggaatctaaa Protospacer
***** **************** * * *.
66. spacer 3.10|982657|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MN694611 (Marine virus AFVG_250M767, complete genome) position: , mismatch: 8, identity: 0.75
accagaaaatttaactatatcacc---ttcggaca CRISPR spacer
agcagaatatttaactgtatcacctgttttgc--- Protospacer
* ***** ********.******* **.*
67. spacer 3.12|982779|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MN693032 (Marine virus AFVG_117M42, complete genome) position: , mismatch: 8, identity: 0.75
cgagagagctgaatatcaagctgtatctccga CRISPR spacer
acaaagagctgaatatcaagcagcatctgata Protospacer
*.***************** *.**** *
68. spacer 3.29|983817|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MH622943 (Myoviridae sp. isolate ctbc_4, complete genome) position: , mismatch: 8, identity: 0.75
cggctatttgaagagactccgggtggagacct CRISPR spacer
agagtatttgaagaaactccgggtggaatttt Protospacer
*. **********.************. ..*
69. spacer 3.33|984061|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to MN234226 (Mycobacterium phage Curiosium, complete genome) position: , mismatch: 8, identity: 0.75
cgccgccactggtcggccgcgtgaatcagttt CRISPR spacer
cgccgccactggtcggccgcttgggggcgtcg Protospacer
******************** **.. **.
70. spacer 3.38|984367|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NC_017543 (Paenibacillus polymyxa M1 plasmid pPPM1a, complete sequence) position: , mismatch: 8, identity: 0.75
attaatacctactgactgtaaatat-tgcgaca CRISPR spacer
gataatacctgctgagtgtaaatatctgtagc- Protospacer
. ********.**** ********* **...*
71. spacer 2.12|964547|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016593 (Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence) position: , mismatch: 9, identity: 0.719
tgtacgtcgcgccgctgtcgtcaggataaatg CRISPR spacer
aataggtcgcgccgctgtcgtcgggcgcatag Protospacer
.** *****************.** * *
72. spacer 2.12|964547|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_017386 (Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
tgtacgtcgcgccgctgtcgtcaggataaatg CRISPR spacer
aataggtcgcgccgctgtcgtcgggcgcatag Protospacer
.** *****************.** * *
73. spacer 2.12|964547|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_014621 (Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence) position: , mismatch: 9, identity: 0.719
tgtacgtcgcgccgctgtcgtcaggataaatg CRISPR spacer
aataggtcgcgccgctgtcgtcgggcgcatag Protospacer
.** *****************.** * *
74. spacer 2.12|964547|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012909 (Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
tgtacgtcgcgccgctgtcgtcaggataaatg CRISPR spacer
aataggtcgcgccgctgtcgtcgggcgcatag Protospacer
.** *****************.** * *
75. spacer 2.19|964974|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_023571 (Oenococcus phage phiS11, complete genome) position: , mismatch: 9, identity: 0.719
aacgacaaaacccactggattatttttgtgaa CRISPR spacer
attgaaaacacccactggattattttccggtg Protospacer
* .** ** *****************. * .
76. spacer 2.19|964974|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MH220877 (Oenococcus phage phiOE33PA, complete genome) position: , mismatch: 9, identity: 0.719
aacgacaaaacccactggattatttttgtgaa CRISPR spacer
attgaaaacacccactggattattttccggtg Protospacer
* .** ** *****************. * .
77. spacer 2.20|965035|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 9, identity: 0.719
ttccgccatgaccgtttcagcctccagctttc CRISPR spacer
gaccgccatgcccgattcagcctcccccacac Protospacer
******** *** ********** * . *
78. spacer 2.21|965096|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to AP013461 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S24-C21) position: , mismatch: 9, identity: 0.719
gaatttatggataacggcggtatgtacgcgcc CRISPR spacer
ggtgctatgggtaagggcggtatgtacggctc Protospacer
*. .*****.*** ************* .*
79. spacer 2.21|965096|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to AP013749 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S45-C34, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
gaatttatggataacggcggtatgtacgcgcc CRISPR spacer
ggtgctatgggtaagggcggtatgtacggctc Protospacer
*. .*****.*** ************* .*
80. spacer 2.21|965096|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to AP013462 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S33-C24) position: , mismatch: 9, identity: 0.719
gaatttatggataacggcggtatgtacgcgcc CRISPR spacer
ggtgctatgggtaagggcggtatgtacggctc Protospacer
*. .*****.*** ************* .*
81. spacer 2.21|965096|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to AP013743 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S34-C32, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
gaatttatggataacggcggtatgtacgcgcc CRISPR spacer
ggtgctatgggtaagggcggtatgtacggctc Protospacer
*. .*****.*** ************* .*
82. spacer 2.21|965096|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to AP014436 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S31-C13, *** SEQUENCING IN PROGRESS ***, 5 ordered pieces) position: , mismatch: 9, identity: 0.719
gaatttatggataacggcggtatgtacgcgcc CRISPR spacer
ggtgctatgggtaagggcggtatgtacggctc Protospacer
*. .*****.*** ************* .*
83. spacer 2.21|965096|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to AP013742 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S30-C25, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
gaatttatggataacggcggtatgtacgcgcc CRISPR spacer
ggtgctatgggtaagggcggtatgtacggctc Protospacer
*. .*****.*** ************* .*
84. spacer 2.21|965096|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to AP013463 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S42-C45) position: , mismatch: 9, identity: 0.719
gaatttatggataacggcggtatgtacgcgcc CRISPR spacer
ggtgctatgggtaagggcggtatgtacggctc Protospacer
*. .*****.*** ************* .*
85. spacer 2.21|965096|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to AP013747 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S43-C36, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
gaatttatggataacggcggtatgtacgcgcc CRISPR spacer
ggtgctatgggtaagggcggtatgtacggctc Protospacer
*. .*****.*** ************* .*
86. spacer 2.21|965096|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to AP013746 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S40-C25, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
gaatttatggataacggcggtatgtacgcgcc CRISPR spacer
ggtgctatgggtaagggcggtatgtacggctc Protospacer
*. .*****.*** ************* .*
87. spacer 2.21|965096|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to AP013745 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S39-C31, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
gaatttatggataacggcggtatgtacgcgcc CRISPR spacer
ggtgctatgggtaagggcggtatgtacggctc Protospacer
*. .*****.*** ************* .*
88. spacer 2.21|965096|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to AP013748 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S44-C33, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
gaatttatggataacggcggtatgtacgcgcc CRISPR spacer
ggtgctatgggtaagggcggtatgtacggctc Protospacer
*. .*****.*** ************* .*
89. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
tcgcgcgccgggatattgcgcagcgtgaacgc Protospacer
**.***************** ***. .* .
90. spacer 2.25|965340|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MK016501 (Mycobacterium phage Nebkiss, complete genome) position: , mismatch: 9, identity: 0.719
caagcggatgtcgtgaaaaaactcaacgacgc CRISPR spacer
gatccagatgtcgtgaaaaagatcaacgaaat Protospacer
* *.**************. ******* ..
91. spacer 3.2|982169|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719
cgccaccacctgcgcctccggccccgccttac CRISPR spacer
ggggaccacctgcgcgtccggcccggcgagaa Protospacer
* *********** ******** ** *
92. spacer 3.15|982962|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 9, identity: 0.719
gcagttacggcgctggtgctggggcagaacat CRISPR spacer
accacggcggcgctggtggtgtggcagaacct Protospacer
.* .. .*********** ** ******** *
93. spacer 3.22|983389|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ggggtatccgttatcgccgatcgctaccagaa CRISPR spacer
cgcatcaccgtgctcgccgatcgctaccaggg Protospacer
* .* **** *****************..
94. spacer 3.22|983389|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ggggtatccgttatcgccgatcgctaccagaa CRISPR spacer
cgcatcaccgtgctcgccgatcgctaccaggg Protospacer
* .* **** *****************..
95. spacer 3.24|983511|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_029094 (Pseudoalteromonas phage H101, complete genome) position: , mismatch: 9, identity: 0.719
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
acaaaaaggcttacaattatgaatatcgatca Protospacer
* ******.******* ******** . *
96. spacer 3.24|983511|32|NZ_CP022138|CRISPRCasFinder,CRT matches to AP013511 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-C117A-MedDCM-OCT-S32-C49) position: , mismatch: 9, identity: 0.719
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
actcgagattttagaattatgaatataacaaa Protospacer
* . .*.. **** *** **************
97. spacer 3.24|983511|32|NZ_CP022138|CRISPRCasFinder,CRT matches to AP013877 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C117A-MedDCM-OCT-S27-C30, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
actcgagattttagaattatgaatataacaaa Protospacer
* . .*.. **** *** **************
98. spacer 3.30|983878|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 9, identity: 0.719
tcagcgtgatatcgcccgtcagcgccttgttg CRISPR spacer
agtgcgtgatctcccccgtcagcgccccggcg Protospacer
******* ** ************..* .*
99. spacer 3.30|983878|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 9, identity: 0.719
tcagcgtgatatcgcccgtcagcgccttgttg CRISPR spacer
tgatgatggtatcgcccgtcaccgccttgcgc Protospacer
* * .**.************ *******.
100. spacer 3.32|984000|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to MG976803 (Escherichia phage myPSH2311, complete genome) position: , mismatch: 9, identity: 0.719
gtgtgccaatccatccatgtgctttgttactt CRISPR spacer
taatgcctatccatccatgtgctgtgtttaag Protospacer
.**** *************** ****
101. spacer 3.32|984000|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.719
gtgtgccaatccatccatgtgctttgttactt CRISPR spacer
gtgtgccaacgcatccatgtgctcgatggcgg Protospacer
*********. ************. .* .*
102. spacer 3.38|984367|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040831 (Paenibacillus polymyxa strain ZF129 plasmid pAP2, complete sequence) position: , mismatch: 9, identity: 0.719
attaatacctactgactgtaaatattgcgaca CRISPR spacer
gataatacctgctgagtgtaaatatcttcaga Protospacer
. ********.**** *********. . * *
103. spacer 3.45|984794|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
104. spacer 3.45|984794|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
105. spacer 3.45|984794|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NC_007814 (Bacillus phage Fah, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
106. spacer 3.45|984794|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to KY963370 (Bacillus phage Negev_SA, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
107. spacer 3.45|984794|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to DQ150593 (Bacillus anthracis bacteriophage Fah, complete sequence) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
108. spacer 3.45|984794|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to DQ222853 (Bacillus anthracis phage Gamma isolate 51, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
109. spacer 3.45|984794|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to DQ221100 (Bacteriophage gamma putative terminase small subunit, putative terminase large subunit, putative portal protein, putative prohead protease, putative phage structural protein, putative DNA packaging protein, putative head-tail adaptor, phage related proteins, putative major tail protein, phage related protein, putative tail tape measure protein, phage related protein, putative minor structural protein, putative holin, N-acetylmuramoyl-L-alanine amidase (PlyG), putative lipoprotein, putative transcriptional regulator, conserved hypothetical proteins, FtsK/SpoIIIE family protein, phage related protein, conserved hypothetical protein, putative transcriptional regulator, putative site-specific recombinase, conserved hypothetical protein, putative transcriptional regulators, putative antirepressor, conserved hypothetical protein, putative DNA replication proteins, conserved hypothetical protein, phage related proteins, conserved hypothetical protein, putative transglycosylase, and putative endonuclease genes, complete cds) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
110. spacer 3.45|984794|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to DQ222851 (Bacillus anthracis phage Cherry, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
111. spacer 3.45|984794|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to DQ289556 (Bacillus anthracis phage Gamma isolate d'Herelle, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
112. spacer 3.45|984794|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
113. spacer 3.45|984794|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NC_007458 (Bacillus phage Gamma, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
114. spacer 2.7|964242|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MK672802 (Vibrio phage Va_90-11-286_p16, complete genome) position: , mismatch: 10, identity: 0.688
ttcgcgccagattttagcgaggtgatacaggt CRISPR spacer
gaggcgccatattgtagcgaggtgattattga Protospacer
****** *** ************ *
115. spacer 2.7|964242|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MK672805 (Vibrio phage Va_PF430-3_p42, complete genome) position: , mismatch: 10, identity: 0.688
ttcgcgccagattttagcgaggtgatacaggt CRISPR spacer
gaggcgccatattgtagcgaggtgattattga Protospacer
****** *** ************ *
116. spacer 2.12|964547|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 10, identity: 0.688
tgtacgtcgcgccgctgtcgtcaggataaatg CRISPR spacer
ggtaggttgcgccgctgtcgtcagacagaccc Protospacer
*** **.****************. .* .
117. spacer 2.16|964791|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_023282 (Streptomyces sp. FR1 plasmid pFRL2, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgcgatcaggtcgctgaaccggtcaaaatt CRISPR spacer
tcggcgatcaggtcgccgatccggtccgcgtc Protospacer
. *************.** ****** . .*.
118. spacer 2.16|964791|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgcgatcaggtcgctgaaccggtcaaaatt CRISPR spacer
tgcgcgatcaagtcgctgacccggcgcacgcc Protospacer
.*********.******** ****. * ...
119. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010682 (Phaeobacter piscinae strain P14 plasmid pP14_a, complete sequence) position: , mismatch: 10, identity: 0.688
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
cggtgccccaggatattgcgccgcgcatgccg Protospacer
**** **.**************** . .
120. spacer 2.22|965157|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010644 (Phaeobacter piscinae strain P36 plasmid pP36_a, complete sequence) position: , mismatch: 10, identity: 0.688
gcgtgcgccgggatattgcgccgcgccgagaa CRISPR spacer
cggtgccccaggatattgcgccgcgcacgccg Protospacer
**** **.**************** . .
121. spacer 3.2|982169|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cgccaccacctgcgcctccggccccgccttac CRISPR spacer
cgccaccacctgggcatccggcctgctgtcga Protospacer
************ ** *******. . *..
122. spacer 3.3|982230|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MT118301 (Pseudomonas phage Epa33, complete genome) position: , mismatch: 10, identity: 0.688
gcgctcaactggcgcgcaacctgccgtttgcc CRISPR spacer
gcgaacaactggcgcgcaacctgatggcgaag Protospacer
*** ****************** .* . .
123. spacer 3.4|982291|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_019846 (Sinorhizobium meliloti GR4 plasmid pRmeGR4a, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgtgaaaaactgcgttaccgcctgggtgag CRISPR spacer
tcgtcgaaaatctgcgttaccgcatgggttga Protospacer
. .***** ************ ***** ..
124. spacer 3.4|982291|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgtgaaaaactgcgttaccgcctgggtgag CRISPR spacer
tcgtcgaaaatctgcgttaccgcatgggttga Protospacer
. .***** ************ ***** ..
125. spacer 3.4|982291|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP021826 (Sinorhizobium meliloti strain KH35c plasmid accessoryA, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgtgaaaaactgcgttaccgcctgggtgag CRISPR spacer
tcgtcgaaaatctgcgttaccgcatgggttga Protospacer
. .***** ************ ***** ..
126. spacer 3.4|982291|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgtgaaaaactgcgttaccgcctgggtgag CRISPR spacer
tcgtcgaaaatctgcgttaccgcatgggttga Protospacer
. .***** ************ ***** ..
127. spacer 3.8|982535|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MW013502 (Salmonella virus L cI-40 13-am43, complete genome) position: , mismatch: 10, identity: 0.688
ctcaccgggtggcagaactggagaaataccgc CRISPR spacer
ctcgccgggtggcagaactggaggcgcggaag Protospacer
***.*******************. ... .
128. spacer 3.8|982535|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_004348 (Enterobacteria phage ST64T, complete genome) position: , mismatch: 10, identity: 0.688
ctcaccgggtggcagaactggagaaataccgc CRISPR spacer
ctcgccgggtggcagaactggaggcgcggaag Protospacer
***.*******************. ... .
129. spacer 3.8|982535|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MW013503 (Salmonella virus L cII-101, complete genome) position: , mismatch: 10, identity: 0.688
ctcaccgggtggcagaactggagaaataccgc CRISPR spacer
ctcgccgggtggcagaactggaggcgcggaag Protospacer
***.*******************. ... .
130. spacer 3.8|982535|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MG197810 (Klebsiella phage 1611E-K2-1, complete genome) position: , mismatch: 10, identity: 0.688
ctcaccgggtggcagaactggagaaataccgc CRISPR spacer
aggcgcgggtggtagaactggagaaatataaa Protospacer
*******.***************. .
131. spacer 3.8|982535|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_018275 (Salmonella phage vB_SemP_Emek, complete genome) position: , mismatch: 10, identity: 0.688
ctcaccgggtggcagaactggagaaataccgc CRISPR spacer
ctcgccgggtggcagaactggaggcgcggaag Protospacer
***.*******************. ... .
132. spacer 3.8|982535|32|NZ_CP022138|CRISPRCasFinder,CRT matches to AY052766 (Salmonella typhimurium bacteriophage ST64T, complete genome) position: , mismatch: 10, identity: 0.688
ctcaccgggtggcagaactggagaaataccgc CRISPR spacer
ctcgccgggtggcagaactggaggcgcggaag Protospacer
***.*******************. ... .
133. spacer 3.8|982535|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MF188997 (Salmonella phage vB_SalP_PM43, complete genome) position: , mismatch: 10, identity: 0.688
ctcaccgggtggcagaactggagaaataccgc CRISPR spacer
ctcgccgggtggcagaactggaggcgcggaag Protospacer
***.*******************. ... .
134. spacer 3.9|982596|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP019653 (Paenibacillus larvae subsp. larvae DSM 25430 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
agttttatgttgatgctaatcccggcgaattc CRISPR spacer
tgtttcatgttcatgctaatcccgtacaccgg Protospacer
****.***** ************ * .
135. spacer 3.15|982962|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP024609 (Massilia violaceinigra strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gcagttacggcgctggtgctggggcagaacat CRISPR spacer
aggcatccggagatggtgctggggcagaaccg Protospacer
. . * *** * *****************
136. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP023025 (Acinetobacter baumannii strain 10324 plasmid pAba10324c, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
137. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP034093 (Acinetobacter baumannii strain A52 plasmid pA52-1, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
138. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP041590 (Acinetobacter baumannii strain J9 plasmid pJ9-3, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
139. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP038645 (Acinetobacter baumannii strain ACN21 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
140. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP039519 (Acinetobacter baumannii strain TG22653 plasmid pTG22653, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
141. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to CP033517 (Acinetobacter baumannii strain 2008S11-069 plasmid p2008S11-069-1, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
142. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP016301 (Acinetobacter baumannii strain CMC-CR-MDR-Ab66 plasmid pCMCVTAb1-Ab66, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
143. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP016296 (Acinetobacter baumannii strain CMC-CR-MDR-Ab4 plasmid pCMCVTAb1-Ab4, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
144. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP016299 (Acinetobacter baumannii strain CMC-MDR-Ab59 plasmid pCMCVTAb1-Ab59, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
145. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP024125 (Acinetobacter baumannii strain AYP-A2 plasmid pAYP-A2, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
146. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP026128 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
147. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP033864 (Acinetobacter sp. FDAARGOS_560 plasmid unnamed2) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
148. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP010398 (Acinetobacter baumannii strain 6200 plasmid p6200-114.848kb, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
149. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP015484 (Acinetobacter baumannii strain ORAB01 plasmid pORAB01-1, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
150. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP018333 (Acinetobacter baumannii strain A1296 isolate A1296 plasmid pA1296_1, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
151. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP020585 (Acinetobacter baumannii strain CBA7 plasmid pCBA7_1, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
152. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_023031 (Acinetobacter baumannii ZW85-1 plasmid ZW85p2, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
153. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to CP031744 (Acinetobacter baumannii WM99c plasmid pWM99c-2, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
154. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP050905 (Acinetobacter baumannii strain DT-Ab057 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
155. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NC_020524 (Acinetobacter baumannii MDR-TJ plasmid pABTJ2, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
156. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP021327 (Acinetobacter baumannii strain XH386 plasmid pXH386, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
157. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_MK386680 (Acinetobacter baumannii strain ABAY04001 plasmid pABAY04001_1A, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
158. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP018257 (Acinetobacter baumannii strain AF-673 plasmid pAF-673, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
159. spacer 3.17|983084|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP010780 (Acinetobacter baumannii strain XH386 plasmid pAB386, complete sequence) position: , mismatch: 10, identity: 0.688
tattaccctttcagaatcttttttggattgct CRISPR spacer
cttaaccctttcagaagcttgtttggagcttg Protospacer
. * ************ *** ****** . .
160. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KF594187 (Siphovirus contig89 strain Day2AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
161. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KF594193 (Siphovirus contig89 strain Day30Noon, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
162. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KF594192 (Siphovirus contig89 strain Day30AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
163. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KF594185 (Siphovirus contig89 strain Day1Noon, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
164. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KF594191 (Siphovirus contig89 strain Day14AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
165. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KF594186 (Siphovirus contig89 strain Day1PM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
166. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KF594194 (Siphovirus contig89 strain Day60AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
167. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KF594184 (Siphovirus contig89 strain Day1AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
168. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KF594189 (Siphovirus contig89 strain Day7AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
169. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KF594188 (Siphovirus contig89 strain Day4AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
170. spacer 3.23|983450|32|NZ_CP022138|CRISPRCasFinder,CRT matches to KF594190 (Siphovirus contig89 strain Day7Noon, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
171. spacer 3.24|983511|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP022446 (Bacillus cereus C1L plasmid pC1L1, complete sequence) position: , mismatch: 10, identity: 0.688
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
ttttatctttttacaatgatgaatatgaaaaa Protospacer
. * *****************.* ***
172. spacer 3.30|983878|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MG592643 (Vibrio phage 1.275.O._10N.286.54.E11, partial genome) position: , mismatch: 10, identity: 0.688
tcagcgtgatatcgcccgtcagcgccttgttg CRISPR spacer
atgccaatatatcgaccgtcagcgccttcttt Protospacer
.. *. ****** ************* **
173. spacer 3.32|984000|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to NC_027395 (Phage vB_EcoP_SU10, complete genome) position: , mismatch: 10, identity: 0.688
gtgtgccaatccatccatgtgctttgttactt CRISPR spacer
taaggcctatccatccatgtgctgtgtttaag Protospacer
. *** *************** ****
174. spacer 3.32|984000|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to EU330206 (Enterobacteria phage phiEco32, complete genome) position: , mismatch: 10, identity: 0.688
gtgtgccaatccatccatgtgctttgttactt CRISPR spacer
taaggcctatccatccatgtgctgtgtttaag Protospacer
. *** *************** ****
175. spacer 3.32|984000|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to MT446386 (UNVERIFIED: Escherichia virus TH06, complete genome) position: , mismatch: 10, identity: 0.688
gtgtgccaatccatccatgtgctttgttactt CRISPR spacer
taaggcctatccatccatgtgctgtgtttaag Protospacer
. *** *************** ****
176. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
177. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
178. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
179. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
180. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
181. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
182. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
183. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
184. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
185. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
186. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
187. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
188. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
189. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
190. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
191. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
192. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
193. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
194. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
195. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
196. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
197. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
198. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
199. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MG700549 (Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
200. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MG700550 (Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
201. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MG700550 (Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
202. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
203. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
204. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
205. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
206. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
207. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
208. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
209. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
210. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
211. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
212. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
213. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
214. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
215. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
216. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
217. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
218. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
219. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
220. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
221. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
222. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
223. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
224. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
225. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
226. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
227. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
228. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
229. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
230. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
231. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
232. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
233. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
234. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
235. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
236. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
237. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
238. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
239. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
240. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
241. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP052437 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
242. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
243. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP052353 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
244. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
245. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
246. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
247. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
248. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
249. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
250. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037930 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
251. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
252. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015396 (Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
253. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
254. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
255. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
256. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
257. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
258. spacer 2.5|964120|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 11, identity: 0.656
caagagatcagattgatgctgactgtcagcct CRISPR spacer
ttgcggatcagattgaggctgactttcacggc Protospacer
. . .*********** ******* *** .
259. spacer 2.16|964791|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 11, identity: 0.656
cgcgcgatcaggtcgctgaaccggtcaaaatt CRISPR spacer
tcggcgatcaggtcgacgaaccggtcgctgaa Protospacer
. ************ .*********. .
260. spacer 2.19|964974|32|NZ_CP022138|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041436 (Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence) position: , mismatch: 11, identity: 0.656
aacgacaaaacccactggattatttttgtgaa CRISPR spacer
ttatgtttaacccaatggtttatttttgtgat Protospacer
.. ****** *** ************
261. spacer 3.2|982169|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 11, identity: 0.656
cgccaccacctgcgcctccggccccgccttac CRISPR spacer
gatggacaccttcgccgccggccccgcctcct Protospacer
.. . ***** **** ************. .
262. spacer 3.24|983511|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP021670 (Bacillus licheniformis strain SRCM100141 plasmid pBL141-2 sequence) position: , mismatch: 11, identity: 0.656
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
gttaaaagatttagaatgatgaatatgtttct Protospacer
. .*****.**** ************. .
263. spacer 3.24|983511|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP035189 (Bacillus licheniformis strain SRCM103914 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
gttaaaagatttagaatgatgaatatgtttct Protospacer
. .*****.**** ************. .
264. spacer 3.24|983511|32|NZ_CP022138|CRISPRCasFinder,CRT matches to NZ_CP014843 (Bacillus licheniformis strain SCDB 14 plasmid pSCDB14, complete sequence) position: , mismatch: 11, identity: 0.656
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
gttaaaagatttagaatgatgaatatgtttct Protospacer
. .*****.**** ************. .
265. spacer 3.24|983511|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MG592473 (Vibrio phage 1.101.O._10N.261.45.C6, partial genome) position: , mismatch: 11, identity: 0.656
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
cagaaaaggtttacactgaagaatattctggt Protospacer
. ************ *** ****** ...
266. spacer 3.24|983511|32|NZ_CP022138|CRISPRCasFinder,CRT matches to MG592459 (Vibrio phage 1.084.O._10N.261.49.F5, partial genome) position: , mismatch: 11, identity: 0.656
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
cagaaaaggtttacactgaagaatattctggt Protospacer
. ************ *** ****** ...
267. spacer 3.32|984000|32|NZ_CP022138|CRISPRCasFinder,CRT,PILER-CR matches to MT446410 (UNVERIFIED: Escherichia virus TH38, complete genome) position: , mismatch: 11, identity: 0.656
gtgtgccaatccatccatgtgctttgttactt CRISPR spacer
taagacctatccatccatgtgctgtgtttaag Protospacer
. .** *************** ****
268. spacer 3.46|984855|32|NZ_CP022138|CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
aggggcgttccgcagtcggcaagggctgaaaa CRISPR spacer
tcgggcatcccgcagtcggcaagggtgcggcg Protospacer
****.*.****************. .. .
