Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022047 Staphylococcus sciuri strain FDAARGOS_285 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP022046 Staphylococcus sciuri strain FDAARGOS_285 chromosome, complete genome 3 crisprs cas3,DEDDh,DinG,WYL,csa3 1 0 9 0

Results visualization

1. NZ_CP022046
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022046_1 164392-164480 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022046_2 757639-757797 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022046_3 1203465-1203535 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP022046_3 3.1|1203488|25|NZ_CP022046|CRISPRCasFinder 1203488-1203512 25 NZ_CP022046.2 1206014-1206038 2 0.92
NZ_CP022046_3 3.1|1203488|25|NZ_CP022046|CRISPRCasFinder 1203488-1203512 25 NZ_CP022046.2 1206950-1206974 2 0.92

1. spacer 3.1|1203488|25|NZ_CP022046|CRISPRCasFinder matches to position: 1206014-1206038, mismatch: 2, identity: 0.92

tcaatctgatagtggttccgattcg	CRISPR spacer
tcaatctgatagtagttctgattcg	Protospacer
*************.****.******

2. spacer 3.1|1203488|25|NZ_CP022046|CRISPRCasFinder matches to position: 1206950-1206974, mismatch: 2, identity: 0.92

tcaatctgatagtggttccgattcg	CRISPR spacer
tcaatctgatagtagttctgattcg	Protospacer
*************.****.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 816459 : 828130 11 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_2 843719 : 851563 7 Staphylococcus_phage(85.71%) holin NA
DBSCAN-SWA_3 855336 : 862566 6 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_4 991172 : 1002483 8 uncultured_Mediterranean_phage(42.86%) tRNA NA
DBSCAN-SWA_5 1631418 : 1639889 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 1831778 : 1839112 9 Staphylococcus_phage(50.0%) bacteriocin NA
DBSCAN-SWA_7 1898659 : 1905824 7 Staphylococcus_phage(83.33%) NA NA
DBSCAN-SWA_8 1955612 : 1968155 11 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_9 2465752 : 2476605 16 Staphylococcus_phage(45.45%) integrase attL 2470472:2470487|attR 2478691:2478706
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage