Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022083 Burkholderia cepacia strain FDAARGOS_345 chromosome 1, complete sequence 1 crisprs DEDDh,cas3,WYL,DinG,RT 0 1 251 0
NZ_CP022082 Burkholderia cepacia strain FDAARGOS_345 chromosome 3, complete sequence 0 crisprs RT 0 0 0 0
NZ_CP022084 Burkholderia cepacia strain FDAARGOS_345 chromosome 2, complete sequence 1 crisprs csa3,Cas14u_CAS-V,cas3,DinG,WYL 0 1 2 0
NZ_CP022081 Burkholderia cepacia strain FDAARGOS_345 plasmid unnamed1, complete sequence 0 crisprs PD-DExK 0 0 0 0

Results visualization

1. NZ_CP022083
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022083_1 2020221-2020293 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022083_1 1.1|2020245|25|NZ_CP022083|CRISPRCasFinder 2020245-2020269 25 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1258766-1258790 3 0.88
NZ_CP022083_1 1.1|2020245|25|NZ_CP022083|CRISPRCasFinder 2020245-2020269 25 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1263435-1263459 3 0.88

1. spacer 1.1|2020245|25|NZ_CP022083|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.88

gcttagggcggtcccatgcaaggcg	CRISPR spacer
gcttagtccggtcccatgcaaggct	Protospacer
******  **************** 

2. spacer 1.1|2020245|25|NZ_CP022083|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.88

gcttagggcggtcccatgcaaggcg	CRISPR spacer
gcttagtccggtcccatgcaaggct	Protospacer
******  **************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5616 5 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_2 14094 : 20093 2 Virus_Rctr197k(50.0%) NA NA
DBSCAN-SWA_3 30841 : 31615 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_4 48492 : 49977 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_5 64304 : 68105 5 Burkholderia_phage(66.67%) NA NA
DBSCAN-SWA_6 88385 : 90218 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_7 114767 : 126265 12 Micromonas_pusilla_virus(16.67%) protease NA
DBSCAN-SWA_8 144678 : 149174 4 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_9 162484 : 169934 8 Escherichia_phage(33.33%) protease NA
DBSCAN-SWA_10 187335 : 199020 12 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_11 205144 : 209669 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_12 224460 : 225756 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_13 232765 : 233770 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_14 241384 : 242398 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_15 250997 : 252482 2 Croceibacter_phage(50.0%) NA NA
DBSCAN-SWA_16 256111 : 259487 3 Bordetella_phage(50.0%) NA NA
DBSCAN-SWA_17 275610 : 286149 9 Bacillus_virus(40.0%) tRNA NA
DBSCAN-SWA_18 289864 : 301497 10 Staphylococcus_phage(40.0%) NA NA
DBSCAN-SWA_19 310228 : 311672 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_20 328964 : 329621 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_21 334648 : 336203 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_22 351533 : 352928 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_23 356472 : 357495 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_24 365137 : 366565 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_25 373658 : 379428 6 Enterobacteria_phage(60.0%) NA NA
DBSCAN-SWA_26 382881 : 383913 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_27 388588 : 390569 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_28 412948 : 413998 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_29 438000 : 442629 3 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_30 446707 : 451641 4 Bordetella_phage(50.0%) NA NA
DBSCAN-SWA_31 471401 : 472649 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_32 489093 : 491810 3 Moumouvirus(50.0%) NA NA
DBSCAN-SWA_33 513088 : 516479 4 Enterobacteria_phage(75.0%) NA NA
DBSCAN-SWA_34 535872 : 554000 17 Wolbachia_phage(11.11%) tRNA NA
DBSCAN-SWA_35 571167 : 575773 4 Klebsiella_phage(50.0%) NA NA
DBSCAN-SWA_36 587518 : 588478 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_37 592369 : 600281 6 uncultured_Mediterranean_phage(75.0%) tRNA NA
DBSCAN-SWA_38 626850 : 631038 4 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_39 637136 : 637508 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_40 649559 : 650285 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_41 655658 : 657047 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_42 665814 : 671522 4 Streptococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_43 679413 : 683948 4 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_44 691911 : 692328 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_45 701243 : 701744 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_46 706972 : 710439 3 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_47 731522 : 736093 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_48 739910 : 740462 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_49 744504 : 745623 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_50 755797 : 756256 1 Rhizoctonia_fumigata_mycovirus(100.0%) NA NA
DBSCAN-SWA_51 763297 : 763804 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_52 784015 : 787901 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_53 804530 : 810041 6 Acinetobacter_phage(60.0%) NA NA
DBSCAN-SWA_54 821567 : 887504 63 Acinetobacter_phage(22.22%) tRNA,transposase,plate,protease NA
DBSCAN-SWA_55 892046 : 894245 2 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_56 906316 : 907243 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_57 910785 : 911607 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_58 923544 : 924755 1 Pseudomonas_phage(100.0%) transposase NA
DBSCAN-SWA_59 935180 : 937059 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_60 976267 : 991515 7 Klosneuvirus(20.0%) NA NA
DBSCAN-SWA_61 995513 : 996704 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_62 1021860 : 1022547 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_63 1036359 : 1037058 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_64 1048773 : 1051343 3 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_65 1062861 : 1064280 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_66 1076209 : 1081500 5 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_67 1104107 : 1105250 1 Ostreococcus_mediterraneus_virus(100.0%) NA NA
DBSCAN-SWA_68 1110982 : 1111312 1 Burkholderia_phage(100.0%) NA NA
DBSCAN-SWA_69 1116903 : 1118991 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_70 1123945 : 1126873 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_71 1148904 : 1151454 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_72 1158832 : 1160344 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_73 1174194 : 1175922 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_74 1185432 : 1187137 2 Bifidobacterium_phage(50.0%) NA NA
DBSCAN-SWA_75 1190427 : 1192967 2 Pithovirus(50.0%) NA NA
DBSCAN-SWA_76 1200531 : 1203444 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_77 1219436 : 1221756 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_78 1247406 : 1248204 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_79 1253008 : 1258053 2 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_80 1280156 : 1281722 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_81 1294447 : 1300639 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_82 1307232 : 1319128 10 uncultured_virus(20.0%) transposase NA
DBSCAN-SWA_83 1325062 : 1326421 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_84 1330258 : 1331350 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_85 1346925 : 1347684 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_86 1359840 : 1365242 5 Pseudomonas_phage(33.33%) integrase attL 1350076:1350091|attR 1368677:1368692
DBSCAN-SWA_87 1368488 : 1371221 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_88 1379572 : 1388475 7 Paramecium_bursaria_Chlorella_virus(20.0%) tRNA NA
DBSCAN-SWA_89 1395987 : 1397901 3 Vibrio_phage(66.67%) NA NA
DBSCAN-SWA_90 1410882 : 1412837 2 Phaeocystis_globosa_virus(50.0%) NA NA
DBSCAN-SWA_91 1427329 : 1428673 1 Erwinia_phage(100.0%) protease NA
DBSCAN-SWA_92 1432947 : 1438425 6 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_93 1447595 : 1449236 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_94 1473557 : 1474865 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_95 1478857 : 1480869 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_96 1490384 : 1491626 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_97 1505307 : 1506291 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_98 1511235 : 1512543 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_99 1527026 : 1529178 2 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_100 1540558 : 1544939 3 Paramecium_bursaria_Chlorella_virus(33.33%) tRNA NA
DBSCAN-SWA_101 1565573 : 1566506 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_102 1600934 : 1602239 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_103 1605927 : 1606605 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_104 1610759 : 1612400 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_105 1622281 : 1623349 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_106 1632070 : 1632556 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_107 1640327 : 1641242 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_108 1645804 : 1649368 4 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_109 1653556 : 1657248 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_110 1666761 : 1668840 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_111 1688931 : 1690704 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_112 1694777 : 1697275 4 Rhizobium_phage(50.0%) NA NA
DBSCAN-SWA_113 1702146 : 1703754 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_114 1711042 : 1712680 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_115 1719726 : 1722945 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_116 1732384 : 1740488 4 Organic_Lake_phycodnavirus(33.33%) NA NA
DBSCAN-SWA_117 1744649 : 1746513 2 Salicola_phage(50.0%) NA NA
DBSCAN-SWA_118 1753105 : 1757648 6 uncultured_Mediterranean_phage(66.67%) tRNA NA
DBSCAN-SWA_119 1764003 : 1764912 1 Corynebacterium_phage(100.0%) NA NA
DBSCAN-SWA_120 1768990 : 1784276 14 Brazilian_cedratvirus(14.29%) NA NA
DBSCAN-SWA_121 1801705 : 1802422 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_122 1824852 : 1825677 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_123 1835413 : 1840660 5 Tetraselmis_virus(33.33%) tRNA NA
DBSCAN-SWA_124 1851973 : 1853845 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_125 1869543 : 1871208 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_126 1876008 : 1877055 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_127 1882284 : 1884836 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_128 1889171 : 1889951 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_129 1893536 : 1894979 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_130 1898716 : 1899865 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_131 1915865 : 1917854 2 Feldmannia_irregularis_virus(50.0%) NA NA
DBSCAN-SWA_132 1921824 : 1922529 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_133 1940506 : 1944277 4 Mollivirus(50.0%) NA NA
DBSCAN-SWA_134 1949308 : 1952251 2 Bacillus_phage(50.0%) protease NA
DBSCAN-SWA_135 1963407 : 1970748 6 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_136 1979309 : 1983381 4 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_137 1987587 : 1989012 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_138 1998746 : 2011232 12 Orpheovirus(16.67%) tRNA NA
DBSCAN-SWA_139 2014580 : 2015510 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_140 2023939 : 2026114 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_141 2040493 : 2046128 5 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_142 2051437 : 2064243 11 Lake_Baikal_phage(14.29%) tRNA,protease NA
DBSCAN-SWA_143 2078831 : 2082991 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_144 2101428 : 2102004 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_145 2106434 : 2113647 9 Agrobacterium_phage(33.33%) integrase attL 2094543:2094558|attR 2113752:2113767
DBSCAN-SWA_146 2120448 : 2121765 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_147 2125484 : 2126996 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_148 2146018 : 2146687 1 Vibrio_virus(100.0%) NA NA
DBSCAN-SWA_149 2155705 : 2157859 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_150 2161105 : 2161675 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_151 2164945 : 2165629 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_152 2177911 : 2178325 1 Thermus_virus(100.0%) NA NA
DBSCAN-SWA_153 2182503 : 2183951 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_154 2188818 : 2190528 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_155 2194363 : 2195143 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_156 2199499 : 2200225 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_157 2204123 : 2205461 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_158 2216954 : 2217548 1 Ochrobactrum_phage(100.0%) NA NA
DBSCAN-SWA_159 2225363 : 2231965 3 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_160 2235621 : 2237961 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_161 2244413 : 2250218 5 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_162 2256969 : 2257923 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_163 2280197 : 2287575 4 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) tRNA NA
DBSCAN-SWA_164 2293846 : 2295628 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_165 2317296 : 2319381 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_166 2329299 : 2329914 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_167 2333014 : 2346994 15 Orpheovirus(20.0%) NA NA
DBSCAN-SWA_168 2372540 : 2373131 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_169 2414151 : 2418078 3 Caulobacter_phage(50.0%) NA NA
DBSCAN-SWA_170 2424779 : 2427346 3 Caulobacter_phage(66.67%) NA NA
DBSCAN-SWA_171 2435427 : 2437341 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_172 2443929 : 2445408 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_173 2451405 : 2452929 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_174 2471505 : 2475714 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_175 2490335 : 2493507 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_176 2501872 : 2503633 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_177 2512426 : 2610584 102 uncultured_Caudovirales_phage(21.28%) portal,integrase,tRNA,holin,protease,head,transposase,capsid,plate,tail,terminase attL 2551879:2551901|attR 2595679:2595701
DBSCAN-SWA_178 2626919 : 2630416 3 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_179 2641592 : 2643134 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_180 2652658 : 2655206 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_181 2667719 : 2670325 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_182 2679479 : 2680262 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_183 2690328 : 2697729 7 Emiliania_huxleyi_virus(33.33%) NA NA
DBSCAN-SWA_184 2703716 : 2707531 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_185 2714815 : 2718175 5 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_186 2725664 : 2726261 1 Pandoravirus(100.0%) tRNA NA
DBSCAN-SWA_187 2736539 : 2737460 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_188 2761331 : 2762057 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_189 2767627 : 2768737 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_190 2777287 : 2783997 4 Agrobacterium_phage(25.0%) protease NA
DBSCAN-SWA_191 2787279 : 2787993 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_192 2793045 : 2809292 12 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_193 2813436 : 2814396 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_194 2817936 : 2818557 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_195 2823039 : 2824215 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_196 2831584 : 2833360 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_197 2837987 : 2844436 5 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_198 2848244 : 2849282 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_199 2861389 : 2863987 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_200 2872911 : 2874027 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_201 2883274 : 2897499 14 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_202 2901321 : 2944194 37 Powai_lake_megavirus(20.0%) tRNA,transposase,plate,protease NA
DBSCAN-SWA_203 2947770 : 2948869 1 Leptospira_phage(100.0%) transposase NA
DBSCAN-SWA_204 2960367 : 2961069 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_205 2964242 : 2966840 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_206 2981661 : 2983745 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_207 3007858 : 3010293 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_208 3018453 : 3019452 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_209 3033289 : 3047079 7 Planktothrix_phage(25.0%) protease NA
DBSCAN-SWA_210 3057172 : 3057844 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_211 3065340 : 3066453 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_212 3073798 : 3075118 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_213 3088258 : 3089407 1 Archaeal_BJ1_virus(100.0%) NA NA
DBSCAN-SWA_214 3099856 : 3100822 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_215 3104149 : 3105229 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_216 3138437 : 3139793 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_217 3169991 : 3186706 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_218 3190804 : 3191653 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_219 3203060 : 3209818 4 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_220 3214668 : 3233805 14 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_221 3237063 : 3238122 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_222 3241397 : 3245009 5 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_223 3251234 : 3257961 8 Burkholderia_virus(33.33%) NA NA
DBSCAN-SWA_224 3264566 : 3265085 1 Pectobacterium_phage(100.0%) NA NA
DBSCAN-SWA_225 3268812 : 3269517 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_226 3273262 : 3364459 130 Burkholderia_phage(34.25%) portal,integrase,tRNA,head,capsid,plate,tail,terminase attL 3266277:3266325|attR 3311302:3311350
DBSCAN-SWA_227 3377767 : 3382120 3 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_228 3388425 : 3389979 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_229 3398904 : 3400659 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_230 3424626 : 3426057 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_231 3439358 : 3442286 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_232 3446597 : 3447629 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_233 3461104 : 3468510 7 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_234 3480304 : 3481405 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_235 3497054 : 3507665 6 uncultured_Caudovirales_phage(25.0%) tRNA NA
DBSCAN-SWA_236 3524498 : 3526082 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_237 3534695 : 3536149 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_238 3541948 : 3550149 7 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_239 3580007 : 3581204 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_240 3593921 : 3596846 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_241 3627803 : 3630599 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_242 3634397 : 3641492 6 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_243 3660154 : 3665652 3 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_244 3669682 : 3675131 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_245 3687990 : 3689610 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_246 3700132 : 3711544 10 Bacillus_phage(50.0%) protease NA
DBSCAN-SWA_247 3718242 : 3728092 9 Halovirus(16.67%) NA NA
DBSCAN-SWA_248 3743585 : 3744341 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_249 3756500 : 3760186 3 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_250 3764354 : 3765032 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_251 3768965 : 3770357 1 Erysipelothrix_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP022084
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022084_1 3037348-3037667 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022084_1 1.3|3037524|31|NZ_CP022084|CRISPRCasFinder 3037524-3037554 31 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1073398-1073428 8 0.742
NZ_CP022084_1 1.3|3037524|31|NZ_CP022084|CRISPRCasFinder 3037524-3037554 31 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 871327-871357 8 0.742
NZ_CP022084_1 1.3|3037524|31|NZ_CP022084|CRISPRCasFinder 3037524-3037554 31 NZ_CP022193 Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence 36974-37004 9 0.71
NZ_CP022084_1 1.3|3037524|31|NZ_CP022084|CRISPRCasFinder 3037524-3037554 31 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 433713-433743 9 0.71
NZ_CP022084_1 1.3|3037524|31|NZ_CP022084|CRISPRCasFinder 3037524-3037554 31 NZ_CP014311 Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence 174204-174234 10 0.677

1. spacer 1.3|3037524|31|NZ_CP022084|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.742

gggtggcgcggtgacgtcgaaccgtcgcgag	CRISPR spacer
accgtacgcggcgccgtcgaaccgtcgcgag	Protospacer
.    .*****.* *****************

2. spacer 1.3|3037524|31|NZ_CP022084|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

gggtggcgcggtgacgtcgaaccgtcgcgag	CRISPR spacer
gaagagcgcggtgacgtcgaacggccgcggt	Protospacer
*.. .***************** *.****. 

3. spacer 1.3|3037524|31|NZ_CP022084|CRISPRCasFinder matches to NZ_CP022193 (Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

gggtggcgcggtgacgtcgaaccgtcgcgag	CRISPR spacer
ccaaggcgcggagacgtcgaaccggcgctcc	Protospacer
  . ******* ************ ***   

4. spacer 1.3|3037524|31|NZ_CP022084|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gggtggcgcggtgacgtcgaaccgtcgcgag	CRISPR spacer
aaaggtgacggcgacgacgaaccgtcgcgag	Protospacer
... *  .***.**** **************

5. spacer 1.3|3037524|31|NZ_CP022084|CRISPRCasFinder matches to NZ_CP014311 (Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.677

gggtggcgcggtgacgtcgaaccgtcgcgag	CRISPR spacer
attctcggcggtgacgtcgaccggtcgcgac	Protospacer
.  .   ************* * ******* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 361794 : 370776 8 Burkholderia_virus(33.33%) transposase NA
DBSCAN-SWA_2 1369340 : 1376141 12 Burkholderia_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage