Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017993 Enterobacter cloacae complex sp. ECNIH7 plasmid pKPC-98f, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP017991 Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence 0 crisprs WYL,TnsE_C 0 0 2 0
NZ_CP017990 Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome 4 crisprs WYL,DEDDh,csa3,DinG,cas3,RT 1 2 13 1
NZ_CP017992 Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-2c5, complete sequence 0 crisprs NA 0 0 2 0

Results visualization

1. NZ_CP017990
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017990_1 324252-324388 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017990_2 1093508-1093620 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017990_3 1198641-1198778 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017990_4 1792766-1792863 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP017990_4 4.1|1792798|34|NZ_CP017990|CRISPRCasFinder 1792798-1792831 34 NZ_CP017990.1 1395296-1395329 2 0.941
NZ_CP017990_4 4.1|1792798|34|NZ_CP017990|CRISPRCasFinder 1792798-1792831 34 NZ_CP017990.1 1395362-1395395 2 0.941
NZ_CP017990_4 4.1|1792798|34|NZ_CP017990|CRISPRCasFinder 1792798-1792831 34 NZ_CP017990.1 1395428-1395461 2 0.941

1. spacer 4.1|1792798|34|NZ_CP017990|CRISPRCasFinder matches to position: 1395296-1395329, mismatch: 2, identity: 0.941

aatcgttcactacctggtgcagcagattcacccc	CRISPR spacer
aatagttcactacctggtgcaggagattcacccc	Protospacer
*** ****************** ***********

2. spacer 4.1|1792798|34|NZ_CP017990|CRISPRCasFinder matches to position: 1395362-1395395, mismatch: 2, identity: 0.941

aatcgttcactacctggtgcagcagattcacccc	CRISPR spacer
aatagttcactacctggtgcaggagattcacccc	Protospacer
*** ****************** ***********

3. spacer 4.1|1792798|34|NZ_CP017990|CRISPRCasFinder matches to position: 1395428-1395461, mismatch: 2, identity: 0.941

aatcgttcactacctggtgcagcagattcacccc	CRISPR spacer
aatagttcactacctggtgcaggagattcacccc	Protospacer
*** ****************** ***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017990_4 4.1|1792798|34|NZ_CP017990|CRISPRCasFinder 1792798-1792831 34 MH178096 Aeromonas phage AsXd-1, complete genome 10853-10886 0 1.0
NZ_CP017990_1 1.1|324296|49|NZ_CP017990|CRISPRCasFinder 324296-324344 49 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 167171-167219 9 0.816

1. spacer 4.1|1792798|34|NZ_CP017990|CRISPRCasFinder matches to MH178096 (Aeromonas phage AsXd-1, complete genome) position: , mismatch: 0, identity: 1.0

aatcgttcactacctggtgcagcagattcacccc	CRISPR spacer
aatcgttcactacctggtgcagcagattcacccc	Protospacer
**********************************

2. spacer 1.1|324296|49|NZ_CP017990|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 9, identity: 0.816

tctccctctcccgtgggagagggtcggggtgagggcaccagaccgcacg	CRISPR spacer
caccctctccccgtgggagagggtcggggtgagggcatcagaccgcacc	Protospacer
. .**....****************************.********** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1203867 : 1257349 65 Enterobacteria_phage(46.15%) protease,tail,integrase,head,terminase,plate,tRNA,capsid,portal attL 1207971:1207990|attR 1239889:1239908
DBSCAN-SWA_2 1319849 : 1405412 89 Enterobacteria_phage(30.77%) tail,holin,head,terminase,portal,capsid,protease NA
DBSCAN-SWA_3 1532599 : 1545571 9 uncultured_virus(16.67%) capsid,terminase,transposase,portal NA
DBSCAN-SWA_4 1768630 : 1857652 94 Enterobacteria_phage(27.45%) protease,holin,tail,head,terminase,tRNA,capsid,portal NA
DBSCAN-SWA_5 2297203 : 2307277 9 Oenococcus_phage(16.67%) NA NA
DBSCAN-SWA_6 3087835 : 3118814 45 Vibrio_phage(63.89%) transposase,tail,integrase,head,plate attL 3083460:3083474|attR 3094795:3094809
DBSCAN-SWA_7 3207048 : 3214627 7 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_8 3312952 : 3420055 113 Salmonella_phage(15.69%) protease,transposase,tail,lysis,holin,head,integrase,terminase,plate,tRNA,capsid,portal attL 3398519:3398537|attR 3420647:3420665
DBSCAN-SWA_9 3733156 : 3852185 139 Salmonella_phage(54.44%) tail,lysis,integrase,head,terminase,plate,tRNA,capsid,portal attL 3823149:3823164|attR 3853470:3853485
DBSCAN-SWA_10 4162055 : 4225588 59 uncultured_virus(22.22%) integrase,tRNA,transposase attL 4206632:4206691|attR 4224307:4225623
DBSCAN-SWA_11 4302550 : 4389007 72 Escherichia_phage(11.54%) integrase,transposase attL 4312973:4312985|attR 4396265:4396280
DBSCAN-SWA_12 4439603 : 4535562 102 Erwinia_phage(33.33%) transposase,tail,lysis,integrase,holin,plate,tRNA attL 4445349:4445369|attR 4519396:4519416
DBSCAN-SWA_13 4995536 : 5084494 92 Salmonella_phage(75.0%) tail,holin,integrase,head,terminase,plate,portal,tRNA,capsid,protease attL 5047366:5047407|attR 5080162:5080203
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP017990.1|WP_000952328.1|1397636_1397840_+|hypothetical-protein 1397636_1397840_+ 67 aa aa NA NA NA 1319849-1405412 yes
2. NZ_CP017991
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 24663 : 76976 48 uncultured_Caudovirales_phage(21.43%) transposase,integrase attL 44595:44609|attR 79092:79106
DBSCAN-SWA_2 132032 : 139839 6 Macacine_betaherpesvirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP017992
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3008 : 12734 10 uncultured_Caudovirales_phage(33.33%) transposase NA
DBSCAN-SWA_2 49243 : 59848 16 Emiliania_huxleyi_virus(12.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage