Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021845 Escherichia coli strain EC1515 plasmid pEC1515-1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP021846 Escherichia coli strain EC1515 plasmid pEC1515-2, complete sequence 0 crisprs RT,csa3 0 0 2 0
NZ_CP021847 Escherichia coli strain EC1515 plasmid pEC1515-3, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP021844 Escherichia coli strain EC1515 chromosome, complete genome 12 crisprs csa3,PD-DExK,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,c2c9_V-U4,DinG,WYL 0 10 6 0

Results visualization

1. NZ_CP021845
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29563 : 80752 58 Escherichia_phage(25.0%) integrase,transposase attL 38696:38712|attR 78573:78589
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP021846
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 78041 53 Escherichia_phage(52.63%) transposase,integrase attL 16193:16252|attR 41450:43238
DBSCAN-SWA_2 82168 : 91516 12 Escherichia_phage(75.0%) integrase attL 88802:88815|attR 90363:90376
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP021847
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7822 : 18566 12 Enterobacteria_phage(33.33%) integrase,transposase attL 11335:11394|attR 14935:15591
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP021844
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_1 893991-894110 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_2 1111393-1111665 Unclear I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_3 1137357-1137812 TypeI-E I-E
7 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_4 1741075-1741192 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_5 1972830-1972964 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_6 2411600-2411723 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_7 3095697-3095788 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_8 3235742-3235890 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_9 4038300-4038406 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_10 4055962-4056074 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_11 4268965-4269099 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021844_12 4497615-4497764 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021844_7 7.1|3095723|40|NZ_CP021844|CRISPRCasFinder 3095723-3095762 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
NZ_CP021844_6 6.1|2411643|38|NZ_CP021844|CRISPRCasFinder 2411643-2411680 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 101196-101230 2 0.943
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165464-165498 3 0.914
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 158418-158444 4 0.852
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386534-386560 4 0.852
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397084-397110 4 0.852
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 19-45 4 0.852
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 18-44 4 0.852
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18382-18408 4 0.852
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 18-44 4 0.852
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 18-44 4 0.852
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 6720-6746 5 0.815
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7468-7494 5 0.815
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 83566-83592 5 0.815
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84292-84318 5 0.815
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14239-14273 5 0.857
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56080-56114 5 0.857
NZ_CP021844_10 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder 4056005-4056031 27 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 283162-283188 6 0.778
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 6804-6838 6 0.829
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208981-209015 6 0.829
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219475-219509 6 0.829
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210309-210343 6 0.829
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191264-191298 6 0.829
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30177-30211 6 0.829
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 170-204 6 0.829
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 88-122 6 0.829
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87137-87171 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 138033-138067 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 43-77 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3372-3406 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208887-208921 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 42-76 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3371-3405 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219381-219415 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 42-76 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3371-3405 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210215-210249 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 42-76 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3371-3405 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191170-191204 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27246-27280 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18350-18384 7 0.8
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15018-15052 7 0.8
NZ_CP021844_3 3.3|1137508|32|NZ_CP021844|PILER-CR,CRISPRCasFinder,CRT 1137508-1137539 32 MH617380 Microviridae sp. isolate ctcc639, complete genome 3153-3184 8 0.75
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 61916-61950 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4114-4148 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229148-229182 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229249-229283 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229350-229384 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229451-229485 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 203852-203886 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 204038-204072 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 204131-204165 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4113-4147 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239642-239676 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239743-239777 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239844-239878 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239945-239979 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214346-214380 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214532-214566 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214625-214659 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4113-4147 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230554-230588 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230655-230689 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230756-230790 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230857-230891 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205180-205214 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205366-205400 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205459-205493 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4113-4147 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211524-211558 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211625-211659 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211726-211760 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211827-211861 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186135-186169 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186321-186355 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186414-186448 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 14272-14306 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 6744-6778 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7392-7426 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 83590-83624 8 0.771
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84216-84250 8 0.771
NZ_CP021844_2 2.1|1111422|32|NZ_CP021844|PILER-CR,CRISPRCasFinder,CRT 1111422-1111453 32 NZ_CP020744 Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence 111330-111361 9 0.719
NZ_CP021844_8 8.1|3235770|32|NZ_CP021844|CRISPRCasFinder 3235770-3235801 32 NZ_CP045060 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence 9736-9767 9 0.719
NZ_CP021844_8 8.1|3235770|32|NZ_CP021844|CRISPRCasFinder 3235770-3235801 32 NZ_CP045053 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence 9737-9768 9 0.719
NZ_CP021844_8 8.1|3235770|32|NZ_CP021844|CRISPRCasFinder 3235770-3235801 32 NZ_CP045057 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence 9736-9767 9 0.719
NZ_CP021844_8 8.2|3235830|33|NZ_CP021844|CRISPRCasFinder 3235830-3235862 33 MN855903 Myoviridae sp. isolate 490, partial genome 4171-4203 9 0.727
NZ_CP021844_8 8.3|3235778|32|NZ_CP021844|PILER-CR 3235778-3235809 32 NZ_CP045060 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence 9736-9767 9 0.719
NZ_CP021844_8 8.3|3235778|32|NZ_CP021844|PILER-CR 3235778-3235809 32 NZ_CP045053 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence 9737-9768 9 0.719
NZ_CP021844_8 8.3|3235778|32|NZ_CP021844|PILER-CR 3235778-3235809 32 NZ_CP045057 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence 9736-9767 9 0.719
NZ_CP021844_8 8.4|3235838|33|NZ_CP021844|PILER-CR 3235838-3235870 33 MN855903 Myoviridae sp. isolate 490, partial genome 4171-4203 9 0.727
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386558-386592 9 0.743
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4013-4047 9 0.743
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4012-4046 9 0.743
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4012-4046 9 0.743
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4012-4046 9 0.743
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 13988-14022 9 0.743
NZ_CP021844_11 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder 4269015-4269049 35 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 41415-41449 9 0.743
NZ_CP021844_2 2.1|1111422|32|NZ_CP021844|PILER-CR,CRISPRCasFinder,CRT 1111422-1111453 32 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 809959-809990 10 0.688

1. spacer 7.1|3095723|40|NZ_CP021844|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

gcgctgcggatcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
*********.******************************

2. spacer 6.1|2411643|38|NZ_CP021844|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.943

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ttcagcgcctgatgcgacgctggcgcgtcttatca	Protospacer
**********************.*********** 

4. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 3, identity: 0.914

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgtaacgcctgatgcgacgctgacgcgtcttatct	Protospacer
* .*.******************************

5. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 4, identity: 0.852

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
ggcgcacaattgccggatgcggcgtga	Protospacer
 **********************...*

6. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 4, identity: 0.852

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
agcgcacaagtgccggatgcggcgtaa	Protospacer
 ******** *************..**

7. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 4, identity: 0.852

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
ggtgcacaattgccggatgcggcgtaa	Protospacer
 *.********************..**

8. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 4, identity: 0.852

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
agcgcacaaatgccggatgcggcgtaa	Protospacer
 ******** *************..**

9. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 4, identity: 0.852

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
agcgcacaaatgccggatgcggcgtaa	Protospacer
 ******** *************..**

10. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 4, identity: 0.852

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
agcgcacaaatgccggatgcggcgtaa	Protospacer
 ******** *************..**

11. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 4, identity: 0.852

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
agcgcacaaatgccggatgcggcgtaa	Protospacer
 ******** *************..**

12. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 4, identity: 0.852

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
agcgcacaaatgccggatgcggcgtaa	Protospacer
 ******** *************..**

13. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 5, identity: 0.815

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
tgcgcacaactgccggatgcggcgtga	Protospacer
.********.*************...*

14. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 5, identity: 0.815

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
ggtgcacaattgccggatgcggcgtga	Protospacer
 *.********************...*

15. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 5, identity: 0.815

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
tgcgcacaactgccggatgcggcgtga	Protospacer
.********.*************...*

16. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 5, identity: 0.815

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
ggtgcacaattgccggatgcggcgtga	Protospacer
 *.********************...*

17. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 5, identity: 0.857

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accagcgcctgatgcgccgctgtcgcgtcttatca	Protospacer
 .************** ***** *********** 

18. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 5, identity: 0.857

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ctcaacgcctgatgcgacgctggcgcgtcttagcg	Protospacer
.***.*****************.********* * 

19. spacer 10.1|4056005|27|NZ_CP021844|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 6, identity: 0.778

cgcgcacaattgccggatgcggcacaa	CRISPR spacer
gatgcataattgccggatgccgcacat	Protospacer
 ..***.************* ***** 

20. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gtttatgccagatgcgacgctgacgcgtcttatct	Protospacer
 *. ..*** *************************

21. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

22. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

23. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

24. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

25. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*.....**************************** 

26. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
attgaagcctgatgcgacgctgacgcgtcttatca	Protospacer
 *... **************************** 

27. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .*...**************************** 

28. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
cacgatgcctgatgcgacgctgccgcgtcttatca	Protospacer
. *...**************** *********** 

29. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgcgctgcctgatgcgacgctaatgcgtcttatca	Protospacer
* *. .***************.*.********** 

30. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

31. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

32. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

33. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

34. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

35. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

36. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

37. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

38. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

39. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

40. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

41. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

42. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accggtgccagatgcgacgcagacgcgtcttatca	Protospacer
 .*.*.*** ********** ************* 

43. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

44. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. .*.****************.*********** 

45. spacer 3.3|1137508|32|NZ_CP021844|PILER-CR,CRISPRCasFinder,CRT matches to MH617380 (Microviridae sp. isolate ctcc639, complete genome) position: , mismatch: 8, identity: 0.75

attacgacttccgcacgcacccaccgtttgta	CRISPR spacer
attacgacatccgcacgcccccacgtggtaca	Protospacer
******** ********* *****    *..*

46. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgccagatgcgacgctggcgcgtcttatct	Protospacer
 . ...*** ************.************

47. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

48. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

49. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

50. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

51. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

52. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

53. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

54. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

55. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

56. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

57. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

58. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

59. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

60. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

61. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

62. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

63. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

64. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

65. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

66. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

67. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

68. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

69. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

70. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

71. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

72. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

73. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

74. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

75. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

76. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

77. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

78. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

79. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgaattacctgatgcgacgctggcgcatcttatca	Protospacer
*  * ..***************.***.******* 

80. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatacgacgctgacgcgtcttatca	Protospacer
 . ...*******.******************** 

81. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. ...****************.*********** 

82. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatacgacgctgacgcgtcttatca	Protospacer
 . ...*******.******************** 

83. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. ...****************.*********** 

84. spacer 2.1|1111422|32|NZ_CP021844|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020744 (Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gccctataatgagaaataaactaattcctatt	CRISPR spacer
ctactataatgaaaaagaaactaattagtctc	Protospacer
 . *********.*** *********  * *.

85. spacer 8.1|3235770|32|NZ_CP021844|CRISPRCasFinder matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

86. spacer 8.1|3235770|32|NZ_CP021844|CRISPRCasFinder matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

87. spacer 8.1|3235770|32|NZ_CP021844|CRISPRCasFinder matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

88. spacer 8.2|3235830|33|NZ_CP021844|CRISPRCasFinder matches to MN855903 (Myoviridae sp. isolate 490, partial genome) position: , mismatch: 9, identity: 0.727

gttcgctgcaaccgctagccaagacggtaggtt	CRISPR spacer
gttcgctgcaaccgttcgccaagaccacaaagg	Protospacer
**************.* ******** ..*..  

89. spacer 8.3|3235778|32|NZ_CP021844|PILER-CR matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

90. spacer 8.3|3235778|32|NZ_CP021844|PILER-CR matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

91. spacer 8.3|3235778|32|NZ_CP021844|PILER-CR matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

92. spacer 8.4|3235838|33|NZ_CP021844|PILER-CR matches to MN855903 (Myoviridae sp. isolate 490, partial genome) position: , mismatch: 9, identity: 0.727

gttcgctgcaaccgctagccaagacggtaggtt	CRISPR spacer
gttcgctgcaaccgttcgccaagaccacaaagg	Protospacer
**************.* ******** ..*..  

93. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgatgctaacgcgtcttatca	Protospacer
 .....***********.***.************ 

94. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

95. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

96. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

97. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

98. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
acggatgcccgatgcgacgctggcgcgtcttatcg	Protospacer
 . ...***.************.*********** 

99. spacer 11.1|4269015|35|NZ_CP021844|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgtctgatgcgacgctggcgcgtcttatca	Protospacer
 .....*.**************.*********** 

100. spacer 2.1|1111422|32|NZ_CP021844|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 10, identity: 0.688

gccctataatgagaaataaactaattcctatt	CRISPR spacer
ctaaaaaaatgtaaaataaactaattcctaaa	Protospacer
 .   * **** .*****************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1257786 : 1336728 90 Shigella_phage(42.31%) head,capsid,tail,tRNA,holin,plate,terminase,portal,integrase,protease attL 1248891:1248905|attR 1297199:1297213
DBSCAN-SWA_2 1574456 : 1655658 99 Enterobacteria_phage(47.69%) head,capsid,tRNA,holin,transposase,lysis,terminase,portal,integrase,protease attL 1573916:1573931|attR 1624022:1624037
DBSCAN-SWA_3 1875184 : 1884629 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 1975532 : 1983055 7 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_5 3366054 : 3410767 60 Enterobacteria_phage(57.89%) head,capsid,tail,transposase,lysis,terminase,portal,integrase,protease attL 3376095:3376110|attR 3419644:3419659
DBSCAN-SWA_6 3958303 : 3988321 25 Pseudomonas_phage(14.29%) integrase,transposase attL 3979291:3979305|attR 3990162:3990176
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage