Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021778 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP021779 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP021776 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 chromosome, complete genome 4 crisprs csa3,cas3,DEDDh,DinG,RT,WYL 0 2 9 0
NZ_CP021777 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_2, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP021778
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 43434 55 Escherichia_phage(20.0%) transposase,integrase attL 26515:26574|attR 34982:35638
DBSCAN-SWA_2 46663 : 47221 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_3 53296 : 57867 4 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_4 66263 : 71758 3 Bacillus_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP021776
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021776_1 556731-556854 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021776_2 2105812-2105909 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021776_3 3784765-3784859 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021776_4 4781549-4781663 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021776_2 2.1|2105844|34|NZ_CP021776|CRISPRCasFinder 2105844-2105877 34 MH178096 Aeromonas phage AsXd-1, complete genome 10853-10886 0 1.0
NZ_CP021776_1 1.1|556774|38|NZ_CP021776|CRISPRCasFinder 556774-556811 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947

1. spacer 2.1|2105844|34|NZ_CP021776|CRISPRCasFinder matches to MH178096 (Aeromonas phage AsXd-1, complete genome) position: , mismatch: 0, identity: 1.0

ggggtgaatctgctgcaccaggtagtgaacgatt	CRISPR spacer
ggggtgaatctgctgcaccaggtagtgaacgatt	Protospacer
**********************************

2. spacer 1.1|556774|38|NZ_CP021776|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cagacgcaagatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
********..****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 364717 : 425029 81 Enterobacterial_phage(37.74%) terminase,tail,head,holin,portal,integrase,capsid,protease,tRNA attL 355215:355230|attR 433985:434000
DBSCAN-SWA_2 1049870 : 1102627 62 Erwinia_phage(24.32%) terminase,tail,plate,holin,head,portal,integrase,capsid,protease,lysis attL 1062536:1062550|attR 1103912:1103926
DBSCAN-SWA_3 1373906 : 1385573 14 Salmonella_phage(22.22%) terminase NA
DBSCAN-SWA_4 1495053 : 1503903 7 Escherichia_phage(28.57%) NA NA
DBSCAN-SWA_5 1921742 : 2071969 160 Escherichia_phage(30.77%) terminase,tail,plate,transposase,holin,lysis,head,portal,coat,integrase,capsid,tRNA attL 2031070:2031087|attR 2063631:2063648
DBSCAN-SWA_6 2081349 : 2135283 61 Enterobacteria_phage(27.78%) holin,integrase,terminase,tail attL 2081602:2081616|attR 2142620:2142634
DBSCAN-SWA_7 2640817 : 2681109 49 Salmonella_phage(80.49%) terminase,tail,head,plate,portal,tRNA,integrase,capsid,lysis attL 2635096:2635126|attR 2686098:2686128
DBSCAN-SWA_8 3788666 : 3865974 86 uncultured_Caudovirales_phage(42.11%) transposase,protease,integrase attL 3789078:3789092|attR 3854734:3854750
DBSCAN-SWA_9 4667048 : 4715841 70 Cronobacter_phage(35.71%) terminase,tail,head,holin,transposase,integrase attL 4658073:4658089|attR 4717843:4717859
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP021777
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 296 : 10696 12 Escherichia_phage(50.0%) transposase,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage