Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021733 Escherichia coli strain AR_0114 plasmid unitig_1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP021735 Escherichia coli strain AR_0114 plasmid unitig_4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP021734 Escherichia coli strain AR_0114 plasmid unitig_2, complete sequence 0 crisprs RT,cas14j,csa3 0 0 1 0
NZ_CP021732 Escherichia coli strain AR_0114, complete genome 8 crisprs c2c9_V-U4,cas3,DinG,RT,DEDDh,WYL,csa3,PD-DExK,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 0 13 5 0

Results visualization

1. NZ_CP021733
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 32319 : 68664 36 Escherichia_phage(38.46%) transposase,integrase attL 56411:56470|attR 68658:69478
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP021734
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6194 : 69652 61 Escherichia_phage(30.3%) transposase,integrase attL 22278:22337|attR 74415:75234
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP021732
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021732_1 79623-79746 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021732_2 747955-748046 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021732_3 1009471-1009615 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021732_4 1268718-1268814 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021732_5 1408859-1409003 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021732_6 1996674-1996823 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021732_7 3660460-3661098 Orphan I-E
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021732_8 3689585-3690220 TypeI-E I-E
10 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021732_2 2.1|747981|40|NZ_CP021732|CRISPRCasFinder 747981-748020 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP021732_8 8.10|3690160|35|NZ_CP021732|CRT 3690160-3690194 35 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246934-246968 0 1.0
NZ_CP021732_1 1.1|79666|38|NZ_CP021732|CRISPRCasFinder 79666-79703 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP021732_7 7.13|3660977|32|NZ_CP021732|CRISPRCasFinder,CRT 3660977-3661008 32 KT898133 Aeromonas phage phiARM81ld, complete genome 45655-45686 2 0.938
NZ_CP021732_8 8.4|3689794|35|NZ_CP021732|PILER-CR,CRISPRCasFinder,CRT 3689794-3689828 35 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42676-42710 2 0.943
NZ_CP021732_7 7.1|3660490|31|NZ_CP021732|PILER-CR 3660490-3660520 31 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 320388-320418 5 0.839
NZ_CP021732_7 7.3|3660612|31|NZ_CP021732|PILER-CR 3660612-3660642 31 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37867-37897 6 0.806
NZ_CP021732_7 7.7|3660611|32|NZ_CP021732|CRISPRCasFinder,CRT 3660611-3660642 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
NZ_CP021732_7 7.1|3660490|31|NZ_CP021732|PILER-CR 3660490-3660520 31 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107537 7 0.774
NZ_CP021732_7 7.1|3660490|31|NZ_CP021732|PILER-CR 3660490-3660520 31 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199311 7 0.774
NZ_CP021732_7 7.9|3660733|32|NZ_CP021732|CRISPRCasFinder,CRT 3660733-3660764 32 KC821619 Cellulophaga phage phi18:1, complete genome 6924-6955 7 0.781
NZ_CP021732_7 7.9|3660733|32|NZ_CP021732|CRISPRCasFinder,CRT 3660733-3660764 32 KC821627 Cellulophaga phage phi18:2, complete genome 6924-6955 7 0.781
NZ_CP021732_7 7.5|3660489|32|NZ_CP021732|CRISPRCasFinder,CRT 3660489-3660520 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
NZ_CP021732_7 7.5|3660489|32|NZ_CP021732|CRISPRCasFinder,CRT 3660489-3660520 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
NZ_CP021732_7 7.8|3660672|32|NZ_CP021732|CRISPRCasFinder,CRT 3660672-3660703 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
NZ_CP021732_7 7.13|3660977|32|NZ_CP021732|CRISPRCasFinder,CRT 3660977-3661008 32 MN901520 Halorubrum coriense virus Hardycor2, complete genome 16524-16555 8 0.75
NZ_CP021732_7 7.9|3660733|32|NZ_CP021732|CRISPRCasFinder,CRT 3660733-3660764 32 NZ_CP020483 Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence 383-414 9 0.719
NZ_CP021732_5 5.1|1408902|59|NZ_CP021732|CRISPRCasFinder 1408902-1408960 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
NZ_CP021732_5 5.1|1408902|59|NZ_CP021732|CRISPRCasFinder 1408902-1408960 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814
NZ_CP021732_8 8.5|3689855|35|NZ_CP021732|PILER-CR,CRISPRCasFinder,CRT 3689855-3689889 35 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20186 12 0.657

1. spacer 2.1|747981|40|NZ_CP021732|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 8.10|3690160|35|NZ_CP021732|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

ccggacgcactggatgcgatgatggacatcacttg	CRISPR spacer
ccggacgcactggatgcgatgatggacatcacttg	Protospacer
***********************************

3. spacer 1.1|79666|38|NZ_CP021732|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 7.13|3660977|32|NZ_CP021732|CRISPRCasFinder,CRT matches to KT898133 (Aeromonas phage phiARM81ld, complete genome) position: , mismatch: 2, identity: 0.938

gacgatgagacgccctggtgtgccgcgttcgt	CRISPR spacer
gacgacgagacgccctggtgcgccgcgttcgt	Protospacer
*****.**************.***********

5. spacer 8.4|3689794|35|NZ_CP021732|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.943

tcggcgagtaagagtactgagtattttaatctcat	CRISPR spacer
acggcgagtaagagtgctgagtattttaatctcat	Protospacer
 **************.*******************

6. spacer 7.1|3660490|31|NZ_CP021732|PILER-CR matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 5, identity: 0.839

cattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
cgtcgactgcccgtggcgtcccgccgacctg	Protospacer
*.*.******************  ****** 

7. spacer 7.3|3660612|31|NZ_CP021732|PILER-CR matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.806

gcacgccctgccggaatctcccctcgctctc	CRISPR spacer
gcacgccctgccggaagatcccctcacgatt	Protospacer
****************  *******.*  *.

8. spacer 7.7|3660611|32|NZ_CP021732|CRISPRCasFinder,CRT matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812

tgcacgccctgccggaatctcccctcgctctc	CRISPR spacer
tgcacgccctgccggaagatcccctcacgatt	Protospacer
*****************  *******.*  *.

9. spacer 7.1|3660490|31|NZ_CP021732|PILER-CR matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 7, identity: 0.774

cattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
cgtcgactgcccgtggggtcccagcgaaatc	Protospacer
*.*.************ ***** ****  *.

10. spacer 7.1|3660490|31|NZ_CP021732|PILER-CR matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

cattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
cgtcgactgcccgtggggtcccagcgaaatc	Protospacer
*.*.************ ***** ****  *.

11. spacer 7.9|3660733|32|NZ_CP021732|CRISPRCasFinder,CRT matches to KC821619 (Cellulophaga phage phi18:1, complete genome) position: , mismatch: 7, identity: 0.781

agctttattgttttcagggaaaataacgcggc	CRISPR spacer
ctcttttttcttttcagggaaaataaaaccgc	Protospacer
  **** ** **************** .* **

12. spacer 7.9|3660733|32|NZ_CP021732|CRISPRCasFinder,CRT matches to KC821627 (Cellulophaga phage phi18:2, complete genome) position: , mismatch: 7, identity: 0.781

agctttattgttttcagggaaaataacgcggc	CRISPR spacer
ctcttttttcttttcagggaaaataaaaccgc	Protospacer
  **** ** **************** .* **

13. spacer 7.5|3660489|32|NZ_CP021732|CRISPRCasFinder,CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

14. spacer 7.5|3660489|32|NZ_CP021732|CRISPRCasFinder,CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

15. spacer 7.8|3660672|32|NZ_CP021732|CRISPRCasFinder,CRT matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75

agtaagccggttgattatcgcca----gggatatta	CRISPR spacer
agtaagcaggatgattatcgccaccatggcgt----	Protospacer
******* ** ************    ** .*    

16. spacer 7.13|3660977|32|NZ_CP021732|CRISPRCasFinder,CRT matches to MN901520 (Halorubrum coriense virus Hardycor2, complete genome) position: , mismatch: 8, identity: 0.75

--gacgatgagacgccctggtgtgccgcgttcgt	CRISPR spacer
ccgccgcc--gacgctcgggtgtgccgcgttcgg	Protospacer
  * ** .  *****.* *************** 

17. spacer 7.9|3660733|32|NZ_CP021732|CRISPRCasFinder,CRT matches to NZ_CP020483 (Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence) position: , mismatch: 9, identity: 0.719

agctttattgttttcagggaaaataacgcggc	CRISPR spacer
acttttattgttttgagtgaaaataaaggcta	Protospacer
* .*********** ** ******** *    

18. spacer 5.1|1408902|59|NZ_CP021732|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831

-cggagcacttattgccggatgcggcgtgaacgccttatccggcctacggttctggcacc	CRISPR spacer
tcagtgcac-gatcgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctc	Protospacer
 *.* ****  **.**************************** ************   .*

19. spacer 5.1|1408902|59|NZ_CP021732|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814

cggagcacttattgccggatgcggcgtgaacgccttatccggcctacggttctggcacc-	CRISPR spacer
ggtacggctttttgccggatgcggcgtaaacgccttatccggcctacggtt-tggtgcga	Protospacer
 * *  .*** ****************.*********************** ***..*  

20. spacer 8.5|3689855|35|NZ_CP021732|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.657

tcggccatagactttattaacttcattgggggtta	CRISPR spacer
atcgccatagaattttttaacttcattgcctaaag	Protospacer
 . ******** *** ************   .  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 548665 : 631082 96 Escherichia_phage(39.62%) tRNA,protease,portal,terminase,head,tail,capsid,integrase,transposase,holin attL 584188:584202|attR 631184:631198
DBSCAN-SWA_2 1204887 : 1241402 36 Escherichia_phage(40.0%) transposase NA
DBSCAN-SWA_3 1569232 : 1608811 37 Enterobacteria_phage(25.0%) transposase,plate,integrase attL 1560901:1560916|attR 1591777:1591792
DBSCAN-SWA_4 3706517 : 3713657 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_5 4330644 : 4340085 10 Enterobacteria_phage(85.71%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage