Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021656 Aeromonas salmonicida strain O23A plasmid pO23AP2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 1 crisprs NA 2 2 0 0
NZ_CP021655 Aeromonas salmonicida strain O23A plasmid pO23AP1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP021658 Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence 0 crisprs DEDDh 0 0 0 0
NZ_CP021654 Aeromonas salmonicida strain O23A chromosome, complete genome 15 crisprs cas1,cas3f,cas8f,cas5f,cas7f,cas6f,DinG,DEDDh,cas3,WYL,csa3 0 34 4 0

Results visualization

1. NZ_CP021657
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021657_1 46148-46336 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657.1 33631-33660 0 1.0
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657.1 45840-45869 0 1.0
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657.1 45910-45939 0 1.0
NZ_CP021657_1 1.2|46278|19|NZ_CP021657|PILER-CR 46278-46296 19 NZ_CP021657.1 46337-46355 0 1.0
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657.1 49315-49344 2 0.933

1. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to position: 33631-33660, mismatch: 0, identity: 1.0

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
gcgctgctgttcctggacaaccccgagcca	Protospacer
******************************

2. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to position: 45840-45869, mismatch: 0, identity: 1.0

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
gcgctgctgttcctggacaaccccgagcca	Protospacer
******************************

3. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to position: 45910-45939, mismatch: 0, identity: 1.0

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
gcgctgctgttcctggacaaccccgagcca	Protospacer
******************************

4. spacer 1.2|46278|19|NZ_CP021657|PILER-CR matches to position: 46337-46355, mismatch: 0, identity: 1.0

acctggacaacccgagccg	CRISPR spacer
acctggacaacccgagccg	Protospacer
*******************

5. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to position: 49315-49344, mismatch: 2, identity: 0.933

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
gcgctgctgttcctggacagtcccgagcca	Protospacer
*******************..*********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 33631-33660 0 1.0
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 45840-45869 0 1.0
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 45910-45939 0 1.0
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 46188-46217 0 1.0
NZ_CP021657_1 1.2|46278|19|NZ_CP021657|PILER-CR 46278-46296 19 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 46268-46286 0 1.0
NZ_CP021657_1 1.2|46278|19|NZ_CP021657|PILER-CR 46278-46296 19 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 46337-46355 0 1.0
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 38502-38531 1 0.967
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 7-36 1 0.967
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 214-243 1 0.967
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 283-312 1 0.967
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 421-450 1 0.967
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 6618-6647 1 0.967
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 33701-33730 1 0.967
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 38295-38324 1 0.967
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 46050-46079 1 0.967
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 46119-46148 1 0.967
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 38833-38862 2 0.933
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 49315-49344 2 0.933
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 34046-34075 2 0.933
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 38572-38601 2 0.933
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 38699-38728 2 0.933
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 490-519 2 0.933
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 38364-38393 2 0.933
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 37729-37758 3 0.9
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 37301-37330 3 0.9
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP021657 Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence 45980-46009 5 0.833
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1898433-1898462 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 37724-37753 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 473067-473096 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1813926-1813955 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1851971-1852000 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1930681-1930710 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1852283-1852312 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1930681-1930710 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1851971-1852000 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1851174-1851203 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1930681-1930710 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1930681-1930710 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1930681-1930710 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NC_014305 Erwinia billingiae Eb661 plasmid pEB170, complete sequence 163994-164023 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1927996-1928025 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1852282-1852311 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1930686-1930715 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 2007600-2007629 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 2007600-2007629 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 773416-773445 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 554892-554921 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 431516-431545 6 0.8
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 459362-459391 7 0.767
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1447594-1447623 7 0.767
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 169231-169260 7 0.767
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 365668-365697 7 0.767
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 460943-460972 7 0.767
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 228066-228095 7 0.767
NZ_CP021657_1 1.1|46198|30|NZ_CP021657|PILER-CR 46198-46227 30 MT708547 Klebsiella phage Muenster, complete genome 112580-112609 7 0.767

1. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
gcgctgctgttcctggacaaccccgagcca	Protospacer
******************************

2. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
gcgctgctgttcctggacaaccccgagcca	Protospacer
******************************

3. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
gcgctgctgttcctggacaaccccgagcca	Protospacer
******************************

4. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
gcgctgctgttcctggacaaccccgagcca	Protospacer
******************************

5. spacer 1.2|46278|19|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 0, identity: 1.0

acctggacaacccgagccg	CRISPR spacer
acctggacaacccgagccg	Protospacer
*******************

6. spacer 1.2|46278|19|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 0, identity: 1.0

acctggacaacccgagccg	CRISPR spacer
acctggacaacccgagccg	Protospacer
*******************

7. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 1, identity: 0.967

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
gtgctgctgttcctggacaaccccgagcca	Protospacer
*.****************************

8. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 1, identity: 0.967

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccag	Protospacer
******************** ********* 

9. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 1, identity: 0.967

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccag	Protospacer
******************** ********* 

10. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 1, identity: 0.967

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccag	Protospacer
******************** ********* 

11. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 1, identity: 0.967

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccag	Protospacer
******************** ********* 

12. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 1, identity: 0.967

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccag	Protospacer
******************** ********* 

13. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 1, identity: 0.967

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccag	Protospacer
******************** ********* 

14. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 1, identity: 0.967

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccag	Protospacer
******************** ********* 

15. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 1, identity: 0.967

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccag	Protospacer
******************** ********* 

16. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 1, identity: 0.967

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccag	Protospacer
******************** ********* 

17. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 2, identity: 0.933

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
gcgctgctgttcctggacaaccccgaaccg	Protospacer
**************************.**.

18. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 2, identity: 0.933

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
gcgctgctgttcctggacagtcccgagcca	Protospacer
*******************..*********

19. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 2, identity: 0.933

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccgg	Protospacer
******************** ********. 

20. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 2, identity: 0.933

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccgg	Protospacer
******************** ********. 

21. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 2, identity: 0.933

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacaa-cccgagccgg	Protospacer
******************** ********. 

22. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 2, identity: 0.933

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacag-cccgagccag	Protospacer
*******************. ********* 

23. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 2, identity: 0.933

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctgctgttcctggacag-cccgagccag	Protospacer
*******************. ********* 

24. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 3, identity: 0.9

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
tcactgctgttcctgggcaaccccgagcca	Protospacer
 *.*************.*************

25. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 3, identity: 0.9

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
gcgctactgttcctggacaa-cccgagccgg	Protospacer
*****.************** ********. 

26. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP021657 (Aeromonas salmonicida strain O23A plasmid pO23AP3, complete sequence) position: , mismatch: 5, identity: 0.833

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
tacctgctgcacctggacaaccccgagcca	Protospacer
   ******. *******************

27. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

28. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

29. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

30. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

31. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

32. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

33. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

34. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

35. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

36. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

37. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

38. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

39. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

40. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NC_014305 (Erwinia billingiae Eb661 plasmid pEB170, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca-	CRISPR spacer
cagctgctgttcctggacag-cccgggccgc	Protospacer
  *****************. ****.***. 

41. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

42. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

43. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

44. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

45. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

46. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

47. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

48. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.8

gcgctgctgttcctggacaaccccgagcca--	CRISPR spacer
ctgctgctgttcgtcgacaacccc--gccatc	Protospacer
 .********** * *********  ****  

49. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
agcctgctgttcctggacgaccccgaccgc	Protospacer
.  ***************.******* *  

50. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.767

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
atcctgctgctcctggaccaccccgaggcg	Protospacer
.. ******.******** ******** *.

51. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 7, identity: 0.767

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
acggatctgttcctggacaacctcgagcag	Protospacer
.**   ****************.***** .

52. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.767

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
atcctgctgctcctggaccaccccgaggcg	Protospacer
.. ******.******** ******** *.

53. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 7, identity: 0.767

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
ggggcgctgttcctggccaaccccgacctc	Protospacer
* * .*********** ********* *. 

54. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 7, identity: 0.767

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
ggggcgctgttcctggccaaccccgacctc	Protospacer
* * .*********** ********* *. 

55. spacer 1.1|46198|30|NZ_CP021657|PILER-CR matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 7, identity: 0.767

gcgctgctgttcctggacaaccccgagcca	CRISPR spacer
ggcctgctgtttctggacagccccgaatga	Protospacer
*  ********.*******.******.. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP021654
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_1 145292-145407 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_2 528746-532014 TypeI-F I-F
54 spacers
cas6f,cas7f,cas5f,cas8f,cas3f,cas1,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_5 557088-557171 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_4 556860-556944 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_3 556449-556773 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_6 2019565-2019660 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_7 2095680-2095788 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_8 2529926-2530026 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_9 2830227-2830375 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_10 2952705-2952817 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_11 3555747-3555862 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_12 3749530-3749622 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_13 3844856-3844942 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_14 4575830-4575929 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021654_15 4633596-4633723 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021654_2 2.21|529975|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529975-530006 32 MK804891 Aeromonas phage 2_D05, complete genome 13615-13646 0 1.0
NZ_CP021654_2 2.21|529975|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529975-530006 32 MK813942 Aeromonas phage 4_4512, complete genome 1351-1382 0 1.0
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 MH179474 Aeromonas phage 62AhydR11PP, complete genome 8709-8740 0 1.0
NZ_CP021654_2 2.34|530755|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530755-530786 32 EU515217 Aeromonas phage DH1 clone SEQDH5, genomic sequence 4103-4134 0 1.0
NZ_CP021654_2 2.4|528954|33|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 528954-528986 33 MK733234 Aeromonas phage V46 capsid protein gene, complete cds 1116-1148 1 0.97
NZ_CP021654_2 2.21|529975|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529975-530006 32 MK804892 Aeromonas phage 4_D05, complete genome 14164-14195 1 0.969
NZ_CP021654_2 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530155-530186 32 MH179474 Aeromonas phage 62AhydR11PP, complete genome 9434-9465 1 0.969
NZ_CP021654_2 2.34|530755|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530755-530786 32 MH179474 Aeromonas phage 62AhydR11PP, complete genome 7014-7045 1 0.969
NZ_CP021654_2 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531115-531146 32 KT898134 Aeromonas phage phiARM81mr, complete genome 5141-5172 1 0.969
NZ_CP021654_2 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531955-531986 32 KY290953 Aeromonas phage 51, complete genome 39383-39414 1 0.969
NZ_CP021654_2 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531955-531986 32 NC_019527 Aeromonas phage vB_AsaM-56, complete genome 39383-39414 1 0.969
NZ_CP021654_2 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531955-531986 32 KY290954 Aeromonas phage 56, complete genome 39383-39414 1 0.969
NZ_CP021654_2 2.4|528954|33|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 528954-528986 33 MK813942 Aeromonas phage 4_4512, complete genome 14734-14766 2 0.939
NZ_CP021654_2 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530155-530186 32 EU515217 Aeromonas phage DH1 clone SEQDH5, genomic sequence 1683-1714 2 0.938
NZ_CP021654_2 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530155-530186 32 KY290953 Aeromonas phage 51, complete genome 38058-38089 2 0.938
NZ_CP021654_2 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530155-530186 32 MK804891 Aeromonas phage 2_D05, complete genome 38640-38671 2 0.938
NZ_CP021654_2 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530155-530186 32 NC_019527 Aeromonas phage vB_AsaM-56, complete genome 38058-38089 2 0.938
NZ_CP021654_2 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530155-530186 32 KY290954 Aeromonas phage 56, complete genome 38058-38089 2 0.938
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 EU515217 Aeromonas phage DH1 clone SEQDH5, genomic sequence 2408-2439 2 0.938
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 MK804891 Aeromonas phage 2_D05, complete genome 39365-39396 2 0.938
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 MK804892 Aeromonas phage 4_D05, complete genome 38730-38761 2 0.938
NZ_CP021654_2 2.49|531655|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531655-531686 32 MK804891 Aeromonas phage 2_D05, complete genome 36077-36108 2 0.938
NZ_CP021654_2 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531955-531986 32 EU515217 Aeromonas phage DH1 clone SEQDH5, genomic sequence 2382-2413 2 0.938
NZ_CP021654_2 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531955-531986 32 MH179474 Aeromonas phage 62AhydR11PP, complete genome 8735-8766 2 0.938
NZ_CP021654_2 2.49|531655|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531655-531686 32 MH179474 Aeromonas phage 62AhydR11PP, complete genome 12525-12556 3 0.906
NZ_CP021654_2 2.49|531655|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531655-531686 32 MK804892 Aeromonas phage 4_D05, complete genome 34937-34968 4 0.875
NZ_CP021654_2 2.29|530455|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530455-530486 32 KT070866 Bacillus phage PBC4, complete genome 54386-54417 5 0.844
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NC_019125 Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence 49116-49145 5 0.833
NZ_CP021654_3 3.5|556716|30|NZ_CP021654|CRISPRCasFinder 556716-556745 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 613159-613188 5 0.833
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 378887-378916 5 0.833
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 372703-372732 5 0.833
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 367619-367648 5 0.833
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 991918-991947 5 0.833
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 623634-623663 5 0.833
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1156413-1156442 5 0.833
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 519883-519912 5 0.833
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NZ_CP031599 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence 201105-201134 6 0.8
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 126476-126505 6 0.8
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 126476-126505 6 0.8
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NC_015728 Roseobacter litoralis Och 149 plasmid pRLO149_83, complete sequence 63013-63042 6 0.8
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NZ_CP013915 Serratia fonticola strain GS2 plasmid pSF002, complete sequence 17549-17578 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 479446-479475 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 383439-383468 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 407383-407412 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 382906-382935 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 383782-383811 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 388642-388671 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 387482-387511 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 387482-387511 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 387474-387503 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 407383-407412 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 388642-388671 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP021126 Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence 458027-458056 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 389991-390020 6 0.8
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 617247-617276 6 0.8
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_JX627582 Methylobacterium oryzae CBMB20 plasmid pMOC3, complete sequence 2180-2209 6 0.8
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP015370 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p3, complete sequence 33731-33760 6 0.8
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 LZ998060 JP 2017534684-A/7: Phage Therapy 11432-11461 6 0.8
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NC_028879 Pseudomonas phage PaMx42, complete genome 7578-7607 6 0.8
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 LQ277712 Sequence 7 from Patent WO2016071503 11432-11461 6 0.8
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 LC581504 Staphylococcus phage vB_PaeS-Yazdi-M DNA, complete genome 5029-5058 6 0.8
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 LC552830 Pseudomonas phage vB_PaeS-Yazdi-M DNA, complete genome 5029-5058 6 0.8
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 739954-739983 6 0.8
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NC_021911 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence 386793-386822 6 0.8
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1416409-1416438 6 0.8
NZ_CP021654_2 2.13|529495|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529495-529526 32 MN103543 Pseudomonas phage vB_PaeM_PS119XW, complete genome 158516-158547 7 0.781
NZ_CP021654_2 2.13|529495|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529495-529526 32 MK599315 Pseudomonas phage PA1C, complete genome 158479-158510 7 0.781
NZ_CP021654_2 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530155-530186 32 MK967377 Gordonia phage MagicMan, complete genome 6219-6250 7 0.781
NZ_CP021654_2 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530155-530186 32 MN813694 Gordonia phage Opie, complete genome 6228-6259 7 0.781
NZ_CP021654_2 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530155-530186 32 NC_031255 Gordonia phage Schwabeltier, complete genome 6220-6251 7 0.781
NZ_CP021654_2 2.28|530395|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530395-530426 32 MN703409 Arthrobacter phage LittleTokyo, complete genome 5162-5193 7 0.781
NZ_CP021654_2 2.31|530575|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530575-530606 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2683017-2683048 7 0.781
NZ_CP021654_2 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531115-531146 32 LN713927 Pseudomonas fluorescens SBW25 plasmid pQBR55, complete sequence 107402-107433 7 0.781
NZ_CP021654_2 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531175-531206 32 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 371540-371571 7 0.781
NZ_CP021654_2 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531175-531206 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 957188-957219 7 0.781
NZ_CP021654_2 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531175-531206 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 932545-932576 7 0.781
NZ_CP021654_2 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531175-531206 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 957188-957219 7 0.781
NZ_CP021654_2 2.44|531355|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531355-531386 32 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 60104-60135 7 0.781
NZ_CP021654_2 2.53|531895|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531895-531926 32 NZ_LT994838 Klebsiella variicola isolate CNR130 plasmid CNR130, complete sequence 51384-51415 7 0.781
NZ_CP021654_2 2.53|531895|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531895-531926 32 NZ_LT994833 Klebsiella pneumoniae isolate CNR341 plasmid CNR341, complete sequence 50322-50353 7 0.781
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NZ_CP042262 Litoreibacter sp. LN3S51 plasmid unnamed1, complete sequence 297713-297742 7 0.767
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NZ_CP045736 Aeromicrobium sp. MF47 plasmid p001, complete sequence 23479-23508 7 0.767
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 322754-322783 7 0.767
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 641218-641247 7 0.767
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_LC066384 Aureimonas sp. AU12 plasmid pAU12rrn, complete sequence 2411-2440 7 0.767
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 297914-297943 7 0.767
NZ_CP021654_2 2.1|528774|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 528774-528805 32 KM879463 Arthrobacter phage vB_ArtM-ArV1, complete genome 63116-63147 8 0.75
NZ_CP021654_2 2.5|529015|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529015-529046 32 NZ_CP019063 Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence 222419-222450 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 522198-522229 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 8292-8323 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 50438-50469 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 50713-50744 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 117975-118006 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1250554-1250585 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 8271-8302 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 8287-8318 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1298082-1298113 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 274390-274421 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP044333 Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence 138994-139025 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 260340-260371 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1417130-1417161 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 1572495-1572526 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 964136-964167 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 797080-797111 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 1006592-1006623 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 260090-260121 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 50481-50512 8 0.75
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 50438-50469 8 0.75
NZ_CP021654_2 2.26|530275|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530275-530306 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 17563-17594 8 0.75
NZ_CP021654_2 2.26|530275|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530275-530306 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 17563-17594 8 0.75
NZ_CP021654_2 2.26|530275|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530275-530306 32 NC_014840 Pantoea sp. At-9b plasmid pPAT9B03, complete sequence 63039-63070 8 0.75
NZ_CP021654_2 2.26|530275|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530275-530306 32 NZ_CP026517 Deinococcus sp. NW-56 plasmid unnamed1, complete sequence 290151-290182 8 0.75
NZ_CP021654_2 2.28|530395|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530395-530426 32 MT889373 Arthrobacter phage Brynnie, complete genome 5270-5301 8 0.75
NZ_CP021654_2 2.28|530395|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530395-530426 32 MF140397 Arthrobacter phage Abidatro, complete genome 5210-5241 8 0.75
NZ_CP021654_2 2.30|530515|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530515-530546 32 NZ_CP034087 Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence 46009-46040 8 0.75
NZ_CP021654_2 2.31|530575|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530575-530606 32 MK411746 Arthrobacter phage Sonali, complete genome 54440-54471 8 0.75
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 371937-371968 8 0.75
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 143866-143897 8 0.75
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 360732-360763 8 0.75
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 135225-135256 8 0.75
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 144050-144081 8 0.75
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 597711-597742 8 0.75
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 24533-24564 8 0.75
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 389002-389033 8 0.75
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 269695-269726 8 0.75
NZ_CP021654_2 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531115-531146 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 428686-428717 8 0.75
NZ_CP021654_2 2.50|531715|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531715-531746 32 NZ_CP018464 Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence 141442-141473 8 0.75
NZ_CP021654_2 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531955-531986 32 NZ_CP022727 Erwinia persicina strain B64 plasmid pEP2, complete sequence 17951-17982 8 0.75
NZ_CP021654_2 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531955-531986 32 NZ_CP006371 Aureimonas sp. AU20 plasmid pAU20d, complete sequence 36480-36511 8 0.75
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NZ_CP019032 Lactobacillus fermentum strain SNUV175 plasmid pSNU175-3, complete sequence 25688-25717 8 0.733
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NC_006529 Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence 8859-8888 8 0.733
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1800665-1800694 8 0.733
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 365395-365424 8 0.733
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NZ_CP026517 Deinococcus sp. NW-56 plasmid unnamed1, complete sequence 192822-192851 8 0.733
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 KR063281 Gordonia phage GMA2, complete genome 91944-91973 8 0.733
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 121853-121882 8 0.733
NZ_CP021654_3 3.4|556659|30|NZ_CP021654|CRISPRCasFinder 556659-556688 30 MH643778 Pseudomonas phage YMC12/01/R24, complete genome 42877-42906 8 0.733
NZ_CP021654_3 3.4|556659|30|NZ_CP021654|CRISPRCasFinder 556659-556688 30 MT613935 Pseudomonas phage Persinger, complete genome 36814-36843 8 0.733
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 837577-837606 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 34272-34301 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 43089-43118 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 363303-363332 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP021821 Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence 178253-178282 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 519071-519100 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 395329-395358 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 1318548-1318577 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 34274-34303 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1383997-1384026 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 1600083-1600112 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 689735-689764 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 141806-141835 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1049115-1049144 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 101027-101056 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 391882-391911 8 0.733
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 159577-159606 8 0.733
NZ_CP021654_2 2.1|528774|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 528774-528805 32 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 142918-142949 9 0.719
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 8292-8323 9 0.719
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 161773-161804 9 0.719
NZ_CP021654_2 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529195-529226 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 134127-134158 9 0.719
NZ_CP021654_2 2.14|529555|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529555-529586 32 MK448905 Streptococcus phage Javan318, complete genome 22797-22828 9 0.719
NZ_CP021654_2 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530155-530186 32 KC292021 Halovirus HRTV-7, complete genome 56913-56944 9 0.719
NZ_CP021654_2 2.30|530515|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530515-530546 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 613038-613069 9 0.719
NZ_CP021654_2 2.36|530875|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530875-530906 32 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 567986-568017 9 0.719
NZ_CP021654_2 2.37|530935|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530935-530966 32 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 71673-71704 9 0.719
NZ_CP021654_2 2.39|531055|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531055-531086 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 386176-386207 9 0.719
NZ_CP021654_2 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531115-531146 32 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 675852-675883 9 0.719
NZ_CP021654_2 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531115-531146 32 NZ_CP049142 Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence 338697-338728 9 0.719
NZ_CP021654_2 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531115-531146 32 NZ_CP018684 Vibrio harveyi isolate QT520 plasmid p3, complete sequence 53403-53434 9 0.719
NZ_CP021654_2 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531115-531146 32 NC_028791 Mycobacterium phage MOOREtheMARYer, complete genome 7606-7637 9 0.719
NZ_CP021654_2 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531175-531206 32 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 753759-753790 9 0.719
NZ_CP021654_2 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531175-531206 32 MN694443 Marine virus AFVG_250M280, complete genome 31575-31606 9 0.719
NZ_CP021654_2 2.47|531535|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531535-531566 32 NZ_AP017296 Nostoc sp. NIES-3756 plasmid pNOS3756_1, complete sequence 435311-435342 9 0.719
NZ_CP021654_3 3.1|556476|30|NZ_CP021654|CRISPRCasFinder 556476-556505 30 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 93167-93196 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 690493-690522 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 683096-683125 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 585857-585886 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 644681-644710 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 584972-585001 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 583758-583787 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 583748-583777 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 585845-585874 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 585864-585893 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 585842-585871 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 690551-690580 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 690551-690580 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 690540-690569 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1278613-1278642 9 0.7
NZ_CP021654_3 3.3|556602|30|NZ_CP021654|CRISPRCasFinder 556602-556631 30 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1281091-1281120 9 0.7
NZ_CP021654_3 3.5|556716|30|NZ_CP021654|CRISPRCasFinder 556716-556745 30 MG298964 Streptomyces phage Alsaber, complete genome 30060-30089 9 0.7
NZ_CP021654_3 3.5|556716|30|NZ_CP021654|CRISPRCasFinder 556716-556745 30 MT711979 Streptomyces phage Endor2, complete genome 30007-30036 9 0.7
NZ_CP021654_3 3.5|556716|30|NZ_CP021654|CRISPRCasFinder 556716-556745 30 MT711978 Streptomyces phage Endor1, complete genome 30466-30495 9 0.7
NZ_CP021654_3 3.5|556716|30|NZ_CP021654|CRISPRCasFinder 556716-556745 30 KT186229 Streptomyces phage Verse, complete genome 30861-30890 9 0.7
NZ_CP021654_3 3.5|556716|30|NZ_CP021654|CRISPRCasFinder 556716-556745 30 KX815338 Streptomyces phage Joe, complete genome 29786-29815 9 0.7
NZ_CP021654_3 3.5|556716|30|NZ_CP021654|CRISPRCasFinder 556716-556745 30 KT186228 Streptomyces phage Amela, complete genome 30867-30896 9 0.7
NZ_CP021654_3 3.5|556716|30|NZ_CP021654|CRISPRCasFinder 556716-556745 30 MN204498 Streptomyces phage Saftant, complete genome 30181-30210 9 0.7
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 220818-220847 9 0.7
NZ_CP021654_2 2.31|530575|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530575-530606 32 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 255433-255464 10 0.688
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 317768-317799 10 0.688
NZ_CP021654_2 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 530695-530726 32 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 28173-28204 10 0.688
NZ_CP021654_2 2.46|531475|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531475-531506 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1925394-1925425 10 0.688
NZ_CP021654_5 5.1|557115|30|NZ_CP021654|CRISPRCasFinder 557115-557144 30 NZ_CP049160 Caballeronia sp. SBC1 plasmid pSBC1_4, complete sequence 188462-188491 10 0.667
NZ_CP021654_2 2.7|529135|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529135-529166 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1783858-1783889 11 0.656
NZ_CP021654_2 2.7|529135|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529135-529166 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1784031-1784062 11 0.656
NZ_CP021654_2 2.7|529135|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529135-529166 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1784029-1784060 11 0.656
NZ_CP021654_2 2.7|529135|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 529135-529166 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1783998-1784029 11 0.656
NZ_CP021654_2 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT 531175-531206 32 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 285917-285948 11 0.656
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 MT952845 Microbacterium phage GardenState, complete genome 28799-28828 14 0.533
NZ_CP021654_4 4.1|556887|30|NZ_CP021654|CRISPRCasFinder 556887-556916 30 MK880124 Microbacterium phage IAmGroot, complete genome 29266-29295 14 0.533

1. spacer 2.21|529975|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK804891 (Aeromonas phage 2_D05, complete genome) position: , mismatch: 0, identity: 1.0

tactcgcaggccaagttcacaccgaaaggagt	CRISPR spacer
tactcgcaggccaagttcacaccgaaaggagt	Protospacer
********************************

2. spacer 2.21|529975|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK813942 (Aeromonas phage 4_4512, complete genome) position: , mismatch: 0, identity: 1.0

tactcgcaggccaagttcacaccgaaaggagt	CRISPR spacer
tactcgcaggccaagttcacaccgaaaggagt	Protospacer
********************************

3. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MH179474 (Aeromonas phage 62AhydR11PP, complete genome) position: , mismatch: 0, identity: 1.0

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
tacggccatccgcaccggggtgctcactgact	Protospacer
********************************

4. spacer 2.34|530755|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to EU515217 (Aeromonas phage DH1 clone SEQDH5, genomic sequence) position: , mismatch: 0, identity: 1.0

gtgttgactgcccctgatgggctgtttggttt	CRISPR spacer
gtgttgactgcccctgatgggctgtttggttt	Protospacer
********************************

5. spacer 2.4|528954|33|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK733234 (Aeromonas phage V46 capsid protein gene, complete cds) position: , mismatch: 1, identity: 0.97

caccgagaacggcatcccgatgaccatggttta	CRISPR spacer
cactgagaacggcatcccgatgaccatggttta	Protospacer
***.*****************************

6. spacer 2.21|529975|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK804892 (Aeromonas phage 4_D05, complete genome) position: , mismatch: 1, identity: 0.969

tactcgcaggccaagttcacaccgaaaggagt	CRISPR spacer
tactcgcaggccaagttcacacctaaaggagt	Protospacer
*********************** ********

7. spacer 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MH179474 (Aeromonas phage 62AhydR11PP, complete genome) position: , mismatch: 1, identity: 0.969

gccgagatgtcgcgggagcagaagcaggccat	CRISPR spacer
gccgagatgtcccgggagcagaagcaggccat	Protospacer
*********** ********************

8. spacer 2.34|530755|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MH179474 (Aeromonas phage 62AhydR11PP, complete genome) position: , mismatch: 1, identity: 0.969

gtgttgactgcccctgatgggctgtttggttt	CRISPR spacer
gtgttgactgcccctgacgggctgtttggttt	Protospacer
*****************.**************

9. spacer 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to KT898134 (Aeromonas phage phiARM81mr, complete genome) position: , mismatch: 1, identity: 0.969

ttaagcgggcgcttggtggtggtgttgaggta	CRISPR spacer
ttgagcgggcgcttggtggtggtgttgaggta	Protospacer
**.*****************************

10. spacer 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to KY290953 (Aeromonas phage 51, complete genome) position: , mismatch: 1, identity: 0.969

tatcaaggcgtcaccgtgccgcaggctacggc	CRISPR spacer
tatcaaggcatcaccgtgccgcaggctacggc	Protospacer
*********.**********************

11. spacer 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_019527 (Aeromonas phage vB_AsaM-56, complete genome) position: , mismatch: 1, identity: 0.969

tatcaaggcgtcaccgtgccgcaggctacggc	CRISPR spacer
tatcaaggcatcaccgtgccgcaggctacggc	Protospacer
*********.**********************

12. spacer 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to KY290954 (Aeromonas phage 56, complete genome) position: , mismatch: 1, identity: 0.969

tatcaaggcgtcaccgtgccgcaggctacggc	CRISPR spacer
tatcaaggcatcaccgtgccgcaggctacggc	Protospacer
*********.**********************

13. spacer 2.4|528954|33|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK813942 (Aeromonas phage 4_4512, complete genome) position: , mismatch: 2, identity: 0.939

caccgagaacggcatcccgatgaccatggttta	CRISPR spacer
aaccgaaaacggcatcccgatgaccatggttta	Protospacer
 *****.**************************

14. spacer 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to EU515217 (Aeromonas phage DH1 clone SEQDH5, genomic sequence) position: , mismatch: 2, identity: 0.938

gccgagatgtcgcgggagcagaagcaggccat	CRISPR spacer
gccgagatgtcacgggagcagaaacaggccat	Protospacer
***********.***********.********

15. spacer 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to KY290953 (Aeromonas phage 51, complete genome) position: , mismatch: 2, identity: 0.938

gccgagatgtcgcgggagcagaagcaggccat	CRISPR spacer
gccgagatgtcacgggagcagaagcaagccat	Protospacer
***********.**************.*****

16. spacer 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK804891 (Aeromonas phage 2_D05, complete genome) position: , mismatch: 2, identity: 0.938

gccgagatgtcgcgggagcagaagcaggccat	CRISPR spacer
gccgagatgtcacgggagcagaaacaggccat	Protospacer
***********.***********.********

17. spacer 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_019527 (Aeromonas phage vB_AsaM-56, complete genome) position: , mismatch: 2, identity: 0.938

gccgagatgtcgcgggagcagaagcaggccat	CRISPR spacer
gccgagatgtcacgggagcagaagcaagccat	Protospacer
***********.**************.*****

18. spacer 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to KY290954 (Aeromonas phage 56, complete genome) position: , mismatch: 2, identity: 0.938

gccgagatgtcgcgggagcagaagcaggccat	CRISPR spacer
gccgagatgtcacgggagcagaagcaagccat	Protospacer
***********.**************.*****

19. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to EU515217 (Aeromonas phage DH1 clone SEQDH5, genomic sequence) position: , mismatch: 2, identity: 0.938

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
tacggccatccgcacgggggttctcactgact	Protospacer
*************** ***** **********

20. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK804891 (Aeromonas phage 2_D05, complete genome) position: , mismatch: 2, identity: 0.938

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
tacggccatccgtaccggcgtgctcactgact	Protospacer
************.***** *************

21. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK804892 (Aeromonas phage 4_D05, complete genome) position: , mismatch: 2, identity: 0.938

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
tacggcaatccgtaccggggtgctcactgact	Protospacer
****** *****.*******************

22. spacer 2.49|531655|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK804891 (Aeromonas phage 2_D05, complete genome) position: , mismatch: 2, identity: 0.938

agaagcgcggcattgacaccctaaccgagatc	CRISPR spacer
agaagcgaggcattgacaccctgaccgagatc	Protospacer
******* **************.*********

23. spacer 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to EU515217 (Aeromonas phage DH1 clone SEQDH5, genomic sequence) position: , mismatch: 2, identity: 0.938

tatcaaggcgtcaccgtgccgcaggctacggc	CRISPR spacer
taccaaggcatcaccgtgccgcaggctacggc	Protospacer
**.******.**********************

24. spacer 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MH179474 (Aeromonas phage 62AhydR11PP, complete genome) position: , mismatch: 2, identity: 0.938

tatcaaggcgtcaccgtgccgcaggctacggc	CRISPR spacer
taccaaggcatcaccgtgccgcaggctacggc	Protospacer
**.******.**********************

25. spacer 2.49|531655|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MH179474 (Aeromonas phage 62AhydR11PP, complete genome) position: , mismatch: 3, identity: 0.906

agaagcgcggcattgacaccctaaccgagatc	CRISPR spacer
agaagcgcggaattgacaccctgaccgagatt	Protospacer
********** ***********.********.

26. spacer 2.49|531655|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK804892 (Aeromonas phage 4_D05, complete genome) position: , mismatch: 4, identity: 0.875

agaagcgcggcattgacaccctaaccgagatc	CRISPR spacer
agaagcgcggcattgacaccctgacagaggtg	Protospacer
**********************.** ***.* 

27. spacer 2.29|530455|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to KT070866 (Bacillus phage PBC4, complete genome) position: , mismatch: 5, identity: 0.844

tgaaaaatggtgatgaagtcata-cagctgatc	CRISPR spacer
tgaaaaacggtgatgaaatcatatcaactaat-	Protospacer
*******.*********.***** **.**.** 

28. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NC_019125 (Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence) position: , mismatch: 5, identity: 0.833

agctgggtgccggccagctgaccgccggac	CRISPR spacer
agtccggtgccggtcagcagaccgccggac	Protospacer
**.. ********.**** ***********

29. spacer 3.5|556716|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

gggtcggtgacggcgatctctctgccgtga	CRISPR spacer
gggtcggtgacggcgaactctctgcccatg	Protospacer
**************** *********   .

30. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 5, identity: 0.833

atgtcggccttggcgagaccttcgccgcca-	CRISPR spacer
gggtcggccttggcgagatcgtcg-cgccag	Protospacer
. ****************.* *** ***** 

31. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 5, identity: 0.833

atgtcggccttggcgagaccttcgccgcca-	CRISPR spacer
gggtcggccttggcgagatcgtcg-cgccag	Protospacer
. ****************.* *** ***** 

32. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 5, identity: 0.833

atgtcggccttggcgagaccttcgccgcca-	CRISPR spacer
gggtcggccttggcgagatcgtcg-cgccag	Protospacer
. ****************.* *** ***** 

33. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.833

atgtcggccttggcgagaccttcgccgcca-	CRISPR spacer
gggtcggccttggcgagatcgtcg-cgccag	Protospacer
. ****************.* *** ***** 

34. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.833

atgtcggccttggcgagaccttcgccgcca-	CRISPR spacer
gggtcggccttggcgagatcgtcg-cgccag	Protospacer
. ****************.* *** ***** 

35. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.833

atgtcggccttggcgagaccttcgccgcca-	CRISPR spacer
gggtcggccttggcgagatcgtcg-cgccag	Protospacer
. ****************.* *** ***** 

36. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.833

atgtcggccttggcgagaccttcgccgcca-	CRISPR spacer
gggtcggccttggcgagatcgtcg-cgccag	Protospacer
. ****************.* *** ***** 

37. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 6, identity: 0.8

agctgggtgccggccagctgaccgccggac	CRISPR spacer
cttgggttgcgggccagctgaccgccggac	Protospacer
  . ** *** *******************

38. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 6, identity: 0.8

agctgggtgccggccagctgacc--gccggac	CRISPR spacer
agctgcgtgccggcccgctgaccgagcttg--	Protospacer
***** ********* *******  **. *  

39. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 6, identity: 0.8

agctgggtgccggccagctgacc--gccggac	CRISPR spacer
agctgcgtgccggcccgctgaccgagcttg--	Protospacer
***** ********* *******  **. *  

40. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NC_015728 (Roseobacter litoralis Och 149 plasmid pRLO149_83, complete sequence) position: , mismatch: 6, identity: 0.8

agctgggtgccggccagctgaccgccggac	CRISPR spacer
atccgcatgccgaccacctgaccgccggac	Protospacer
* *.* .*****.*** *************

41. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013915 (Serratia fonticola strain GS2 plasmid pSF002, complete sequence) position: , mismatch: 6, identity: 0.8

agctgggtgccggccagctgaccgccggac	CRISPR spacer
atctctatgccggccagctggccgccgggc	Protospacer
* **  .*************.*******.*

42. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

43. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

44. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

45. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

46. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

47. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

48. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

49. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

50. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

51. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

52. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

53. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtagagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

54. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

55. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 6, identity: 0.8

agataggtcagggcgacgcctgggccctga	CRISPR spacer
agctggtggagcgcgacgcctgggccctga	Protospacer
** *.*   ** ******************

56. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_JX627582 (Methylobacterium oryzae CBMB20 plasmid pMOC3, complete sequence) position: , mismatch: 6, identity: 0.8

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ctcctggccttcgcgagaccttcggcgcca	Protospacer
 * ..****** ************ *****

57. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP015370 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p3, complete sequence) position: , mismatch: 6, identity: 0.8

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ctcctggccttcgcgagaccttcggcgcca	Protospacer
 * ..****** ************ *****

58. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to LZ998060 (JP 2017534684-A/7: Phage Therapy) position: , mismatch: 6, identity: 0.8

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ataccggccttggcgcgacctacgccgcgc	Protospacer
**..*********** ***** ******  

59. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NC_028879 (Pseudomonas phage PaMx42, complete genome) position: , mismatch: 6, identity: 0.8

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ataccggccttggcgcgacctacgccgcgc	Protospacer
**..*********** ***** ******  

60. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to LQ277712 (Sequence 7 from Patent WO2016071503) position: , mismatch: 6, identity: 0.8

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ataccggccttggcgcgacctacgccgcgc	Protospacer
**..*********** ***** ******  

61. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to LC581504 (Staphylococcus phage vB_PaeS-Yazdi-M DNA, complete genome) position: , mismatch: 6, identity: 0.8

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ataccggccttggcgcgacctacgccgcgc	Protospacer
**..*********** ***** ******  

62. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to LC552830 (Pseudomonas phage vB_PaeS-Yazdi-M DNA, complete genome) position: , mismatch: 6, identity: 0.8

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ataccggccttggcgcgacctacgccgcgc	Protospacer
**..*********** ***** ******  

63. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 6, identity: 0.8

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgttggccttggcgaaaccttcgatgcga	Protospacer
 ***.***********.******* .** *

64. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 6, identity: 0.8

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgttggccttggcgaaaccttcgatgcga	Protospacer
 ***.***********.******* .** *

65. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.8

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
atcgcatccttggcgagacctccgccgcga	Protospacer
**  *. **************.****** *

66. spacer 2.13|529495|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MN103543 (Pseudomonas phage vB_PaeM_PS119XW, complete genome) position: , mismatch: 7, identity: 0.781

tcaaagccatcaaatcgaatcacttatggtta	CRISPR spacer
gcaacgccagcaaatcgaatcacttgggcttg	Protospacer
 *** **** ***************. * **.

67. spacer 2.13|529495|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 7, identity: 0.781

tcaaagccatcaaatcgaatcacttatggtta	CRISPR spacer
gcaacgccagcaaatcgaatcacttgggcttg	Protospacer
 *** **** ***************. * **.

68. spacer 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK967377 (Gordonia phage MagicMan, complete genome) position: , mismatch: 7, identity: 0.781

gccgagatgtcgcgggagcagaag-caggccat	CRISPR spacer
accgagacgtggcgggagcagaagacccgccg-	Protospacer
.******.** ************* *  ***. 

69. spacer 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MN813694 (Gordonia phage Opie, complete genome) position: , mismatch: 7, identity: 0.781

gccgagatgtcgcgggagcagaag-caggccat	CRISPR spacer
accgagacgtggcgggagcagaagacccgccg-	Protospacer
.******.** ************* *  ***. 

70. spacer 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_031255 (Gordonia phage Schwabeltier, complete genome) position: , mismatch: 7, identity: 0.781

gccgagatgtcgcgggagcagaag-caggccat	CRISPR spacer
accgagacgtggcgggagcagaagacccgccg-	Protospacer
.******.** ************* *  ***. 

71. spacer 2.28|530395|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MN703409 (Arthrobacter phage LittleTokyo, complete genome) position: , mismatch: 7, identity: 0.781

-acaagcgattctgtgcgctctgcgcttgaaga	CRISPR spacer
cacata-gattctctgcgctctgcgcatgaggc	Protospacer
 *** . ****** ************ ***.* 

72. spacer 2.31|530575|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

atcgagcttgtccaggtggcgcatgaggatcc	CRISPR spacer
atcgagcttgtccaggtgttgcatgccgttga	Protospacer
****************** .*****  * *  

73. spacer 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to LN713927 (Pseudomonas fluorescens SBW25 plasmid pQBR55, complete sequence) position: , mismatch: 7, identity: 0.781

ttaagcgggcgcttggtggtggtgttgaggta	CRISPR spacer
ttgcgtgctcgcttggtgatggttttgaggta	Protospacer
**. *.*  *********.**** ********

74. spacer 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 7, identity: 0.781

gacagcgcagagcgtccggaagcgcttggccc	CRISPR spacer
ggcagcgccgagcgtccggatgcgctcgatgc	Protospacer
*.****** *********** *****.*.. *

75. spacer 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 7, identity: 0.781

gacagcgcagagcgtccggaagcgcttggccc	CRISPR spacer
gagatggaagagcggctggaagcgcttggcct	Protospacer
** *  * ****** *.**************.

76. spacer 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 7, identity: 0.781

gacagcgcagagcgtccggaagcgcttggccc	CRISPR spacer
gagatggaagagcggctggaagcgcttggcct	Protospacer
** *  * ****** *.**************.

77. spacer 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 7, identity: 0.781

gacagcgcagagcgtccggaagcgcttggccc	CRISPR spacer
gagatggaagagcggctggaagcgcttggcct	Protospacer
** *  * ****** *.**************.

78. spacer 2.44|531355|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

aacacaatgaagcgggcggctgatgctctggg	CRISPR spacer
aacaaaatgaaccgggcggctgatgcggatcg	Protospacer
**** ****** **************     *

79. spacer 2.53|531895|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT994838 (Klebsiella variicola isolate CNR130 plasmid CNR130, complete sequence) position: , mismatch: 7, identity: 0.781

aattggaaatagtgctcatcgcggcgcattcc	CRISPR spacer
cagcggaaatagggctcaccgcggcgcacgcc	Protospacer
 * .******** *****.*********. **

80. spacer 2.53|531895|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT994833 (Klebsiella pneumoniae isolate CNR341 plasmid CNR341, complete sequence) position: , mismatch: 7, identity: 0.781

aattggaaatagtgctcatcgcggcgcattcc	CRISPR spacer
cagcggaaatagggctcaccgcggcgcacgcc	Protospacer
 * .******** *****.*********. **

81. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP042262 (Litoreibacter sp. LN3S51 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

agctgggtgccggccagctgaccgccggac	CRISPR spacer
tgatcagtgccggacagctgaccgtcggaa	Protospacer
 * * .******* **********.**** 

82. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP045736 (Aeromicrobium sp. MF47 plasmid p001, complete sequence) position: , mismatch: 7, identity: 0.767

agctgggtgccggccagctgaccgccggac	CRISPR spacer
agacgggtgccgtccagcagaccgccgtcg	Protospacer
** .******** ***** ********   

83. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 7, identity: 0.767

agataggtcagggcgacgcctgggccctga	CRISPR spacer
aactggtggagcgcgacgcctgggccctga	Protospacer
*. *.*   ** ******************

84. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767

agataggtcagggcgacgcctgggccctga	CRISPR spacer
aactggtggagcgcgacgcctgggccctga	Protospacer
*. *.*   ** ******************

85. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_LC066384 (Aureimonas sp. AU12 plasmid pAU12rrn, complete sequence) position: , mismatch: 7, identity: 0.767

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
atccggaccttggcgagtccttcgccgctt	Protospacer
** . *.********** **********. 

86. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 7, identity: 0.767

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
tggacggcctgcgcgagaccttcgccgtct	Protospacer
  * ******  ***************.* 

87. spacer 2.1|528774|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to KM879463 (Arthrobacter phage vB_ArtM-ArV1, complete genome) position: , mismatch: 8, identity: 0.75

agtctggccgcgccgccctggttacctataac	CRISPR spacer
tggctggccccgccgccctgattaccgccacc	Protospacer
 * ****** **********.*****  .* *

88. spacer 2.5|529015|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

-----ttggcgatatggcattgcccctgatggcgtcc	CRISPR spacer
gctcgttg-----ctggcattgccactgatggcggcc	Protospacer
     ***      ********** ********* **

89. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gtcgaatttgacgccctgagccagtgggagtt	Protospacer
*****.*************** **  * ...*

90. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

91. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

92. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

93. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

94. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

95. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

96. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

97. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

98. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

99. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044333 (Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gtcgagattgacggcctgagcgatctgcgctg	Protospacer
****** ****** *********  .*** . 

100. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

101. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

102. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

103. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

104. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

105. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

106. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

107. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

108. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctcccgt	Protospacer
*. ************* * ******* *   *

109. spacer 2.26|530275|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.75

aaccaaaccggccccaccaggcgcagcaagat	CRISPR spacer
acactcgccgggcccaccacgcgcagcaagaa	Protospacer
*  *  .**** ******* *********** 

110. spacer 2.26|530275|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.75

aaccaaaccggccccaccaggcgcagcaagat	CRISPR spacer
acactcgccgggcccaccacgcgcagcaagaa	Protospacer
*  *  .**** ******* *********** 

111. spacer 2.26|530275|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 8, identity: 0.75

aaccaaaccggccccaccaggcgcagcaagat	CRISPR spacer
aaccaaaccggcggcaccaggcgtcgactgac	Protospacer
************  *********. *   **.

112. spacer 2.26|530275|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

aaccaaaccggccccaccaggcgcagcaagat	CRISPR spacer
cacagcaccgccaccaccaggcgcagcaacac	Protospacer
 ** . **** * **************** *.

113. spacer 2.28|530395|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MT889373 (Arthrobacter phage Brynnie, complete genome) position: , mismatch: 8, identity: 0.75

acaagc-gattctgtgcgctctgcgcttgaaga	CRISPR spacer
-catctagattctctgcgctctgcgcatgaggc	Protospacer
 **  . ****** ************ ***.* 

114. spacer 2.28|530395|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MF140397 (Arthrobacter phage Abidatro, complete genome) position: , mismatch: 8, identity: 0.75

acaagc-gattctgtgcgctctgcgcttgaaga	CRISPR spacer
-catctagattctctgcgctctgcgcatgaggc	Protospacer
 **  . ****** ************ ***.* 

115. spacer 2.30|530515|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034087 (Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence) position: , mismatch: 8, identity: 0.75

atctgctatgtgatgggcggccgcatcc-tgta	CRISPR spacer
aagctctatgggatcggcggccgcatccgcgt-	Protospacer
*  . ***** *** ************* .** 

116. spacer 2.31|530575|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK411746 (Arthrobacter phage Sonali, complete genome) position: , mismatch: 8, identity: 0.75

atcgagcttgtccaggtggcgcatgaggatcc	CRISPR spacer
gtgggcctggaccaggtggcgcatgaggagct	Protospacer
.* *. ** * ****************** *.

117. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 8, identity: 0.75

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
cccggccatccgcacccggctgctctcgggcg	Protospacer
. ************** ** ***** * *.* 

118. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 8, identity: 0.75

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
cccggccatccgcacccggctgctctcgggcg	Protospacer
. ************** ** ***** * *.* 

119. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 8, identity: 0.75

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
cccggccatccgcacccggctgctctcgggcg	Protospacer
. ************** ** ***** * *.* 

120. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 8, identity: 0.75

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
cccggccatccgcacccggctgctctcgggcg	Protospacer
. ************** ** ***** * *.* 

121. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 8, identity: 0.75

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
cccggccatccgcacccggctgctctcgggcg	Protospacer
. ************** ** ***** * *.* 

122. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
cccggccatccgcacccggttgctctccggcg	Protospacer
. ************** ** ***** *.*.* 

123. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 8, identity: 0.75

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
cccggccatccgcacccggctgctctcgggcg	Protospacer
. ************** ** ***** * *.* 

124. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 8, identity: 0.75

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
cccggccatccgcacccggctgctctcgggcg	Protospacer
. ************** ** ***** * *.* 

125. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 8, identity: 0.75

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
cccggccatccgcacccggctgctctcgggcg	Protospacer
. ************** ** ***** * *.* 

126. spacer 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.75

ttaagcgggcgcttggtggtggtgttgaggta	CRISPR spacer
atcagcaggcgcttggtggtggcgttggcgcc	Protospacer
 * ***.***************.****. *. 

127. spacer 2.50|531715|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018464 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence) position: , mismatch: 8, identity: 0.75

aagaccaactcggtcaaccgggatcaggcgat	CRISPR spacer
actctcaacacggtctaccgggatcaggcgtg	Protospacer
*   .**** ***** **************  

128. spacer 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022727 (Erwinia persicina strain B64 plasmid pEP2, complete sequence) position: , mismatch: 8, identity: 0.75

tatcaaggcgtcaccgtgccgcaggctacggc	CRISPR spacer
gaagccggcgtcaccgtgcagcaggctaccga	Protospacer
 *    ************* ********* * 

129. spacer 2.54|531955|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006371 (Aureimonas sp. AU20 plasmid pAU20d, complete sequence) position: , mismatch: 8, identity: 0.75

tatcaaggcgtcaccgtgccgcaggctacggc	CRISPR spacer
gagcagccggtcatcgtgccgcagggtacggc	Protospacer
 * **.   ****.*********** ******

130. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP019032 (Lactobacillus fermentum strain SNUV175 plasmid pSNU175-3, complete sequence) position: , mismatch: 8, identity: 0.733

agctgggtgccggccagctgaccgccggac	CRISPR spacer
ggctgggtgccggccaactgacacaagcat	Protospacer
.***************.*****    * *.

131. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NC_006529 (Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence) position: , mismatch: 8, identity: 0.733

agctgggtgccggccagctgaccgccggac	CRISPR spacer
ggctgggtgccggccaactgacacaagcat	Protospacer
.***************.*****    * *.

132. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 8, identity: 0.733

agctgggtgccggccagctgaccgccggac	CRISPR spacer
gaccgggtgccggccacctgatcgccgata	Protospacer
..*.************ ****.*****.  

133. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 8, identity: 0.733

agctgggtgccggccagctgaccgccggac	CRISPR spacer
tggaacgcgcctgccagctgaccgccggag	Protospacer
 *  . *.*** ***************** 

134. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

agctgggtgccggccagctgaccgccggac	CRISPR spacer
gtgccggtgccggccagctgacggcccgtc	Protospacer
.  . ***************** *** * *

135. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to KR063281 (Gordonia phage GMA2, complete genome) position: , mismatch: 8, identity: 0.733

agctgggtgccggccagctgaccgccggac	CRISPR spacer
tcgtttctgactgccagctgaccgccggac	Protospacer
   *   ** * ******************

136. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 8, identity: 0.733

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
cactgcgcaatggcaacgtgcaggccatta	Protospacer
 .  * ********** ***********. 

137. spacer 3.4|556659|30|NZ_CP021654|CRISPRCasFinder matches to MH643778 (Pseudomonas phage YMC12/01/R24, complete genome) position: , mismatch: 8, identity: 0.733

agattggccggggtgatacccaggcgctgc	CRISPR spacer
gccttctccggggtgatccccaggcgctcg	Protospacer
.  **  ********** **********  

138. spacer 3.4|556659|30|NZ_CP021654|CRISPRCasFinder matches to MT613935 (Pseudomonas phage Persinger, complete genome) position: , mismatch: 8, identity: 0.733

agattggccggggtgatacccaggcgctgc	CRISPR spacer
tcgtctgccggggtgatgaccaggcgctgg	Protospacer
  .*. ***********. ********** 

139. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

agataggtcagggcgacgcctgggccctga	CRISPR spacer
ccctctgtcagggcgacgcccgggcgctgg	Protospacer
   *  **************.**** ***.

140. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

141. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

142. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

143. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

144. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

145. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

146. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

147. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

148. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

149. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

150. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

151. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

152. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ttgtcggacttggcgagaccttcttcatgg	Protospacer
 ****** *************** .*.. .

153. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
tcacctgcctgggcgagaccttcgccgcgc	Protospacer
 ...* **** *****************  

154. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
ccggcggccttggcgtgaccttcgacgagc	Protospacer
 .* *********** ******** **   

155. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.733

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
tcgtcggcctgggcgagaccttctacgggg	Protospacer
 .******** ************  **  .

156. spacer 2.1|528774|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.719

agtctggccgcgccgccctggttacctataac	CRISPR spacer
ccgtcggccgcgccgcccgggttacccatgtc	Protospacer
   ..************* *******.**. *

157. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctgccgt	Protospacer
*. ************* * *******     *

158. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
gcggagtttgacgcccggcgcgaggctgccgt	Protospacer
*. ************* * *******     *

159. spacer 2.8|529195|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgagtttgacgccctgagcgaggcgcgact	CRISPR spacer
ggcgagttggacgccctgcgcgaggagatgga	Protospacer
* ****** ********* ****** *  .  

160. spacer 2.14|529555|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MK448905 (Streptococcus phage Javan318, complete genome) position: , mismatch: 9, identity: 0.719

ttagtcagctagagcttcagtctcagctgatt	CRISPR spacer
aaaatcagcgagagcttcagtcttagcagcgc	Protospacer
  *.***** *************.*** *  .

161. spacer 2.24|530155|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to KC292021 (Halovirus HRTV-7, complete genome) position: , mismatch: 9, identity: 0.719

gccgagatgtcgcgggagcagaagcaggccat	CRISPR spacer
tccgagatgtcacgggagccgaaggcgtcgcg	Protospacer
 **********.******* ****  * *   

162. spacer 2.30|530515|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719

atctgctatgtgatgggcggccgcatcctgta	CRISPR spacer
gccctcgatgtgatcgccggccgcatcctggc	Protospacer
..*. * ******* * *************  

163. spacer 2.36|530875|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 9, identity: 0.719

aagacaggcattccattcttcgagatgggatt	CRISPR spacer
ttcgcgggcattctcttcttcgagatgggacg	Protospacer
   .*.*******. ***************. 

164. spacer 2.37|530935|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 9, identity: 0.719

agcttgcattggcctcatcaaggccgtgactg	CRISPR spacer
cgatgttgatggcctgatcgaggccgtgactg	Protospacer
 * *  .. ****** ***.************

165. spacer 2.39|531055|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gctcagcaggaaagcgcgctgtgggtgatcaa	CRISPR spacer
aagaagaccgaaagcgcgctgcggctgatcaa	Protospacer
.   **   ************.** *******

166. spacer 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 9, identity: 0.719

ttaag---cgggcgcttggtggtggtgttgaggta	CRISPR spacer
---agctccgggcgcttcgtggtgatgttgaccag	Protospacer
   **   ********* ******.******   .

167. spacer 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 9, identity: 0.719

ttaagcgggcgcttggtggtggtgttgaggta	CRISPR spacer
atcagctggcgcttggtggtgctgttcttctt	Protospacer
 * *** ************** ****    * 

168. spacer 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018684 (Vibrio harveyi isolate QT520 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

ttaagcgggcgcttggtggtggtgttgaggta	CRISPR spacer
tcttgattgcgctttgtggtggttttgaggtt	Protospacer
*.  *   ****** ******** ******* 

169. spacer 2.40|531115|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 9, identity: 0.719

ttaagcgggcgcttggtggtggtgttgaggta	CRISPR spacer
ttctcgacacgcttcgtggtcgtgttgaggta	Protospacer
**    . .***** ***** ***********

170. spacer 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagcgcagagcgtccggaagcgcttggccc	CRISPR spacer
tccagcgcagggcgaccggaagcgcggccgcc	Protospacer
  ********.*** **********     **

171. spacer 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to MN694443 (Marine virus AFVG_250M280, complete genome) position: , mismatch: 9, identity: 0.719

gacagcgcagagcgtccggaagcgcttggccc	CRISPR spacer
ttcaacgcagagcgtccgtaagcgcaaccccg	Protospacer
  **.************* ******    ** 

172. spacer 2.47|531535|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017296 (Nostoc sp. NIES-3756 plasmid pNOS3756_1, complete sequence) position: , mismatch: 9, identity: 0.719

tgccagagtggtggcatgtgttttgacacgta	CRISPR spacer
agtaagagtgctggcaagtgttttgacgattt	Protospacer
 *. ****** ***** **********.  * 

173. spacer 3.1|556476|30|NZ_CP021654|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 9, identity: 0.7

agctgggtgccggccagctgaccgccggac	CRISPR spacer
gggccagtgccggccagctgatcgccgcca	Protospacer
.* . .***************.*****   

174. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcctgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

175. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcccgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

176. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcctgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

177. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcctgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

178. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcctgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

179. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcccgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

180. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcccgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

181. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcctgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

182. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcctgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

183. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcctgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

184. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcctgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

185. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcctgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

186. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
tcgcctgtcatggcaaggtgcaggccgtcc	Protospacer
  .   *. *****************.***

187. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
ttcagggcaatggcaagctgcaggtggtga	Protospacer
   ************** ******. .*  

188. spacer 3.3|556602|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 9, identity: 0.7

agaagggcaatggcaaggtgcaggccatcc	CRISPR spacer
ttcagggcaatggcaagctgcaggtggtga	Protospacer
   ************** ******. .*  

189. spacer 3.5|556716|30|NZ_CP021654|CRISPRCasFinder matches to MG298964 (Streptomyces phage Alsaber, complete genome) position: , mismatch: 9, identity: 0.7

gggtcggtgacggcgatctctctgccgtga	CRISPR spacer
ccctcggtgacagcgatctcgctgccagct	Protospacer
   ********.******** *****.   

190. spacer 3.5|556716|30|NZ_CP021654|CRISPRCasFinder matches to MT711979 (Streptomyces phage Endor2, complete genome) position: , mismatch: 9, identity: 0.7

gggtcggtgacggcgatctctctgccgtga	CRISPR spacer
ccctcggtgacagcgatctcgctgccagct	Protospacer
   ********.******** *****.   

191. spacer 3.5|556716|30|NZ_CP021654|CRISPRCasFinder matches to MT711978 (Streptomyces phage Endor1, complete genome) position: , mismatch: 9, identity: 0.7

gggtcggtgacggcgatctctctgccgtga	CRISPR spacer
ccctcggtgacagcgatctcgctgccagct	Protospacer
   ********.******** *****.   

192. spacer 3.5|556716|30|NZ_CP021654|CRISPRCasFinder matches to KT186229 (Streptomyces phage Verse, complete genome) position: , mismatch: 9, identity: 0.7

gggtcggtgacggcgatctctctgccgtga	CRISPR spacer
ccctcggtgacagcgatctcgctgccagct	Protospacer
   ********.******** *****.   

193. spacer 3.5|556716|30|NZ_CP021654|CRISPRCasFinder matches to KX815338 (Streptomyces phage Joe, complete genome) position: , mismatch: 9, identity: 0.7

gggtcggtgacggcgatctctctgccgtga	CRISPR spacer
ccctcggtgacagcgatctcgctgccagct	Protospacer
   ********.******** *****.   

194. spacer 3.5|556716|30|NZ_CP021654|CRISPRCasFinder matches to KT186228 (Streptomyces phage Amela, complete genome) position: , mismatch: 9, identity: 0.7

gggtcggtgacggcgatctctctgccgtga	CRISPR spacer
ccctcggtgacagcgatctcgctgccagct	Protospacer
   ********.******** *****.   

195. spacer 3.5|556716|30|NZ_CP021654|CRISPRCasFinder matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 9, identity: 0.7

gggtcggtgacggcgatctctctgccgtga	CRISPR spacer
ccctcggtgacagcgatctcgctgccagct	Protospacer
   ********.******** *****.   

196. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

agataggtcagggcgacgcctgggccctga	CRISPR spacer
tcggtgatcagggcgacgcctaggcccttg	Protospacer
  .  *.**************.****** .

197. spacer 2.31|530575|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 10, identity: 0.688

atcgagcttgtccaggtggcgcatgaggatcc	CRISPR spacer
ggggagcttgtccaggtgccacatgacacggc	Protospacer
.  *************** *.***** .   *

198. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
gccggccatccgcaccgaggtgatcgaacgca	Protospacer
  ***************.**** **.   .* 

199. spacer 2.33|530695|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 10, identity: 0.688

tacggccatccgcaccggggtgctcactgact	CRISPR spacer
gccggccatccgcaccgaggtgatcgagcgca	Protospacer
  ***************.**** **.   .* 

200. spacer 2.46|531475|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.688

agagaatatgcggagacgatccagcgcatcga	CRISPR spacer
atccgggatgcggacgcgatccagcgcatcct	Protospacer
*   .. ******* .**************  

201. spacer 5.1|557115|30|NZ_CP021654|CRISPRCasFinder matches to NZ_CP049160 (Caballeronia sp. SBC1 plasmid pSBC1_4, complete sequence) position: , mismatch: 10, identity: 0.667

atgtcggccttggcgagaccttcgccgcca	CRISPR spacer
gccatttccttggcgcgaccttcgccgcgc	Protospacer
..  .  ******** ************  

202. spacer 2.7|529135|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

agtcgatgttcatcttgttgctggaatattct	CRISPR spacer
cgtcgatgcgcatcttgttgctggccagcagc	Protospacer
 *******. **************   ..  .

203. spacer 2.7|529135|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

agtcgatgttcatcttgttgctggaatattct	CRISPR spacer
cgtcgatgcgcatcttgttgctggccagcagc	Protospacer
 *******. **************   ..  .

204. spacer 2.7|529135|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

agtcgatgttcatcttgttgctggaatattct	CRISPR spacer
cgtcgatgcgcatcttgttgctggccagcagc	Protospacer
 *******. **************   ..  .

205. spacer 2.7|529135|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

agtcgatgttcatcttgttgctggaatattct	CRISPR spacer
cgtcgatgcgcatcttgttgctggccagcagc	Protospacer
 *******. **************   ..  .

206. spacer 2.41|531175|32|NZ_CP021654|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 11, identity: 0.656

gacagcgcagagcgtccggaagcgcttggccc	CRISPR spacer
tttgtcgcagatcgtccggatgcgcttgaaat	Protospacer
  .. ****** ******** *******.  .

207. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to MT952845 (Microbacterium phage GardenState, complete genome) position: , mismatch: 14, identity: 0.533

agataggtcagggcgacgcctgggccctga-------	CRISPR spacer
-------tgagggccccggcgacgccctgaccggcgc	Protospacer
       * *****  ** * . *******       

208. spacer 4.1|556887|30|NZ_CP021654|CRISPRCasFinder matches to MK880124 (Microbacterium phage IAmGroot, complete genome) position: , mismatch: 14, identity: 0.533

agataggtcagggcgacgcctgggccctga-------	CRISPR spacer
-------tgagggccccggcgacgccctgaccggcgc	Protospacer
       * *****  ** * . *******       

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 758787 : 853210 100 Aeromonas_virus(68.89%) portal,tail,head,capsid,holin,terminase,integrase,plate,tRNA attL 806634:806693|attR 843481:843592
DBSCAN-SWA_2 1803085 : 1848611 37 uncultured_Mediterranean_phage(15.38%) protease,plate,tRNA NA
DBSCAN-SWA_3 2824603 : 2833258 8 Escherichia_phage(14.29%) tRNA,transposase NA
DBSCAN-SWA_4 4730952 : 4740894 10 uncultured_Mediterranean_phage(25.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage