Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021714 Klebsiella pneumoniae strain AR_0129 plasmid tig00000001, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP021718 Klebsiella pneumoniae strain AR_0129, complete genome 3 crisprs DinG,RT,cas3,csa3,DEDDh,WYL 0 1 396 0
NZ_CP021713 Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence 0 crisprs cas3,RT,csa3 0 0 1 0
NZ_CP021715 Klebsiella pneumoniae strain AR_0129 plasmid tig00000002, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP021716 Klebsiella pneumoniae strain AR_0129 plasmid tig00000003, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP021717 Klebsiella pneumoniae strain AR_0129 plasmid tig00000004, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP021718
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021718_1 364971-365048 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021718_2 4914124-4914209 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021718_3 5398095-5398190 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021718_3 3.1|5398125|36|NZ_CP021718|CRISPRCasFinder 5398125-5398160 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP021718_3 3.1|5398125|36|NZ_CP021718|CRISPRCasFinder 5398125-5398160 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP021718_3 3.1|5398125|36|NZ_CP021718|CRISPRCasFinder 5398125-5398160 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 3.1|5398125|36|NZ_CP021718|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

2. spacer 3.1|5398125|36|NZ_CP021718|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

3. spacer 3.1|5398125|36|NZ_CP021718|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 13435 14 Cronobacter_phage(25.0%) NA NA
DBSCAN-SWA_2 17902 : 20021 3 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_3 31494 : 32415 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_4 38638 : 41963 2 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_5 50204 : 56005 5 Amsacta_moorei_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_6 62627 : 63425 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_7 78207 : 79323 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_8 122225 : 124940 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_9 129473 : 130836 1 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_10 135343 : 140023 5 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_11 143093 : 144621 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_12 149178 : 155092 4 Catovirus(50.0%) holin NA
DBSCAN-SWA_13 161795 : 163340 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_14 174732 : 179473 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_15 191815 : 196236 5 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_16 213347 : 227062 12 Cedratvirus(20.0%) NA NA
DBSCAN-SWA_17 230197 : 232268 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_18 236358 : 237019 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_19 241897 : 244384 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_20 251428 : 259394 5 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_21 265398 : 266445 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_22 270485 : 272150 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_23 276903 : 280705 2 Vibrio_phage(50.0%) tRNA NA
DBSCAN-SWA_24 285393 : 286167 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_25 292993 : 300423 6 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_26 306232 : 307024 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_27 331347 : 334858 4 Vibriophage(33.33%) NA NA
DBSCAN-SWA_28 339219 : 345742 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_29 350587 : 351322 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_30 361414 : 367037 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_31 370840 : 371563 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_32 378060 : 378966 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_33 389133 : 390873 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_34 396078 : 404043 8 Micromonas_pusilla_virus(20.0%) NA NA
DBSCAN-SWA_35 408117 : 413269 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_36 417270 : 418647 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_37 421656 : 423249 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_38 431228 : 433661 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_39 437904 : 439764 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_40 451469 : 453469 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_41 458544 : 510030 60 Salmonella_phage(73.33%) head,lysis,terminase,tail,plate,capsid,integrase,portal attL 458452:458470|attR 495952:495970
DBSCAN-SWA_42 513130 : 517480 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_43 530296 : 560427 22 uncultured_Mediterranean_phage(13.33%) tRNA,protease NA
DBSCAN-SWA_44 564477 : 565566 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_45 569739 : 574282 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_46 591645 : 594718 2 Enterobacteria_phage(50.0%) tRNA NA
DBSCAN-SWA_47 600801 : 605924 3 Agrobacterium_phage(33.33%) NA NA
DBSCAN-SWA_48 614689 : 616597 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_49 629316 : 631371 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_50 636313 : 636973 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_51 661111 : 664630 4 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_52 681194 : 682253 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_53 690172 : 690700 1 Infectious_spleen_and_kidney_necrosis_virus(100.0%) NA NA
DBSCAN-SWA_54 699051 : 699972 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_55 703213 : 703465 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_56 722620 : 723802 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_57 727081 : 727723 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_58 747447 : 753513 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_59 757945 : 759082 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_60 765647 : 864652 102 Klebsiella_phage(40.0%) head,terminase,tail,portal,holin,capsid,integrase,tRNA attL 768170:768185|attR 793429:793444
DBSCAN-SWA_61 867926 : 868781 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_62 872465 : 873719 1 Artogeia_rapae_granulovirus(100.0%) NA NA
DBSCAN-SWA_63 879411 : 883470 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_64 887344 : 893358 4 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_65 898660 : 899293 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_66 905350 : 906571 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_67 913254 : 914082 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_68 920346 : 926080 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_69 933374 : 934052 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_70 946296 : 949254 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_71 956373 : 961739 5 Chrysochromulina_ericina_virus(50.0%) protease NA
DBSCAN-SWA_72 966579 : 967182 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_73 972772 : 974707 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_74 979337 : 981141 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_75 1011818 : 1017257 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_76 1025243 : 1030269 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_77 1059195 : 1060209 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_78 1067816 : 1074963 7 Escherichia_phage(40.0%) tRNA NA
DBSCAN-SWA_79 1080081 : 1081071 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_80 1107251 : 1111889 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_81 1120575 : 1121781 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_82 1133955 : 1137483 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_83 1150303 : 1151605 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_84 1162848 : 1163364 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_85 1182709 : 1185487 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_86 1194930 : 1195890 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_87 1213014 : 1217029 5 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_88 1221136 : 1225273 4 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_89 1230411 : 1231086 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_90 1237151 : 1238132 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_91 1241429 : 1257324 15 Escherichia_phage(70.0%) NA NA
DBSCAN-SWA_92 1261475 : 1262981 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_93 1266227 : 1266602 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_94 1278550 : 1279312 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_95 1284759 : 1286133 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_96 1299167 : 1299959 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_97 1310452 : 1311832 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_98 1337622 : 1338798 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_99 1346160 : 1347717 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_100 1355012 : 1355786 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_101 1369849 : 1370368 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_102 1383780 : 1384563 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_103 1395714 : 1396638 1 Enterobacteria_phage(100.0%) transposase NA
DBSCAN-SWA_104 1400302 : 1401355 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_105 1416956 : 1417694 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_106 1424920 : 1425844 1 Enterobacteria_phage(100.0%) transposase NA
DBSCAN-SWA_107 1449955 : 1451212 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_108 1457152 : 1461269 4 Pithovirus(50.0%) NA NA
DBSCAN-SWA_109 1465404 : 1467485 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_110 1473174 : 1475460 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_111 1484006 : 1484687 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_112 1495271 : 1496812 2 Stx_converting_phage(50.0%) transposase NA
DBSCAN-SWA_113 1501683 : 1504020 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_114 1509869 : 1514605 4 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_115 1518193 : 1519810 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_116 1531081 : 1531855 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_117 1538334 : 1539834 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_118 1545941 : 1547486 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_119 1552767 : 1553469 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_120 1561905 : 1562685 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_121 1573755 : 1575846 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_122 1591568 : 1592582 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_123 1599453 : 1601415 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_124 1611847 : 1614488 2 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_125 1621311 : 1623363 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_126 1628914 : 1630285 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_127 1641540 : 1642815 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_128 1646151 : 1647513 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_129 1651319 : 1652807 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_130 1656994 : 1657867 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_131 1661138 : 1672124 11 Enterobacteria_phage(20.0%) NA NA
DBSCAN-SWA_132 1677600 : 1678371 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_133 1683555 : 1685504 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_134 1699545 : 1700376 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_135 1710108 : 1749559 51 Salmonella_phage(42.22%) integrase,holin,tail,terminase attL 1726603:1726620|attR 1754339:1754356
DBSCAN-SWA_136 1757477 : 1763122 3 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_137 1775180 : 1775804 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_138 1780661 : 1781732 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_139 1801243 : 1802065 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_140 1805580 : 1806354 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_141 1817004 : 1818968 2 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_142 1826405 : 1827155 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_143 1837075 : 1840288 3 environmental_halophage(50.0%) NA NA
DBSCAN-SWA_144 1854780 : 1855542 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_145 1865551 : 1873520 7 Hokovirus(25.0%) NA NA
DBSCAN-SWA_146 1880586 : 1887755 8 Geobacillus_virus(25.0%) tRNA NA
DBSCAN-SWA_147 1897412 : 1900310 3 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_148 1908569 : 1914839 7 Citrobacter_phage(25.0%) NA NA
DBSCAN-SWA_149 1918852 : 1920388 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_150 1929747 : 1930536 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_151 1936047 : 1997223 61 Microcystis_virus(12.5%) plate,tRNA,transposase NA
DBSCAN-SWA_152 2001076 : 2003371 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_153 2019493 : 2020105 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_154 2035730 : 2043099 7 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_155 2047001 : 2048561 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_156 2056001 : 2056211 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_157 2061447 : 2063496 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_158 2071003 : 2077549 9 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_159 2084974 : 2086450 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_160 2090375 : 2106922 18 Tupanvirus(25.0%) tRNA NA
DBSCAN-SWA_161 2113860 : 2115375 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_162 2131983 : 2132736 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_163 2139337 : 2147781 8 Burkholderia_phage(40.0%) NA NA
DBSCAN-SWA_164 2166221 : 2171000 3 Stenotrophomonas_phage(50.0%) integrase attL 2160331:2160345|attR 2169820:2169834
DBSCAN-SWA_165 2184833 : 2185253 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_166 2191869 : 2192088 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_167 2196061 : 2196898 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_168 2212323 : 2220871 5 Pseudomonas_phage(25.0%) transposase NA
DBSCAN-SWA_169 2225368 : 2226268 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_170 2232979 : 2248042 12 Salmonella_phage(14.29%) NA NA
DBSCAN-SWA_171 2253790 : 2261415 7 Escherichia_phage(28.57%) NA NA
DBSCAN-SWA_172 2273988 : 2280862 5 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_173 2297982 : 2304889 6 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_174 2331908 : 2338962 7 Enterobacteria_phage(50.0%) tRNA NA
DBSCAN-SWA_175 2345496 : 2346051 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_176 2362075 : 2363596 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_177 2367360 : 2371267 3 Cellulophaga_phage(50.0%) NA NA
DBSCAN-SWA_178 2375666 : 2376521 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_179 2382229 : 2390201 8 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_180 2395956 : 2402043 5 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_181 2406279 : 2407287 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_182 2413652 : 2414813 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_183 2418733 : 2422131 3 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_184 2426270 : 2438401 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_185 2450567 : 2451521 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_186 2479547 : 2480147 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_187 2492549 : 2493323 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_188 2497614 : 2499132 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_189 2505574 : 2506711 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_190 2515193 : 2516279 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_191 2525394 : 2529977 5 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_192 2533247 : 2535694 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_193 2550184 : 2560111 9 Lactobacillus_phage(25.0%) NA NA
DBSCAN-SWA_194 2563719 : 2565844 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_195 2569197 : 2572774 5 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_196 2604665 : 2679865 81 Salmonella_phage(40.38%) tail,protease,terminase,holin,capsid,integrase,tRNA,transposase attL 2610307:2610324|attR 2677304:2677321
DBSCAN-SWA_197 2690185 : 2690617 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_198 2701129 : 2707450 8 Mycoplasma_phage(20.0%) NA NA
DBSCAN-SWA_199 2722697 : 2744765 19 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_200 2749665 : 2830274 87 Salmonella_phage(70.0%) head,lysis,tail,terminase,portal,tRNA,plate,capsid,integrase,coat,transposase attL 2794369:2794415|attR 2832136:2832182
DBSCAN-SWA_201 2845840 : 2847361 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_202 2869519 : 2870422 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_203 2875603 : 2880902 5 Lactobacillus_phage(25.0%) NA NA
DBSCAN-SWA_204 2895620 : 2903825 8 Vibrio_phage(20.0%) tRNA NA
DBSCAN-SWA_205 2909610 : 2910576 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_206 2937517 : 2938918 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_207 2949283 : 2950105 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_208 2961849 : 2967013 5 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_209 2970482 : 2976901 7 uncultured_Mediterranean_phage(40.0%) NA NA
DBSCAN-SWA_210 2979971 : 2982004 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_211 2990770 : 2996107 4 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_212 2999649 : 3005115 3 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_213 3012529 : 3013375 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_214 3023630 : 3024653 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_215 3031057 : 3031813 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_216 3043357 : 3045858 3 environmental_halophage(50.0%) tRNA NA
DBSCAN-SWA_217 3050803 : 3051628 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_218 3084279 : 3095959 6 Deep-sea_thermophilic_phage(25.0%) NA NA
DBSCAN-SWA_219 3101472 : 3113390 10 Cronobacter_phage(25.0%) NA NA
DBSCAN-SWA_220 3119368 : 3120379 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_221 3126093 : 3127221 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_222 3132984 : 3136455 3 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_223 3158424 : 3160104 2 Escherichia_phage(100.0%) integrase attL 3156290:3156304|attR 3166079:3166093
DBSCAN-SWA_224 3174578 : 3178710 4 uncultured_Caudovirales_phage(75.0%) NA NA
DBSCAN-SWA_225 3181788 : 3182808 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_226 3186776 : 3194678 7 Clostridium_phage(20.0%) tRNA NA
DBSCAN-SWA_227 3199374 : 3200808 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_228 3205383 : 3208257 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_229 3216200 : 3217433 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_230 3234686 : 3235481 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_231 3249236 : 3250391 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_232 3265265 : 3266348 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_233 3273894 : 3274875 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_234 3281574 : 3283110 4 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_235 3293504 : 3294872 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_236 3316426 : 3317182 1 Lactobacillus_prophage(100.0%) NA NA
DBSCAN-SWA_237 3323462 : 3324830 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_238 3329719 : 3331090 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_239 3350799 : 3360702 8 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_240 3364013 : 3365909 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_241 3370251 : 3377132 8 Erwinia_phage(25.0%) NA NA
DBSCAN-SWA_242 3382243 : 3383485 1 Sinorhizobium_phage(100.0%) tRNA NA
DBSCAN-SWA_243 3392778 : 3407138 13 Moraxella_phage(20.0%) tRNA NA
DBSCAN-SWA_244 3425216 : 3426596 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_245 3430867 : 3432355 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_246 3441918 : 3442890 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_247 3459913 : 3461059 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_248 3477165 : 3486863 12 Escherichia_phage(20.0%) NA NA
DBSCAN-SWA_249 3492556 : 3494488 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_250 3499902 : 3506521 4 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_251 3510785 : 3513662 2 Pandoravirus(50.0%) protease NA
DBSCAN-SWA_252 3520260 : 3521702 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_253 3525751 : 3538682 15 Bacillus_virus(16.67%) NA NA
DBSCAN-SWA_254 3542626 : 3543559 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_255 3551004 : 3602584 57 uncultured_Caudovirales_phage(68.75%) head,tail,protease,terminase,portal,capsid,integrase,tRNA attL 3586763:3586780|attR 3602758:3602775
DBSCAN-SWA_256 3618910 : 3620382 2 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_257 3640285 : 3643654 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_258 3651499 : 3661143 9 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_259 3672544 : 3673372 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_260 3688195 : 3691967 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_261 3704793 : 3707184 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_262 3710529 : 3711288 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_263 3715145 : 3717593 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_264 3735338 : 3737146 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_265 3740572 : 3742805 4 Anomala_cuprea_entomopoxvirus(66.67%) NA NA
DBSCAN-SWA_266 3750126 : 3755927 5 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_267 3759011 : 3763148 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_268 3769448 : 3773555 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_269 3779657 : 3780449 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_270 3788990 : 3791033 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_271 3834762 : 3840735 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_272 3845058 : 3846422 1 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_273 3853241 : 3855981 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_274 3861140 : 3862112 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_275 3865515 : 3867446 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_276 3871822 : 3872818 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_277 3878286 : 3879828 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_278 3887801 : 3889643 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_279 3905480 : 3914630 9 Rhizobium_phage(20.0%) NA NA
DBSCAN-SWA_280 3927398 : 3932140 7 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_281 3935599 : 3936517 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_282 3941559 : 3949849 7 Acanthamoeba_polyphaga_mimivirus(25.0%) NA NA
DBSCAN-SWA_283 3960830 : 3961682 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_284 3964816 : 3966208 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_285 3979467 : 3980517 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_286 3997777 : 3998941 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_287 4017376 : 4018489 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_288 4030666 : 4036105 6 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_289 4047114 : 4049034 3 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_290 4052469 : 4053618 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_291 4059385 : 4066915 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_292 4074407 : 4075745 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_293 4081521 : 4089081 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_294 4101431 : 4102424 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_295 4105589 : 4111468 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_296 4125762 : 4128555 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_297 4132443 : 4134911 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_298 4141733 : 4142651 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_299 4165622 : 4167134 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_300 4175472 : 4178975 4 Bacillus_thuringiensis_phage(33.33%) NA NA
DBSCAN-SWA_301 4183477 : 4184812 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_302 4195876 : 4197433 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_303 4202204 : 4202867 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_304 4217497 : 4219336 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_305 4229398 : 4231045 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_306 4239148 : 4248798 8 Bacillus_phage(25.0%) transposase NA
DBSCAN-SWA_307 4252848 : 4258990 6 Catovirus(20.0%) NA NA
DBSCAN-SWA_308 4275357 : 4279202 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_309 4283037 : 4286499 3 Catovirus(50.0%) transposase NA
DBSCAN-SWA_310 4298500 : 4301844 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_311 4310562 : 4311177 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_312 4321113 : 4324234 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_313 4328461 : 4340905 6 Chrysochromulina_ericina_virus(33.33%) NA NA
DBSCAN-SWA_314 4349330 : 4351094 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_315 4356515 : 4358105 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_316 4371648 : 4375332 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_317 4381900 : 4382704 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_318 4399213 : 4400323 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_319 4407389 : 4407998 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_320 4413993 : 4416520 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_321 4419701 : 4425008 3 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_322 4436987 : 4438019 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_323 4445548 : 4446898 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_324 4459181 : 4465966 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_325 4471907 : 4473428 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_326 4478808 : 4480355 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_327 4485715 : 4487218 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_328 4491582 : 4496669 6 Escherichia_phage(40.0%) transposase NA
DBSCAN-SWA_329 4505891 : 4507254 1 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_330 4518168 : 4523814 5 Cronobacter_phage(33.33%) NA NA
DBSCAN-SWA_331 4531098 : 4532079 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_332 4536193 : 4541387 6 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_333 4548741 : 4549287 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_334 4554129 : 4557355 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_335 4563285 : 4567629 3 Pithovirus(50.0%) NA NA
DBSCAN-SWA_336 4587226 : 4588051 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_337 4604550 : 4611129 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_338 4627262 : 4630394 3 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_339 4638151 : 4644209 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_340 4654302 : 4663352 6 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_341 4679243 : 4684069 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_342 4687151 : 4688414 1 Stenotrophomonas_phage(100.0%) integrase attL 4685973:4685986|attR 4693080:4693093
DBSCAN-SWA_343 4691789 : 4697614 7 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_344 4718424 : 4723382 4 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_345 4726620 : 4728727 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_346 4738483 : 4741228 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_347 4745144 : 4746629 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_348 4762216 : 4763143 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_349 4795244 : 4796267 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_350 4803271 : 4806439 3 Paramecium_bursaria_Chlorella_virus(50.0%) transposase NA
DBSCAN-SWA_351 4809599 : 4810879 2 Shigella_phage(50.0%) NA NA
DBSCAN-SWA_352 4824102 : 4826823 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_353 4831558 : 4832881 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_354 4839212 : 4844372 3 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_355 4861529 : 4862483 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_356 4866854 : 4876807 7 Chrysochromulina_ericina_virus(25.0%) tRNA NA
DBSCAN-SWA_357 4895604 : 4896753 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_358 4903094 : 4904678 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_359 4917136 : 4922588 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_360 4928884 : 4929586 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_361 4938285 : 4939041 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_362 4950440 : 4952165 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_363 4978357 : 4979401 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_364 4983668 : 4984232 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_365 4995572 : 4996997 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_366 5006646 : 5016524 9 Shigella_phage(25.0%) transposase NA
DBSCAN-SWA_367 5021928 : 5028699 6 unidentified_phage(50.0%) tRNA NA
DBSCAN-SWA_368 5050834 : 5051632 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_369 5057598 : 5057943 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_370 5061898 : 5063332 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_371 5074910 : 5075669 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_372 5084500 : 5088600 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_373 5101584 : 5102616 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_374 5109128 : 5109932 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_375 5113997 : 5118207 5 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_376 5123715 : 5124297 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_377 5141546 : 5142830 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_378 5150363 : 5151359 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_379 5156006 : 5157404 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_380 5165860 : 5178856 14 Enterobacteria_phage(72.73%) integrase attL 5153994:5154008|attR 5177051:5177065
DBSCAN-SWA_381 5185700 : 5186543 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_382 5195616 : 5199337 5 Anomala_cuprea_entomopoxvirus(66.67%) NA NA
DBSCAN-SWA_383 5210340 : 5211108 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_384 5231591 : 5240111 6 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_385 5256916 : 5261255 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_386 5264853 : 5269513 6 Indivirus(33.33%) NA NA
DBSCAN-SWA_387 5282298 : 5283996 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_388 5298302 : 5303471 4 Agrobacterium_phage(25.0%) protease NA
DBSCAN-SWA_389 5306701 : 5307403 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_390 5311830 : 5315374 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_391 5326297 : 5327407 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_392 5336581 : 5345972 10 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_393 5351493 : 5359304 9 Sodalis_phage(25.0%) transposase NA
DBSCAN-SWA_394 5369449 : 5374655 5 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_395 5377837 : 5378524 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_396 5387069 : 5418626 48 Escherichia_phage(30.0%) integrase,lysis,tRNA,head attL 5378570:5378584|attR 5412577:5412591
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP021714
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 105737 111 Salmonella_phage(88.24%) tail,integrase,terminase attL 22223:22244|attR 101237:101258
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP021715
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 21989 : 32287 8 Escherichia_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP021716
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5772 9 Salmonella_phage(25.0%) integrase attL 2095:2123|attR 6067:6095
DBSCAN-SWA_2 23677 : 25218 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_3 31269 : 35908 4 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_4 41983 : 42541 1 Enterobacteria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP021713
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 96065 : 158855 59 uncultured_Caudovirales_phage(27.78%) protease,integrase,transposase attL 87808:87822|attR 107835:107849
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage