Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022226 Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP022228 Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence 0 crisprs c2c9_V-U4 0 0 1 0
NZ_CP022227 Escherichia coli strain WCHEC96200 plasmid pCTXM15_000200, complete sequence 0 crisprs csa3,RT 0 0 1 0
NZ_CP022229 Escherichia coli strain WCHEC96200 chromosome, complete genome 3 crisprs cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,WYL,PD-DExK,RT,DEDDh,c2c9_V-U4,DinG 0 11 8 0

Results visualization

1. NZ_CP022226
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11268 : 19383 8 Stx2-converting_phage(42.86%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP022228
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 92111 114 Escherichia_phage(87.74%) holin,tail,head,transposase,portal,integrase,plate attL 607:621|attR 64752:64766
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP022227
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1262 : 88640 94 Escherichia_phage(43.48%) integrase,protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP022229
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022229_1 893749-894384 TypeI-E I-E
10 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022229_2 921522-921855 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022229_3 2686879-2687028 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022229_1 1.1|893775|35|NZ_CP022229|CRT 893775-893809 35 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246934-246968 0 1.0
NZ_CP022229_1 1.16|894141|32|NZ_CP022229|PILER-CR 894141-894172 32 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42679-42710 1 0.969
NZ_CP022229_1 1.7|894141|35|NZ_CP022229|CRT,CRISPRCasFinder 894141-894175 35 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42676-42710 2 0.943
NZ_CP022229_2 2.3|921673|32|NZ_CP022229|CRISPRCasFinder,CRT,PILER-CR 921673-921704 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
NZ_CP022229_1 1.13|893958|32|NZ_CP022229|PILER-CR 893958-893989 32 MT110073 Stenotrophomonas phage vB_SmaS_DLP_3, complete genome 39410-39441 7 0.781
NZ_CP022229_1 1.12|893897|32|NZ_CP022229|PILER-CR 893897-893928 32 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 347859-347890 8 0.75
NZ_CP022229_1 1.15|894080|32|NZ_CP022229|PILER-CR 894080-894111 32 KC847113 Bacillus phage PBP180, complete sequence 100-131 8 0.75
NZ_CP022229_2 2.2|921612|32|NZ_CP022229|CRISPRCasFinder,CRT,PILER-CR 921612-921643 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
NZ_CP022229_2 2.5|921795|32|NZ_CP022229|CRISPRCasFinder,CRT,PILER-CR 921795-921826 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
NZ_CP022229_2 2.5|921795|32|NZ_CP022229|CRISPRCasFinder,CRT,PILER-CR 921795-921826 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
NZ_CP022229_1 1.11|893836|32|NZ_CP022229|PILER-CR 893836-893867 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 11267-11298 9 0.719
NZ_CP022229_1 1.15|894080|32|NZ_CP022229|PILER-CR 894080-894111 32 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20183 9 0.719
NZ_CP022229_1 1.15|894080|32|NZ_CP022229|PILER-CR 894080-894111 32 NC_049837 Klebsiella phage vB_KpnS_Alina, complete genome 13583-13614 9 0.719
NZ_CP022229_1 1.16|894141|32|NZ_CP022229|PILER-CR 894141-894172 32 NZ_CP019063 Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence 287201-287232 9 0.719
NZ_CP022229_1 1.15|894080|32|NZ_CP022229|PILER-CR 894080-894111 32 MN480762 Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence 179050-179081 10 0.688
NZ_CP022229_1 1.6|894080|35|NZ_CP022229|CRT,CRISPRCasFinder 894080-894114 35 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20186 12 0.657

1. spacer 1.1|893775|35|NZ_CP022229|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

caagtgatgtccatcatcgcatccagtgcgtccgg	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtccgg	Protospacer
***********************************

2. spacer 1.16|894141|32|NZ_CP022229|PILER-CR matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.969

atgagattaaaatactcagtactcttactcgc	CRISPR spacer
atgagattaaaatactcagcactcttactcgc	Protospacer
*******************.************

3. spacer 1.7|894141|35|NZ_CP022229|CRT,CRISPRCasFinder matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.943

atgagattaaaatactcagtactcttactcgccga	CRISPR spacer
atgagattaaaatactcagcactcttactcgccgt	Protospacer
*******************.************** 

4. spacer 2.3|921673|32|NZ_CP022229|CRISPRCasFinder,CRT,PILER-CR matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812

gagagcgaggggagattccggcagggcgtgca	CRISPR spacer
aatcgtgaggggatcttccggcagggcgtgca	Protospacer
.*  *.*******  *****************

5. spacer 1.13|893958|32|NZ_CP022229|PILER-CR matches to MT110073 (Stenotrophomonas phage vB_SmaS_DLP_3, complete genome) position: , mismatch: 7, identity: 0.781

gatcgcctgctccagcgtcactccctgcccct	CRISPR spacer
gttcgcctgctccagcgtcaatgccccctccc	Protospacer
* ****************** * **. *.**.

6. spacer 1.12|893897|32|NZ_CP022229|PILER-CR matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgaggtcgataagtacgaacggtttccctg	CRISPR spacer
gaagaggtcgatgagtacgaatggttacagcg	Protospacer
*  *********.********.**** *  .*

7. spacer 1.15|894080|32|NZ_CP022229|PILER-CR matches to KC847113 (Bacillus phage PBP180, complete sequence) position: , mismatch: 8, identity: 0.75

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
ttctctctaatgtagttaataaagtcgatggt	Protospacer
*  .*.*.**** ************* ****.

8. spacer 2.2|921612|32|NZ_CP022229|CRISPRCasFinder,CRT,PILER-CR matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75

taatatccc----tggcgataatcaaccggcttact	CRISPR spacer
----acgccatggtggcgataatcatcctgcttact	Protospacer
    *. **    ************ ** *******

9. spacer 2.5|921795|32|NZ_CP022229|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.* 

10. spacer 2.5|921795|32|NZ_CP022229|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.* 

11. spacer 1.11|893836|32|NZ_CP022229|PILER-CR matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

gtcaataggcggcgtcccgtagccgtcccctt	CRISPR spacer
gtgctctggcggcgtgccgtagccatccccga	Protospacer
**   . ******** ********.*****  

12. spacer 1.15|894080|32|NZ_CP022229|PILER-CR matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
ctttaggcaatgaagttaaaaaattctatggc	Protospacer
.  .   ************ *** ********

13. spacer 1.15|894080|32|NZ_CP022229|PILER-CR matches to NC_049837 (Klebsiella phage vB_KpnS_Alina, complete genome) position: , mismatch: 9, identity: 0.719

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
acattggcgatgaagttaataacgtgtatggc	Protospacer
  *..  *.************* ** ******

14. spacer 1.16|894141|32|NZ_CP022229|PILER-CR matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atgagattaaaatactcagtactcttactcgc	CRISPR spacer
cgggaattaacatactcggtactcttaccgtc	Protospacer
  *..***** ******.**********.  *

15. spacer 1.15|894080|32|NZ_CP022229|PILER-CR matches to MN480762 (Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence) position: , mismatch: 10, identity: 0.688

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
gtagattcaatgaagttaataaaaactatgat	Protospacer
  *  ..****************. *****..

16. spacer 1.6|894080|35|NZ_CP022229|CRT,CRISPRCasFinder matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.657

taacccccaatgaagttaataaagtctatggccga	CRISPR spacer
ctttaggcaatgaagttaaaaaattctatggcgat	Protospacer
.  .   ************ *** ******** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 68098 : 75616 7 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_2 123021 : 184076 71 Escherichia_phage(42.22%) portal,tRNA,head,terminase,lysis,tail,plate,integrase,transposase,holin,capsid attL 127310:127336|attR 160189:160215
DBSCAN-SWA_3 199547 : 208990 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 421914 : 494540 91 Enterobacteria_phage(46.77%) portal,tRNA,head,terminase,lysis,integrase,holin attL 453594:453616|attR 502279:502301
DBSCAN-SWA_5 870311 : 877451 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_6 3715858 : 3772060 77 Enterobacteria_phage(36.21%) portal,head,terminase,tail,integrase,transposase,holin,protease,capsid attL 3707968:3707984|attR 3749317:3749333
DBSCAN-SWA_7 4118258 : 4191650 90 Escherichia_phage(36.84%) portal,tRNA,head,terminase,lysis,tail,integrase,transposase,holin,capsid attL 4119386:4119401|attR 4164094:4164109
DBSCAN-SWA_8 4617398 : 4680675 83 Enterobacteria_phage(41.82%) portal,head,terminase,lysis,tail,integrase,transposase,capsid attL 4648252:4648267|attR 4685371:4685386
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage