Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019050 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166c, complete sequence 0 crisprs DEDDh 0 0 2 0
NZ_CP019049 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence 0 crisprs NA 0 0 14 0
NZ_CP019047 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 chromosome, complete genome 4 crisprs csa3,cas3,DEDDh,DinG,cas8e,cse2gr11,cas6e,cas7,cas5,cas1,cas2,WYL,RT 1 24 5 1
NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 1 crisprs NA 2 0 3 0

Results visualization

1. NZ_CP019050
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6912 : 73021 70 Salmonella_phage(77.05%) tail,integrase attL 22585:22610|attR 40749:40774
DBSCAN-SWA_2 76966 : 105757 39 Salmonella_phage(94.59%) tail,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP019047
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019047_1 1444906-1444995 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019047_2 2255536-2256052 TypeI-E I-E,II-B
8 spacers
cas3,cas8e,cse2gr11,cas6e,cas7,cas5,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019047_3 2264806-2266785 TypeI-E I-B,III-A,III-B
32 spacers
cas2,cas1,cas5,cas7,cas6e,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019047_4 4250397-4250536 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP019047_3 3.11|2265444|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265444-2265476 33 NZ_CP019047.1 1457751-1457783 0 1.0

1. spacer 3.11|2265444|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to position: 1457751-1457783, mismatch: 0, identity: 1.0

cgatgacaactttgcctacttcgctgcgctggc	CRISPR spacer
cgatgacaactttgcctacttcgctgcgctggc	Protospacer
*********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019047_2 2.2|2255625|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2255625-2255657 33 NZ_CP046951 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed2, complete sequence 82931-82963 0 1.0
NZ_CP019047_2 2.2|2255625|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2255625-2255657 33 NZ_CP046941 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed2 82923-82955 0 1.0
NZ_CP019047_2 2.2|2255625|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2255625-2255657 33 NZ_CP046383 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed2, complete sequence 82912-82944 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 70971-71003 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 191811-191843 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 115598-115630 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 41428-41460 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 112519-112551 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 100121-100153 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 94728-94760 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 123392-123424 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026212 Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence 101968-102000 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 123389-123421 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 143301-143333 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 184263-184295 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 52169-52201 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_LR130540 Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2 51053-51085 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 57511-57543 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 48995-49027 0 1.0
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MG288676 Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence 32224-32256 0 1.0
NZ_CP019047_3 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264895-2264927 33 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 37803-37835 0 1.0
NZ_CP019047_3 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264895-2264927 33 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 168141-168173 0 1.0
NZ_CP019047_3 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264895-2264927 33 NZ_CP037929 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence 241751-241783 0 1.0
NZ_CP019047_3 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264895-2264927 33 MN922301 Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence 241751-241783 0 1.0
NZ_CP019047_3 3.4|2265017|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265017-2265049 33 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 36327-36359 0 1.0
NZ_CP019047_3 3.4|2265017|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265017-2265049 33 NZ_CP037929 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence 240275-240307 0 1.0
NZ_CP019047_3 3.4|2265017|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265017-2265049 33 MN922301 Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence 240275-240307 0 1.0
NZ_CP019047_3 3.4|2265017|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265017-2265049 33 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 169617-169649 0 1.0
NZ_CP019047_3 3.5|2265078|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265078-2265110 33 MK416010 Klebsiella phage ST11-OXA245phi3.2, complete genome 22172-22204 0 1.0
NZ_CP019047_3 3.6|2265139|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265139-2265171 33 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 17265-17297 0 1.0
NZ_CP019047_3 3.11|2265444|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265444-2265476 33 KY271396 Klebsiella phage 2 LV-2017, complete genome 2133-2165 0 1.0
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 MK448230 Klebsiella phage ST16-OXA48phi5.2, complete genome 4032-4064 0 1.0
NZ_CP019047_3 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265566-2265598 33 LR134212 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3 14827-14859 0 1.0
NZ_CP019047_3 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265566-2265598 33 MK714353 Klebsiella phage ST13-OXA48phi12.5, complete genome 321-353 0 1.0
NZ_CP019047_3 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265566-2265598 33 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 321-353 0 1.0
NZ_CP019047_2 2.1|2255564|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2255564-2255596 33 MN098327 Klebsiella phage Mulock, complete genome 26694-26726 1 0.97
NZ_CP019047_2 2.2|2255625|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2255625-2255657 33 MK416014 Klebsiella phage ST16-OXA48phi5.3, complete genome 28380-28412 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 233926-233958 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 226378-226410 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 24052-24084 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026049 Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence 79682-79714 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 89124-89156 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 77071-77103 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018674 Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence 48746-48778 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 94335-94367 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 20288-20320 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 33889-33921 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 59646-59678 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KY271405 Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence 56858-56890 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 119804-119836 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KX443408 Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence 18090-18122 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052485 Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 31314-31346 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 42196-42228 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 189346-189378 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KP987215 Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence 38873-38905 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 139836-139868 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021753 Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence 82339-82371 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 120371-120403 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 9181-9213 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 49570-49602 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 129903-129935 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 182803-182835 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034040 Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence 114109-114141 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 12618-12650 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 45583-45615 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP044528 Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence 64784-64816 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 9182-9214 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 15961-15993 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 106389-106421 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 34212-34244 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 134203-134235 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 4247-4279 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 47385-47417 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 67410-67442 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 78101-78133 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 58214-58246 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 159061-159093 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 39577-39609 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 119161-119193 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 77729-77761 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 97083-97115 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052572 Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_010886 Klebsiella pneumoniae plasmid pK245, complete sequence 28554-28586 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 54883-54915 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 44902-44934 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 51932-51964 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 221352-221384 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 297-329 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029733 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence 69536-69568 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP035635 Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence 30225-30257 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP035637 Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence 13780-13812 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 163971-164003 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 180767-180799 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP051433 Escherichia sp. SCLE84 plasmid pSCLE3, complete sequence 31390-31422 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 20289-20321 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024882 Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence 61271-61303 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 139134-139166 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP008789 Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence 28523-28555 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 49990-50022 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 104015-104047 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 23803-23835 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 21026-21058 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 21027-21059 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020526 Enterobacter cloacae strain 109 plasmid unnamed1, complete sequence 92420-92452 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 48392-48424 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 186609-186641 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 108808-108840 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025042 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_5, complete sequence 23043-23075 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 102097-102129 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP011987 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-74.026kb, complete sequence 14477-14509 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 18932-18964 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 63402-63434 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 146022-146054 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP022275 Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence 43019-43051 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 69514-69546 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 14167-14199 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 20289-20321 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 45506-45538 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 202182-202214 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 129887-129919 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 48847-48879 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 61425-61457 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_FO834904 Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence 66412-66444 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN310373 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence 41279-41311 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN310374 Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence 89651-89683 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN310376 Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence 40768-40800 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 45583-45615 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 50083-50115 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 4914-4946 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 188794-188826 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 267006-267038 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP010385 Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence 53629-53661 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 107915-107947 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 48847-48879 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 92284-92316 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 122210-122242 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP030079 Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence 13208-13240 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 51324-51356 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026272 Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence 142863-142895 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 38171-38203 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 172254-172286 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052559 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052270 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 21026-21058 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 57856-57888 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 65962-65994 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 98892-98924 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 52544-52576 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MK648236 Klebsiella sp. strain TR5 plasmid pYK5, complete sequence 5523-5555 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 106704-106736 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 16633-16665 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 170597-170629 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 45408-45440 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 163485-163517 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028792 Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence 41169-41201 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 2630-2662 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 170018-170050 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP022349 Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence 61193-61225 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 75054-75086 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 15133-15165 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 39577-39609 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052193 Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence 39577-39609 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 180676-180708 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP014124 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2 8495-8527 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 13413-13445 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 92641-92673 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026206 Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence 116651-116683 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 51246-51278 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 60989-61021 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 78275-78307 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 204493-204525 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 51328-51360 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052376 Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence 18014-18046 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052561 Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052209 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence 118784-118816 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 42039-42071 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 121235-121267 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026182 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence 2014-2046 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 159754-159786 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 51966-51998 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 85084-85116 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 191861-191893 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 134643-134675 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 76260-76292 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 KY930324 Klebsiella pneumoniae plasmid pUCLAKPC1, complete sequence 10910-10942 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP038468 Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence 53604-53636 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 19081-19113 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021545 Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence 40192-40224 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021540 Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence 29725-29757 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 106178-106210 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP031572 Enterobacter hormaechei strain N1 plasmid pQnrS1-1502262, complete sequence 98365-98397 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP010383 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-106.409kb, complete sequence 71306-71338 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 97666-97698 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 42039-42071 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP036176 Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence 37063-37095 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP019691 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence 46341-46373 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 21812-21844 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP030068 Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence 54273-54305 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028549 Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence 35411-35443 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028551 Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence 69816-69848 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP009774 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pNJST258N3-62b, complete sequence 9222-9254 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 40035-40067 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 74323-74355 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 51328-51360 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP046940 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1 68634-68666 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP006925 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N3, complete sequence 9222-9254 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP006927 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence 39365-39397 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 84923-84955 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP008932 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence 1253-1285 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 86783-86815 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP006921 Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C3, complete sequence 2046-2078 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 20771-20803 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP032180 Citrobacter freundii strain AR_0116 plasmid unnamed2, complete sequence 69627-69659 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052282 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence 39578-39610 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029143 Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence 65382-65414 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052547 Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence 16262-16294 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP008842 Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence 136583-136615 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP036446 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence 49139-49171 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP019668 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence 59811-59843 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020065 Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence 71843-71875 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 11238-11270 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 168144-168176 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 53459-53491 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 201055-201087 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 146207-146239 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024537 Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 82255-82287 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP050170 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence 9200-9232 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 62004-62036 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 117106-117138 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024681 Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence 52989-53021 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034677 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence 14733-14765 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MF918373 Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence 70187-70219 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 40733-40765 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_LR130549 Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP023571 Enterobacter hormaechei strain BW plasmid unnamed3, complete sequence 18443-18475 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 51328-51360 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP022574 Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence 141593-141625 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 38347-38379 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 52405-52437 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 54526-54558 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 7751-7783 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 143146-143178 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 9179-9211 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 189840-189872 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP017935 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence 6924-6956 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 73835-73867 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 132562-132594 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021713 Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence 145665-145697 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 50536-50568 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 38540-38572 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026151 Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence 101118-101150 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP040030 Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence 51328-51360 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 64835-64867 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 47158-47190 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 73164-73196 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 50670-50702 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028181 Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence 226583-226615 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 26926-26958 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 154494-154526 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP042546 Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence 34682-34714 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP045019 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-5, complete sequence 25565-25597 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021856 Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence 40681-40713 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021857 Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence 39680-39712 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 77101-77133 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 40158-40190 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021898 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_3_pilon, complete sequence 27576-27608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 120435-120467 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 22888-22920 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052370 Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 73580-73612 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 36120-36152 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024551 Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP032209 Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence 117700-117732 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 103189-103221 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 196828-196860 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 56664-56696 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 137779-137811 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 41998-42030 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021710 Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence 24729-24761 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 102224-102256 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP043319 Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 plasmid pLAP2_050004, complete sequence 29195-29227 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 20289-20321 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052263 Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence 52680-52712 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 78023-78055 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 44759-44791 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 44206-44238 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP011577 Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence 20346-20378 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 9212-9244 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP023186 Klebsiella michiganensis strain K518 plasmid pK518_KPC, complete sequence 4332-4364 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 86836-86868 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP027161 Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence 88701-88733 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 273665-273697 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025009 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence 51377-51409 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 243984-244016 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 114350-114382 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052237 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP023947 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence 36612-36644 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 5582-5614 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 55376-55408 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052437 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence 5329-5361 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP050812 Yokenella regensburgei strain W13 plasmid pYRW13-125, complete sequence 51576-51608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052353 Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence 5329-5361 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 140495-140527 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP014954 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence 4782-4814 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028543 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 16487-16519 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026852 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence 18761-18793 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 143014-143046 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP042975 Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence 153806-153838 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP054265 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence 109789-109821 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 129903-129935 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 182803-182835 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP028781 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP027425 Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence 124362-124394 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP030350 Enterobacter hormaechei strain AR_038 plasmid unnamed5, complete sequence 67343-67375 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052477 Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025006 Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence 51375-51407 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 117299-117331 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 130127-130159 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026716 Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence 126776-126808 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_LR792630 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I 66411-66443 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 31736-31768 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MK649827 Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence 160691-160723 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 56155-56187 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 98449-98481 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MK649829 Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence 65028-65060 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052469 Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence 44169-44201 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP023943 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence 65145-65177 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP030071 Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence 177110-177142 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 271166-271198 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 36120-36152 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP037929 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN922301 Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence 51327-51359 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 139850-139882 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 20289-20321 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP015393 Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence 17907-17939 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP015396 Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence 28767-28799 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 57767-57799 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 232515-232547 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052337 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence 51323-51355 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MK167987 Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence 28746-28778 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MN268580 Klebsiella pneumoniae strain KP13-53 plasmid pKP13-53-tet(A), complete sequence 134702-134734 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028274 Mixta theicola strain SRCM103227 plasmid unnamed1, complete sequence 25971-26003 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MH569712 Serratia marcescens strain S120 plasmid pPM120-2, complete sequence 9983-10015 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 42039-42071 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MH745929 Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence 51334-51366 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 306093-306125 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 41379-41411 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MF156696 Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence 39526-39558 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MG764554 Enterobacter cloacae strain 30860 plasmid p30860-tetA, complete sequence 22526-22558 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021741 Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence 10688-10720 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN823997 Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence 83129-83161 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN824000 Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence 61091-61123 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052489 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence 51326-51358 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 115166-115198 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KY271406 Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence 144728-144760 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 53444-53476 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 39576-39608 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 84062-84094 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026370 Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence 34040-34072 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 15907-15939 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 92865-92897 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN661403 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence 52397-52429 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MT108213 Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence 11848-11880 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP033774 Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence 126365-126397 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 18917-18949 1 0.97
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP054304 Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence 167867-167899 1 0.97
NZ_CP019047_3 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264895-2264927 33 MK416010 Klebsiella phage ST11-OXA245phi3.2, complete genome 17036-17068 1 0.97
NZ_CP019047_3 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264895-2264927 33 KC911857 Salmonella phage SPC32N, complete genome 12663-12695 1 0.97
NZ_CP019047_3 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264895-2264927 33 KC911856 Salmonella phage SPC32H, complete genome 12663-12695 1 0.97
NZ_CP019047_3 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264895-2264927 33 NC_016761 Salmonella phage SPN1S, complete genome 12691-12723 1 0.97
NZ_CP019047_3 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264895-2264927 33 JQ691610 Salmonella phage SPN9TCW, complete genome 12692-12724 1 0.97
NZ_CP019047_3 3.5|2265078|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265078-2265110 33 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 42961-42993 1 0.97
NZ_CP019047_3 3.5|2265078|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265078-2265110 33 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 162983-163015 1 0.97
NZ_CP019047_3 3.5|2265078|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265078-2265110 33 NZ_CP037929 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence 246909-246941 1 0.97
NZ_CP019047_3 3.5|2265078|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265078-2265110 33 MN922301 Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence 246909-246941 1 0.97
NZ_CP019047_3 3.9|2265322|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265322-2265354 33 MN098327 Klebsiella phage Mulock, complete genome 33171-33203 1 0.97
NZ_CP019047_3 3.9|2265322|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265322-2265354 33 KY271395 Klebsiella phage 2b LV-2017, complete genome 10622-10654 1 0.97
NZ_CP019047_3 3.9|2265322|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265322-2265354 33 KY271396 Klebsiella phage 2 LV-2017, complete genome 34389-34421 1 0.97
NZ_CP019047_3 3.10|2265383|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265383-2265415 33 LR134212 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3 17183-17215 1 0.97
NZ_CP019047_3 3.10|2265383|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265383-2265415 33 KY271396 Klebsiella phage 2 LV-2017, complete genome 41321-41353 1 0.97
NZ_CP019047_3 3.11|2265444|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265444-2265476 33 KY271395 Klebsiella phage 2b LV-2017, complete genome 42167-42199 1 0.97
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 NZ_CP022925 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B 15999-16031 1 0.97
NZ_CP019047_3 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265566-2265598 33 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 46035-46067 1 0.97
NZ_CP019047_3 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265566-2265598 33 NZ_CP026278 Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence 307-339 1 0.97
NZ_CP019047_3 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265566-2265598 33 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 594-626 1 0.97
NZ_CP019047_3 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265566-2265598 33 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 594-626 1 0.97
NZ_CP019047_3 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265566-2265598 33 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 321-353 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_006949 Enterobacteria phage ES18, complete genome 37529-37561 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 LC487997 Stx2-converting phage Stx2a F578 genes for Shiga toxin 2 production region, complete sequence 12367-12399 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 AP012539 Stx2-converting phage Stx2a_WGPS6 proviral DNA, complete genome 14289-14321 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_016160 Escherichia phage HK75, complete genome 28054-28086 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 AY736146 Salmonella typhimurium bacteriophage ES18, complete sequence 37529-37561 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 JQ182733 Enterobacterial phage mEp213, complete genome 34539-34571 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 MG986485 Escherichia phage SH2026Stx1, complete genome 13337-13369 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_019714 Enterobacteria phage HK446, complete genome 28987-29019 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 FM180578 Enterobacteria phage 2851, complete genome 11849-11881 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 MH370387 Salmonella phage S149, complete genome 14949-14981 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 MG407615 Salmonella phage Bp96115, partial genome 4868-4900 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 FJ188381 Stx2-converting phage 1717, complete genome 12518-12550 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 AF069529 Bacteriophage HK97, complete genome 29740-29772 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_002167 Enterobacteria phage HK97, complete genome 29740-29772 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_011356 Enterobacteria phage YYZ-2008, complete prophage genome 12041-12073 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_019715 Enterobacterial phage mEp234, complete genome 29870-29902 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 JQ086374 Enterobacteria phage HK544, complete genome 30153-30185 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_019705 Enterobacteria phage mEpX2, complete genome 28508-28540 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_049944 Stx2-converting phage Stx2a_WGPS8 proviral DNA, complete genome 11858-11890 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_019711 Enterobacteria phage HK629, complete genome 36631-36663 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 FJ184280 Enterobacteria phage YYZ-2008, complete genome 12041-12073 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_019769 Enterobacteria phage HK542, complete genome 28637-28669 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 AJ413274 Bacteriophage Nil2 proviral n gene, ORF22, ci gene, cro gene, cii gene, ORF53, o gene, p gene, ninA gene, ORF29, ORF30, ORF31, ninB gene, ORF175, ninE gene, ORF23, ORF57, antA gene, antB gene, roi gene, ninG gene, ninI gene, q gene, stx2A gene, stx2B gene, ileZ gene, argN gene and argO gene 3502-3534 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_019768 Enterobacteria phage HK106, complete genome 32166-32198 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 KY979108 Escherichia phage ECP1, complete genome 40357-40389 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 AP012538 Stx2-converting phage Stx2a_WGPS4 proviral DNA, complete genome 11841-11873 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_005841 Enterobacteria phage ST104 DNA, complete genome 14950-14982 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_011357 Stx2-converting phage 1717, complete prophage genome 12518-12550 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_019719 Enterobacteria phage HK633, complete genome 31202-31234 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 AP012530 Stx2-converting phage Stx2a_F349 proviral DNA, complete genome 11862-11894 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 JF974339 Enterobacteria phage IME10, complete genome 9185-9217 1 0.97
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_005344 Enterobacteria phage Sf6, complete genome 27872-27904 1 0.97
NZ_CP019047_3 3.19|2265932|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2265932-2265964 33 MK416017 Klebsiella phage ST101-KPC2phi6.3, complete genome 35198-35230 1 0.97
NZ_CP019047_3 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2266298-2266330 33 NZ_CP046951 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed2, complete sequence 82350-82382 1 0.97
NZ_CP019047_3 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2266298-2266330 33 NZ_CP046941 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed2 82342-82374 1 0.97
NZ_CP019047_3 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2266298-2266330 33 NZ_CP046383 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed2, complete sequence 82331-82363 1 0.97
NZ_CP019047_3 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2266298-2266330 33 MF695815 Klebsiella phage KPP5665-2, complete genome 11464-11496 1 0.97
NZ_CP019047_3 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2266298-2266330 33 MK416014 Klebsiella phage ST16-OXA48phi5.3, complete genome 28961-28993 1 0.97
NZ_CP019047_2 2.3|2255686|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2255686-2255718 33 KC139649 Salmonella phage FSL SP-069 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, hypothetical proteins, deoxyuridine 5'-triphosphate nucleotidohydrolase, hypothetical proteins, NinH, head morphogenesis protein, hypothetical proteins, capsid related protein, hypothetical proteins, enolase-like protein, hypothetical proteins, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, and DNA polymerase genes, complete cds 21082-21114 2 0.939
NZ_CP019047_2 2.3|2255686|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2255686-2255718 33 KC139634 Salmonella phage FSL SP-062 hypothetical protein gene, partial cds; and capsid related protein, hypothetical proteins, tail length tape measure protein, hypothetical protein, enolase-like protein, hypothetical protein, tail protein, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, DNA methylase, hypothetical proteins, and DNA polymerase genes, complete cds 805-837 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 61090-61122 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 233999-234031 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 74199-74231 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 177083-177115 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 177049-177081 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 29066-29098 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 20021-20053 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 75595-75627 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN661403 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence 22231-22263 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP041050 Citrobacter sp. CF971 plasmid pBM527-4, complete sequence 35066-35098 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 162513-162545 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP050841 Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence 58580-58612 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KR822246 Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence 20371-20403 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 12866-12898 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 13795-13827 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 78222-78254 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 70564-70596 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP017473 Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence 28907-28939 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP042500 Enterobacter sp. E76 plasmid pE76_001, complete sequence 36759-36791 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 12500-12532 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_LN824135 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671 48061-48093 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012835 Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence 29978-30010 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP023150 Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence 12493-12525 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034768 Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence 8212-8244 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP036328 Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence 31267-31299 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 12443-12475 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 52578-52610 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 113223-113255 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP036321 Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence 6354-6386 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_009425 Enterobacter sp. 638 plasmid pENTE01, complete sequence 26796-26828 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 17023-17055 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP015502 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence 9757-9789 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP015502 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence 128076-128108 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP037964 Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence 631-663 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 92730-92762 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 96813-96845 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034325 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence 103405-103437 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 106885-106917 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024835 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence 5000-5032 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 47722-47754 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 89077-89109 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP007736 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence 42758-42790 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 6710-6742 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 138139-138171 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021688 Klebsiella pneumoniae strain AR_0146 plasmid tig00001189, complete sequence 5471-5503 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 210739-210771 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 18483-18515 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 31272-31304 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 12509-12541 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 7737-7769 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024839 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence 53086-53118 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP041250 Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence 20805-20837 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 53750-53782 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 10295-10327 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 12493-12525 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029435 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence 114561-114593 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 95952-95984 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 107712-107744 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 47732-47764 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 122418-122450 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 48710-48742 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024431 Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence 45645-45677 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN792917 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence 22461-22493 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP050361 Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence 22798-22830 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 20776-20808 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN823996 Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence 41929-41961 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN824001 Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence 8631-8663 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 77165-77197 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024509 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence 71233-71265 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 6969-7001 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 22486-22518 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 107780-107812 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP020050 Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence 88100-88132 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 9231-9263 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 104315-104347 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 61752-61784 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP035124 Escherichia coli strain EC25 plasmid pEC25-1, complete sequence 79367-79399 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 10883-10915 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021698 Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence 854-886 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP034085 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence 12517-12549 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028717 Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence 87082-87114 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 82606-82638 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 36561-36593 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 105007-105039 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP028389 Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence 12509-12541 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021758 Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence 51215-51247 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 132168-132200 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 17313-17345 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 82924-82956 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 117305-117337 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP021777 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_2, complete sequence 68290-68322 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP047634 Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence 35082-35114 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP047635 Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence 60311-60343 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MK773538 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-D, complete sequence 24443-24475 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 8648-8680 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MN543570 Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence 12485-12517 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP044045 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence 109405-109437 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 19537-19569 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 6260-6292 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MH909329 Leclercia adecarboxylata strain 150707804 plasmid p707804-3FII, complete sequence 5283-5315 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 123480-123512 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MG764547 Escherichia coli strain 14E509 plasmid p14E509-CTXM, complete sequence 25612-25644 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_MH464586 Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence 124770-124802 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MN688131 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence 15718-15750 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP014777 Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence 29813-29845 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 26620-26652 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 97150-97182 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP029441 Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence 84702-84734 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP032169 Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence 157579-157611 2 0.939
NZ_CP019047_2 2.8|2255992|33|NZ_CP019047|CRISPRCasFinder,CRT 2255992-2256024 33 MN098327 Klebsiella phage Mulock, complete genome 25513-25545 2 0.939
NZ_CP019047_2 2.8|2255992|33|NZ_CP019047|CRISPRCasFinder,CRT 2255992-2256024 33 KY271400 Klebsiella phage 6 LV-2017, complete genome 17605-17637 2 0.939
NZ_CP019047_3 3.9|2265322|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265322-2265354 33 MK448230 Klebsiella phage ST16-OXA48phi5.2, complete genome 12129-12161 2 0.939
NZ_CP019047_3 3.10|2265383|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265383-2265415 33 MN013086 Klebsiella phage vB_Kpn_Chronis, complete genome 27771-27803 2 0.939
NZ_CP019047_3 3.11|2265444|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265444-2265476 33 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 40941-40973 2 0.939
NZ_CP019047_3 3.11|2265444|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265444-2265476 33 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 40941-40973 2 0.939
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 LR134212 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3 15968-16000 2 0.939
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 MK714353 Klebsiella phage ST13-OXA48phi12.5, complete genome 1715-1747 2 0.939
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 1735-1767 2 0.939
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 1735-1767 2 0.939
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 1462-1494 2 0.939
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 1715-1747 2 0.939
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 44894-44926 2 0.939
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 KY271400 Klebsiella phage 6 LV-2017, complete genome 16702-16734 2 0.939
NZ_CP019047_3 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265566-2265598 33 KY271395 Klebsiella phage 2b LV-2017, complete genome 533-565 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 KY709687 Salmonella phage 29485, complete genome 8885-8917 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 KU927496 Salmonella phage 101962B_sal5, complete genome 12921-12953 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 KU927491 Salmonella phage 146851_sal5, complete genome 13688-13720 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 KU927495 Salmonella phage 103203_sal4, complete genome 13184-13216 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 KU927498 Salmonella phage 64795_sal4, complete genome 32207-32239 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 KU927492 Salmonella phage 146851_sal4, complete genome 32217-32249 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_030919 Salmonella phage 118970_sal4, complete genome 13212-13244 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_013059 Salmonella phage c341, complete genome 31487-31519 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 JQ806764 Salmonella phage vB_SosS_Oslo, complete genome 37857-37889 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_017985 Salmonella phage SPN9CC, complete genome 12918-12950 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 FJ000341 Salmonella phage g341c, complete genome 31487-31519 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 EU570103 Salmonella phage epsilon34, complete genome 33528-33560 2 0.939
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 NC_031946 Salmonella Phage 103203_sal5, complete genome 33097-33129 2 0.939
NZ_CP019047_3 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2266298-2266330 33 LR134279 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 4 19174-19206 2 0.939
NZ_CP019047_3 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2266298-2266330 33 LR134277 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 2 718-750 2 0.939
NZ_CP019047_3 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2266298-2266330 33 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 11799-11831 2 0.939
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP045692 Klebsiella pneumoniae strain TK421 plasmid pTK421_2, complete sequence 52975-53007 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP032995 Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence 20193-20225 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NC_017627 Escherichia coli 042 plasmid pAA, complete sequence 14937-14969 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP025625 Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence 7309-7341 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 MF679144 Escherichia coli plasmid pBJ114-78, complete sequence 37427-37459 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KX058576 Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence 16197-16229 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KX808482 Escherichia coli O55:H7 strain 122262 plasmid unnamed, complete sequence 25126-25158 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 55649-55681 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KT282968 Escherichia coli strain EC012 plasmid pEC012, complete sequence 52326-52358 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KU043116 Escherichia coli strain Y5 plasmid pECY56, complete sequence 26414-26446 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KU130396 Escherichia coli strain S68 plasmid pS68, complete sequence 93001-93033 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KX276657 Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence 134644-134676 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP032991 Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence 30927-30959 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052795 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence 137725-137757 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KM085450 Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence 65940-65972 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KR653209 Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence 99362-99394 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KT002541 Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence 85605-85637 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KM085449 Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence 63602-63634 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KM052220 Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence 20822-20854 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP010130 Escherichia coli strain C9 plasmid A, complete genome 7760-7792 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP010233 Escherichia coli strain S30 plasmid B, complete sequence 21964-21996 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP023192 Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence 27457-27489 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP032799 Escherichia coli strain ERL06-2497 plasmid pERL06-2497-2, complete sequence 3666-3698 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP045742 Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence 154709-154741 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_KT754162 Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence 61524-61556 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 CP052804 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence 131771-131803 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_AP017618 Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence 93054-93086 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP013191 Escherichia coli strain FORC_031 plasmid pFORC31.1, complete sequence 89191-89223 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP018116 Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence 32667-32699 3 0.909
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 KY271396 Klebsiella phage 2 LV-2017, complete genome 42252-42284 3 0.909
NZ_CP019047_3 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT 2265810-2265842 33 HQ201308 Cronobacter phage ENT47670, complete genome 16806-16838 3 0.909
NZ_CP019047_2 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT 2255931-2255963 33 NZ_CP041050 Citrobacter sp. CF971 plasmid pBM527-4, complete sequence 48414-48446 6 0.818
NZ_CP019047_3 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265505-2265537 33 MN013086 Klebsiella phage vB_Kpn_Chronis, complete genome 26229-26261 6 0.818
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 360343-360376 7 0.794
NZ_CP019047_3 3.9|2265322|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265322-2265354 33 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 573524-573556 7 0.788
NZ_CP019047_3 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265688-2265720 33 MK919470 Gordonia phage Mellie, complete genome 32640-32672 8 0.758
NZ_CP019047_3 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265688-2265720 33 MN096365 Gordonia phage Samba, complete genome 35030-35062 8 0.758
NZ_CP019047_3 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265688-2265720 33 NC_030921 Gordonia phage Utz, complete genome 33720-33752 8 0.758
NZ_CP019047_3 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265688-2265720 33 MK814754 Mycobacterium phage Sumter, complete genome 39763-39795 8 0.758
NZ_CP019047_3 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265688-2265720 33 JN153085 Mycobacterium phage Doom, complete genome 39472-39504 8 0.758
NZ_CP019047_3 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265688-2265720 33 EU744251 Mycobacterium phage Jasper, complete genome 38647-38679 8 0.758
NZ_CP019047_3 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265688-2265720 33 JN660814 Mycobacterium phage Dreamboat, complete genome 38761-38793 8 0.758
NZ_CP019047_3 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265688-2265720 33 MH669011 Mycobacterium phage PherrisBueller, complete genome 38298-38330 8 0.758
NZ_CP019047_3 3.24|2266237|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2266237-2266269 33 NZ_CP007214 Burkholderia plantarii strain ATCC 43733 plasmid bpln_1p, complete sequence 60726-60758 8 0.758
NZ_CP019047_3 3.32|2266725|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2266725-2266757 33 NZ_CP019876 Komagataeibacter nataicola strain RZS01 plasmid pKNA01, complete sequence 71593-71625 8 0.758
NZ_CP019047_3 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264834-2264866 33 NZ_CP017148 Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence 127493-127525 9 0.727
NZ_CP019047_3 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265688-2265720 33 EU744249 Mycobacterium phage Lockley, complete genome 39102-39134 9 0.727
NZ_CP019047_3 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265688-2265720 33 EU744252 Mycobacterium phage DD5, complete genome 39940-39972 9 0.727
NZ_CP019047_3 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265688-2265720 33 MK878896 Gordonia phage Begonia, complete genome 34921-34953 9 0.727
NZ_CP019047_2 2.1|2255564|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2255564-2255596 33 MK448671 Streptococcus phage Javan115, complete genome 2680-2712 10 0.697
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1379087-1379120 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 39178-39211 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 47993-48026 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 1595177-1595210 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 684825-684858 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 368207-368240 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 136898-136931 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1044207-1044240 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 523974-524007 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 585082-585115 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 400235-400268 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 1323450-1323483 10 0.706
NZ_CP019047_2 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT 2255869-2255902 34 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 39180-39213 10 0.706
NZ_CP019047_3 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264834-2264866 33 NZ_CP013524 Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence 315548-315580 10 0.697
NZ_CP019047_3 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264834-2264866 33 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 312774-312806 10 0.697
NZ_CP019047_3 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264834-2264866 33 NZ_CP013586 Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence 326826-326858 10 0.697
NZ_CP019047_3 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264834-2264866 33 NZ_CP013559 Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence 323495-323527 10 0.697
NZ_CP019047_3 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264834-2264866 33 NZ_CP013576 Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence 324281-324313 10 0.697
NZ_CP019047_3 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264834-2264866 33 NZ_CP013548 Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence 324277-324309 10 0.697
NZ_CP019047_3 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264834-2264866 33 NZ_CP013533 Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence 324277-324309 10 0.697
NZ_CP019047_3 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264834-2264866 33 NZ_CP013543 Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence 327691-327723 10 0.697
NZ_CP019047_3 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264834-2264866 33 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 312774-312806 10 0.697
NZ_CP019047_3 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2264834-2264866 33 NZ_CP013570 Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence 324281-324313 10 0.697
NZ_CP019047_3 3.8|2265261|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT 2265261-2265293 33 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 522260-522292 10 0.697
NZ_CP019047_3 3.28|2266481|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR 2266481-2266513 33 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 567488-567520 10 0.697

1. spacer 2.2|2255625|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046951 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatcggcgtgccgtttgttggacccgaaatag	CRISPR spacer
tgatcggcgtgccgtttgttggacccgaaatag	Protospacer
*********************************

2. spacer 2.2|2255625|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046941 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed2) position: , mismatch: 0, identity: 1.0

tgatcggcgtgccgtttgttggacccgaaatag	CRISPR spacer
tgatcggcgtgccgtttgttggacccgaaatag	Protospacer
*********************************

3. spacer 2.2|2255625|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046383 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatcggcgtgccgtttgttggacccgaaatag	CRISPR spacer
tgatcggcgtgccgtttgttggacccgaaatag	Protospacer
*********************************

4. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

5. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

6. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

7. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

8. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

9. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

10. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

11. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

12. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

13. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

14. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

15. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

16. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

17. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

18. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

19. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

20. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

21. spacer 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 0, identity: 1.0

tacacccagctctttgacgcaaaggctcaggag	CRISPR spacer
tacacccagctctttgacgcaaaggctcaggag	Protospacer
*********************************

22. spacer 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 0, identity: 1.0

tacacccagctctttgacgcaaaggctcaggag	CRISPR spacer
tacacccagctctttgacgcaaaggctcaggag	Protospacer
*********************************

23. spacer 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037929 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence) position: , mismatch: 0, identity: 1.0

tacacccagctctttgacgcaaaggctcaggag	CRISPR spacer
tacacccagctctttgacgcaaaggctcaggag	Protospacer
*********************************

24. spacer 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MN922301 (Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence) position: , mismatch: 0, identity: 1.0

tacacccagctctttgacgcaaaggctcaggag	CRISPR spacer
tacacccagctctttgacgcaaaggctcaggag	Protospacer
*********************************

25. spacer 3.4|2265017|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 0, identity: 1.0

ctggttgacgtatgccgtgatgctgctggtagg	CRISPR spacer
ctggttgacgtatgccgtgatgctgctggtagg	Protospacer
*********************************

26. spacer 3.4|2265017|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037929 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence) position: , mismatch: 0, identity: 1.0

ctggttgacgtatgccgtgatgctgctggtagg	CRISPR spacer
ctggttgacgtatgccgtgatgctgctggtagg	Protospacer
*********************************

27. spacer 3.4|2265017|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MN922301 (Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence) position: , mismatch: 0, identity: 1.0

ctggttgacgtatgccgtgatgctgctggtagg	CRISPR spacer
ctggttgacgtatgccgtgatgctgctggtagg	Protospacer
*********************************

28. spacer 3.4|2265017|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 0, identity: 1.0

ctggttgacgtatgccgtgatgctgctggtagg	CRISPR spacer
ctggttgacgtatgccgtgatgctgctggtagg	Protospacer
*********************************

29. spacer 3.5|2265078|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK416010 (Klebsiella phage ST11-OXA245phi3.2, complete genome) position: , mismatch: 0, identity: 1.0

taccccgtacccgacccgctctaaagtgaccgg	CRISPR spacer
taccccgtacccgacccgctctaaagtgaccgg	Protospacer
*********************************

30. spacer 3.6|2265139|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 0, identity: 1.0

caggttcgtaccggggccgtagaggtctgtttc	CRISPR spacer
caggttcgtaccggggccgtagaggtctgtttc	Protospacer
*********************************

31. spacer 3.11|2265444|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 0, identity: 1.0

cgatgacaactttgcctacttcgctgcgctggc	CRISPR spacer
cgatgacaactttgcctacttcgctgcgctggc	Protospacer
*********************************

32. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448230 (Klebsiella phage ST16-OXA48phi5.2, complete genome) position: , mismatch: 0, identity: 1.0

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcctcttcttcctgacaatcagcgcagcgctg	Protospacer
*********************************

33. spacer 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to LR134212 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3) position: , mismatch: 0, identity: 1.0

tgcgggtggatgacaataacgcctggcgcgccg	CRISPR spacer
tgcgggtggatgacaataacgcctggcgcgccg	Protospacer
*********************************

34. spacer 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK714353 (Klebsiella phage ST13-OXA48phi12.5, complete genome) position: , mismatch: 0, identity: 1.0

tgcgggtggatgacaataacgcctggcgcgccg	CRISPR spacer
tgcgggtggatgacaataacgcctggcgcgccg	Protospacer
*********************************

35. spacer 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

tgcgggtggatgacaataacgcctggcgcgccg	CRISPR spacer
tgcgggtggatgacaataacgcctggcgcgccg	Protospacer
*********************************

36. spacer 2.1|2255564|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 1, identity: 0.97

cggctcttttttatctccttcatccttcgctat	CRISPR spacer
cggctcttttttatttccttcatccttcgctat	Protospacer
**************.******************

37. spacer 2.2|2255625|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK416014 (Klebsiella phage ST16-OXA48phi5.3, complete genome) position: , mismatch: 1, identity: 0.97

tgatcggcgtgccgtttgttggacccgaaatag	CRISPR spacer
tgatcggcgtgccatttgttggacccgaaatag	Protospacer
*************.*******************

38. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

39. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

40. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

41. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

42. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

43. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

44. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018674 (Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

45. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

46. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

47. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

48. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

49. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

50. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

51. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

52. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KX443408 (Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

53. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

54. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

55. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

56. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

57. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KP987215 (Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

58. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

59. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

60. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

61. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

62. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

63. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

64. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

65. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

66. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

67. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

68. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

69. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

70. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

71. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

72. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

73. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

74. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

75. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

76. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

77. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

78. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

79. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

80. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

81. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

82. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

83. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

84. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

85. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

86. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

87. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

88. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

89. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_010886 (Klebsiella pneumoniae plasmid pK245, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

90. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

91. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

92. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

93. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

94. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

95. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029733 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

96. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP035635 (Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

97. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP035637 (Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

98. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

99. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

100. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

101. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

102. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP051433 (Escherichia sp. SCLE84 plasmid pSCLE3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

103. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

104. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

105. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

106. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

107. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

108. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

109. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

110. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

111. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

112. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

113. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

114. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020526 (Enterobacter cloacae strain 109 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

115. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

116. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

117. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

118. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025042 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

119. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

120. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

121. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

122. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP011987 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-74.026kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

123. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

124. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

125. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

126. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

127. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

128. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

129. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

130. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

131. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

132. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

133. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

134. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

135. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

136. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

137. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

138. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

139. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

140. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

141. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

142. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

143. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

144. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

145. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

146. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP010385 (Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

147. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

148. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

149. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

150. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

151. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

152. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP030079 (Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

153. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

154. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

155. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

156. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

157. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

158. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

159. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

160. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

161. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

162. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

163. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

164. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

165. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MK648236 (Klebsiella sp. strain TR5 plasmid pYK5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

166. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

167. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

168. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

169. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

170. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

171. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

172. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

173. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

174. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

175. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

176. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

177. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

178. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

179. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

180. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

181. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP014124 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

182. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

183. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

184. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

185. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

186. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

187. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

188. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

189. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

190. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

191. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

192. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052376 (Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

193. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

194. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

195. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

196. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

197. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026182 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

198. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

199. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

200. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

201. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

202. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

203. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

204. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

205. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

206. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to KY930324 (Klebsiella pneumoniae plasmid pUCLAKPC1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

207. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP038468 (Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

208. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

209. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

210. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

211. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

212. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP031572 (Enterobacter hormaechei strain N1 plasmid pQnrS1-1502262, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

213. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP010383 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-106.409kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

214. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

215. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

216. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

217. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

218. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP019691 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

219. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

220. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP030068 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

221. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

222. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028551 (Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

223. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP009774 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pNJST258N3-62b, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

224. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

225. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

226. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

227. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

228. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP006925 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

229. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

230. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

231. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

232. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

233. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP006921 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

234. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ccttcagctggccgtcgagctgacggatgccgg	Protospacer
*** *****************************

235. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP032180 (Citrobacter freundii strain AR_0116 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

236. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

237. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

238. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052547 (Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

239. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

240. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP036446 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

241. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP019668 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

242. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

243. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

244. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

245. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

246. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

247. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

248. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

249. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

250. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

251. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

252. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

253. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

254. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034677 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

255. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

256. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

257. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

258. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

259. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP023571 (Enterobacter hormaechei strain BW plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

260. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

261. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

262. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

263. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

264. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

265. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

266. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

267. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

268. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

269. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

270. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

271. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

272. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

273. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

274. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

275. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

276. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

277. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

278. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

279. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

280. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

281. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

282. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

283. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

284. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

285. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

286. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

287. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

288. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP045019 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

289. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

290. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

291. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

292. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

293. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021898 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

294. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

295. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

296. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

297. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

298. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

299. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

300. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

301. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

302. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

303. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

304. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

305. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

306. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

307. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

308. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

309. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP043319 (Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 plasmid pLAP2_050004, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

310. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

311. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

312. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

313. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

314. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

315. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

316. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

317. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

318. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP023186 (Klebsiella michiganensis strain K518 plasmid pK518_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

319. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

320. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

321. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagatgacggatgccgg	Protospacer
******************* *************

322. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

323. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

324. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

325. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

326. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

327. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP023947 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

328. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

329. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

330. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

331. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

332. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052437 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

333. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

334. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP050812 (Yokenella regensburgei strain W13 plasmid pYRW13-125, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

335. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052353 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

336. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

337. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

338. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

339. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

340. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

341. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026852 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

342. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

343. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

344. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

345. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

346. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

347. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

348. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

349. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP030350 (Enterobacter hormaechei strain AR_038 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

350. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

351. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

352. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

353. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

354. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

355. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

356. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

357. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

358. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

359. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

360. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

361. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

362. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052469 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

363. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

364. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

365. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

366. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

367. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP037929 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

368. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN922301 (Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

369. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

370. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

371. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

372. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP015393 (Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

373. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP015396 (Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

374. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

375. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

376. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

377. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

378. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MN268580 (Klebsiella pneumoniae strain KP13-53 plasmid pKP13-53-tet(A), complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

379. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028274 (Mixta theicola strain SRCM103227 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcggctggccgtcgagctgacggatgccgg	Protospacer
*****.***************************

380. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

381. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

382. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

383. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MH745929 (Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

384. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

385. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

386. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MF156696 (Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

387. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MG764554 (Enterobacter cloacae strain 30860 plasmid p30860-tetA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

388. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

389. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

390. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

391. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052489 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

392. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

393. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

394. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

395. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

396. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

397. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026370 (Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

398. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

399. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

400. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

401. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

402. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP033774 (Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

403. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

404. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

405. spacer 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK416010 (Klebsiella phage ST11-OXA245phi3.2, complete genome) position: , mismatch: 1, identity: 0.97

tacacccagctctttgacgcaaaggctcaggag	CRISPR spacer
tacacccagctttttgacgcaaaggctcaggag	Protospacer
***********.*********************

406. spacer 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KC911857 (Salmonella phage SPC32N, complete genome) position: , mismatch: 1, identity: 0.97

tacacccagctctttgacgcaaaggctcaggag	CRISPR spacer
tacacccagctctttgacgcaaagactcaggag	Protospacer
************************.********

407. spacer 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KC911856 (Salmonella phage SPC32H, complete genome) position: , mismatch: 1, identity: 0.97

tacacccagctctttgacgcaaaggctcaggag	CRISPR spacer
tacacccagctctttgacgcaaagactcaggag	Protospacer
************************.********

408. spacer 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NC_016761 (Salmonella phage SPN1S, complete genome) position: , mismatch: 1, identity: 0.97

tacacccagctctttgacgcaaaggctcaggag	CRISPR spacer
tacacccagctctttgacgcaaagactcaggag	Protospacer
************************.********

409. spacer 3.2|2264895|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to JQ691610 (Salmonella phage SPN9TCW, complete genome) position: , mismatch: 1, identity: 0.97

tacacccagctctttgacgcaaaggctcaggag	CRISPR spacer
tacacccagctctttgacgcaaagactcaggag	Protospacer
************************.********

410. spacer 3.5|2265078|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 1, identity: 0.97

taccccgtacccgacccgctctaaagtgaccgg	CRISPR spacer
taccccgtacccaacccgctctaaagtgaccgg	Protospacer
************.********************

411. spacer 3.5|2265078|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 1, identity: 0.97

taccccgtacccgacccgctctaaagtgaccgg	CRISPR spacer
taccccgtacccaacccgctctaaagtgaccgg	Protospacer
************.********************

412. spacer 3.5|2265078|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037929 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence) position: , mismatch: 1, identity: 0.97

taccccgtacccgacccgctctaaagtgaccgg	CRISPR spacer
taccccgtacccaacccgctctaaagtgaccgg	Protospacer
************.********************

413. spacer 3.5|2265078|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MN922301 (Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence) position: , mismatch: 1, identity: 0.97

taccccgtacccgacccgctctaaagtgaccgg	CRISPR spacer
taccccgtacccaacccgctctaaagtgaccgg	Protospacer
************.********************

414. spacer 3.9|2265322|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 1, identity: 0.97

tagcggtggtggccatcgataaccttcacgccc	CRISPR spacer
tagcggtggtggccgtcgataaccttcacgccc	Protospacer
**************.******************

415. spacer 3.9|2265322|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 1, identity: 0.97

tagcggtggtggccatcgataaccttcacgccc	CRISPR spacer
tagcggtggtggccgtcgataaccttcacgccc	Protospacer
**************.******************

416. spacer 3.9|2265322|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 1, identity: 0.97

tagcggtggtggccatcgataaccttcacgccc	CRISPR spacer
tagcggtggtggccgtcgataaccttcacgccc	Protospacer
**************.******************

417. spacer 3.10|2265383|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to LR134212 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.97

cgctgtatg-ccccccatccttcgcaagcactac	CRISPR spacer
-gctgtatgcccccccatccttcgcaagcactac	Protospacer
 ******** ************************

418. spacer 3.10|2265383|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 1, identity: 0.97

cgctgtatg-ccccccatccttcgcaagcactac	CRISPR spacer
-gctgtatgcccccccatccttcgcaagcactac	Protospacer
 ******** ************************

419. spacer 3.11|2265444|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 1, identity: 0.97

cgatgacaactttgcctacttcgctgcgctggc	CRISPR spacer
cgatgacaactttgcctacttcgcagcgctggc	Protospacer
************************ ********

420. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022925 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B) position: , mismatch: 1, identity: 0.97

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcctcttcttcctgacaatcagcgcagcgcag	Protospacer
******************************* *

421. spacer 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 1, identity: 0.97

tgcgggtggatgacaataacgcctggcgcgccg	CRISPR spacer
tgcgcgtggatgacaataacgcctggcgcgccg	Protospacer
**** ****************************

422. spacer 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026278 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence) position: , mismatch: 1, identity: 0.97

tgcgggtggatgacaataacgcctggcgcgccg	CRISPR spacer
tgcgggtggatgacaataacgcctggcgtgccg	Protospacer
****************************.****

423. spacer 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 1, identity: 0.97

tgcgggtggatgacaataacgcctggcgcgccg	CRISPR spacer
tgcgtgtggatgacaataacgcctggcgcgccg	Protospacer
**** ****************************

424. spacer 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 1, identity: 0.97

tgcgggtggatgacaataacgcctggcgcgccg	CRISPR spacer
tgcgtgtggatgacaataacgcctggcgcgccg	Protospacer
**** ****************************

425. spacer 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 1, identity: 0.97

tgcgggtggatgacaataacgcctggcgcgccg	CRISPR spacer
tgcgggtggatgacaataacgcctggcgcaccg	Protospacer
*****************************.***

426. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_006949 (Enterobacteria phage ES18, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

427. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to LC487997 (Stx2-converting phage Stx2a F578 genes for Shiga toxin 2 production region, complete sequence) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

428. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to AP012539 (Stx2-converting phage Stx2a_WGPS6 proviral DNA, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

429. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_016160 (Escherichia phage HK75, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

430. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to AY736146 (Salmonella typhimurium bacteriophage ES18, complete sequence) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

431. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to JQ182733 (Enterobacterial phage mEp213, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

432. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MG986485 (Escherichia phage SH2026Stx1, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

433. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_019714 (Enterobacteria phage HK446, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

434. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to FM180578 (Enterobacteria phage 2851, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

435. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MH370387 (Salmonella phage S149, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

436. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MG407615 (Salmonella phage Bp96115, partial genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

437. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to FJ188381 (Stx2-converting phage 1717, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

438. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to AF069529 (Bacteriophage HK97, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

439. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_002167 (Enterobacteria phage HK97, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

440. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_011356 (Enterobacteria phage YYZ-2008, complete prophage genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

441. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_019715 (Enterobacterial phage mEp234, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

442. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to JQ086374 (Enterobacteria phage HK544, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

443. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_019705 (Enterobacteria phage mEpX2, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

444. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_049944 (Stx2-converting phage Stx2a_WGPS8 proviral DNA, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

445. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_019711 (Enterobacteria phage HK629, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

446. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to FJ184280 (Enterobacteria phage YYZ-2008, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

447. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_019769 (Enterobacteria phage HK542, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

448. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to AJ413274 (Bacteriophage Nil2 proviral n gene, ORF22, ci gene, cro gene, cii gene, ORF53, o gene, p gene, ninA gene, ORF29, ORF30, ORF31, ninB gene, ORF175, ninE gene, ORF23, ORF57, antA gene, antB gene, roi gene, ninG gene, ninI gene, q gene, stx2A gene, stx2B gene, ileZ gene, argN gene and argO gene) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

449. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_019768 (Enterobacteria phage HK106, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

450. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to KY979108 (Escherichia phage ECP1, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

451. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to AP012538 (Stx2-converting phage Stx2a_WGPS4 proviral DNA, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

452. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_005841 (Enterobacteria phage ST104 DNA, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

453. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_011357 (Stx2-converting phage 1717, complete prophage genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

454. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_019719 (Enterobacteria phage HK633, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

455. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to AP012530 (Stx2-converting phage Stx2a_F349 proviral DNA, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

456. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to JF974339 (Enterobacteria phage IME10, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

457. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_005344 (Enterobacteria phage Sf6, complete genome) position: , mismatch: 1, identity: 0.97

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgtcgaatctcttctttttcctggtat	Protospacer
**************.******************

458. spacer 3.19|2265932|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to MK416017 (Klebsiella phage ST101-KPC2phi6.3, complete genome) position: , mismatch: 1, identity: 0.97

cagatcaaagcctggactgagcgtcttagtgcg	CRISPR spacer
cagatcaaagcctggactgagcgtctcagtgcg	Protospacer
**************************.******

459. spacer 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046951 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccaggccagatctgtttgggttggtgtcgaag	CRISPR spacer
tccaggccagatctgtttgggttggtgtcgagg	Protospacer
*******************************.*

460. spacer 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046941 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed2) position: , mismatch: 1, identity: 0.97

tccaggccagatctgtttgggttggtgtcgaag	CRISPR spacer
tccaggccagatctgtttgggttggtgtcgagg	Protospacer
*******************************.*

461. spacer 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046383 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccaggccagatctgtttgggttggtgtcgaag	CRISPR spacer
tccaggccagatctgtttgggttggtgtcgagg	Protospacer
*******************************.*

462. spacer 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to MF695815 (Klebsiella phage KPP5665-2, complete genome) position: , mismatch: 1, identity: 0.97

tccaggccagatctgtttgggttggtgtcgaag	CRISPR spacer
tccaggccagatctgtttgggttggtgtcgagg	Protospacer
*******************************.*

463. spacer 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to MK416014 (Klebsiella phage ST16-OXA48phi5.3, complete genome) position: , mismatch: 1, identity: 0.97

tccaggccagatctgtttgggttggtgtcgaag	CRISPR spacer
tccaggccagatctgtttgggttggtgtcgagg	Protospacer
*******************************.*

464. spacer 2.3|2255686|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KC139649 (Salmonella phage FSL SP-069 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, hypothetical proteins, deoxyuridine 5'-triphosphate nucleotidohydrolase, hypothetical proteins, NinH, head morphogenesis protein, hypothetical proteins, capsid related protein, hypothetical proteins, enolase-like protein, hypothetical proteins, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, and DNA polymerase genes, complete cds) position: , mismatch: 2, identity: 0.939

cgtcatcagcgccttgttccagcggcgaccacc	CRISPR spacer
cgtcatcagtgccttgttccagcgacgaccacc	Protospacer
*********.**************.********

465. spacer 2.3|2255686|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KC139634 (Salmonella phage FSL SP-062 hypothetical protein gene, partial cds; and capsid related protein, hypothetical proteins, tail length tape measure protein, hypothetical protein, enolase-like protein, hypothetical protein, tail protein, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, DNA methylase, hypothetical proteins, and DNA polymerase genes, complete cds) position: , mismatch: 2, identity: 0.939

cgtcatcagcgccttgttccagcggcgaccacc	CRISPR spacer
cgtcatcagtgccttgttccagcgacgaccacc	Protospacer
*********.**************.********

466. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

467. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

468. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgatggaggccgg	Protospacer
***********************.*** *****

469. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

470. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

471. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

472. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

473. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgatggaggccgg	Protospacer
***********************.*** *****

474. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgaaggccgg	Protospacer
*************************.* *****

475. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP041050 (Citrobacter sp. CF971 plasmid pBM527-4, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagcttacggacgccgg	Protospacer
********************* *****.*****

476. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

477. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP050841 (Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

478. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KR822246 (Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

479. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

480. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

481. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

482. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

483. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP017473 (Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
catgcagctggccgttgagctgacggatgccgg	Protospacer
* *************.*****************

484. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP042500 (Enterobacter sp. E76 plasmid pE76_001, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtggagctgacggacgccgg	Protospacer
*************** ***********.*****

485. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

486. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_LN824135 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

487. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012835 (Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggctgtcgagctgacggacgccgg	Protospacer
************.**************.*****

488. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP023150 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

489. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgttgagctgacggacgccgg	Protospacer
***************.***********.*****

490. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

491. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

492. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

493. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

494. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

495. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_009425 (Enterobacter sp. 638 plasmid pENTE01, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtggaactgacggatgccgg	Protospacer
*************** **.**************

496. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

497. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

498. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

499. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

500. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

501. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

502. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

503. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

504. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024835 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

505. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

506. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

507. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

508. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

509. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

510. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021688 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001189, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

511. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

512. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

513. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

514. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

515. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

516. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024839 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

517. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

518. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgccgagctgacggaggccgg	Protospacer
**************.************ *****

519. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

520. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

521. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

522. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

523. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

524. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

525. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

526. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

527. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024431 (Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

528. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN792917 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

529. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP050361 (Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

530. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

531. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

532. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

533. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

534. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024509 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

535. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

536. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

537. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

538. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP020050 (Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

539. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

540. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

541. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

542. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

543. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

544. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021698 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

545. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

546. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

547. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

548. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

549. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

550. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

551. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021758 (Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

552. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

553. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

554. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

555. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

556. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021777 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgttgg	Protospacer
*****************************..**

557. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

558. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP047635 (Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

559. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MK773538 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-D, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

560. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

561. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

562. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP044045 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

563. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgaactgacggaggccgg	Protospacer
******************.******** *****

564. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
catgcagctggccgtggagctgacggatgccgg	Protospacer
* ************* *****************

565. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MH909329 (Leclercia adecarboxylata strain 150707804 plasmid p707804-3FII, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggcagg	Protospacer
*************************** ** **

566. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

567. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MG764547 (Escherichia coli strain 14E509 plasmid p14E509-CTXM, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

568. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

569. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN688131 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

570. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

571. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

572. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

573. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

574. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

575. spacer 2.8|2255992|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 2, identity: 0.939

ttcatcacgtgtgagcggatttggctctatcct	CRISPR spacer
ttcatcacgtgtgagcggatctggttctatcct	Protospacer
********************.***.********

576. spacer 2.8|2255992|33|NZ_CP019047|CRISPRCasFinder,CRT matches to KY271400 (Klebsiella phage 6 LV-2017, complete genome) position: , mismatch: 2, identity: 0.939

ttcatcacgtgtgagcggatttggctctatcct	CRISPR spacer
ttcatcacgtgtgagcggatctggttctatcct	Protospacer
********************.***.********

577. spacer 3.9|2265322|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448230 (Klebsiella phage ST16-OXA48phi5.2, complete genome) position: , mismatch: 2, identity: 0.939

tagcggtggtggccatcgataaccttcacgccc	CRISPR spacer
tagcggtggtggccgtcgataactttcacgccc	Protospacer
**************.********.*********

578. spacer 3.10|2265383|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 2, identity: 0.939

cgctgtatg-ccccccatccttcgcaagcactac	CRISPR spacer
-gctgtatgcccccccatccttcggaagcactac	Protospacer
 ******** ************** *********

579. spacer 3.11|2265444|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 2, identity: 0.939

cgatgacaactttgcctacttcgctgcgctggc	CRISPR spacer
cgatgacaactttgcatacttcgccgcgctggc	Protospacer
*************** ********.********

580. spacer 3.11|2265444|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 2, identity: 0.939

cgatgacaactttgcctacttcgctgcgctggc	CRISPR spacer
cgatgacaactttgcatacttcgccgcgctggc	Protospacer
*************** ********.********

581. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to LR134212 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3) position: , mismatch: 2, identity: 0.939

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcctcttcttcttggcaatcagcgcagcgctg	Protospacer
************.**.*****************

582. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK714353 (Klebsiella phage ST13-OXA48phi12.5, complete genome) position: , mismatch: 2, identity: 0.939

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcctcttcttcttggcaatcagcgcagcgctg	Protospacer
************.**.*****************

583. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 2, identity: 0.939

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcctcgtcttcctgacaatcagcacagcgctg	Protospacer
****** *****************.********

584. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 2, identity: 0.939

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcctcgtcttcctgacaatcagcacagcgctg	Protospacer
****** *****************.********

585. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 2, identity: 0.939

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcctcttcttcctgacagtcagcacagcgctg	Protospacer
******************.*****.********

586. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 2, identity: 0.939

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcctcttcttcttggcaatcagcgcagcgctg	Protospacer
************.**.*****************

587. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 2, identity: 0.939

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcctcttcttcctgacagtcagcacagcgctg	Protospacer
******************.*****.********

588. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KY271400 (Klebsiella phage 6 LV-2017, complete genome) position: , mismatch: 2, identity: 0.939

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcctcgtcttcctgacaatcagcacagcgctg	Protospacer
****** *****************.********

589. spacer 3.13|2265566|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 2, identity: 0.939

tgcgggtggatgacaataacgcctggcgcgccg	CRISPR spacer
tgcgcgtggacgacaataacgcctggcgcgccg	Protospacer
**** *****.**********************

590. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to KY709687 (Salmonella phage 29485, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

591. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to KU927496 (Salmonella phage 101962B_sal5, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

592. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to KU927491 (Salmonella phage 146851_sal5, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

593. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to KU927495 (Salmonella phage 103203_sal4, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

594. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to KU927498 (Salmonella phage 64795_sal4, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

595. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to KU927492 (Salmonella phage 146851_sal4, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

596. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_030919 (Salmonella phage 118970_sal4, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

597. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_013059 (Salmonella phage c341, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

598. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to JQ806764 (Salmonella phage vB_SosS_Oslo, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

599. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_017985 (Salmonella phage SPN9CC, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

600. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to FJ000341 (Salmonella phage g341c, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

601. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to EU570103 (Salmonella phage epsilon34, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

602. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_031946 (Salmonella Phage 103203_sal5, complete genome) position: , mismatch: 2, identity: 0.939

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcaggatgtcgaatctcttctttttcctggtat	Protospacer
*****.********.******************

603. spacer 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to LR134279 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 4) position: , mismatch: 2, identity: 0.939

tccaggccagatctgtttgggttggtgtcgaag	CRISPR spacer
tccacgccagatcagtttgggttggtgtcgaag	Protospacer
**** ******** *******************

604. spacer 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to LR134277 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 2) position: , mismatch: 2, identity: 0.939

tccaggccagatctgtttgggttggtgtcgaag	CRISPR spacer
tccacgccagatcagtttgggttggtgtcgaag	Protospacer
**** ******** *******************

605. spacer 3.25|2266298|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 2, identity: 0.939

tccaggccagatctgtttgggttggtgtcgaag	CRISPR spacer
tccacgccagatcagtttgggttggtgtcgaag	Protospacer
**** ******** *******************

606. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP045692 (Klebsiella pneumoniae strain TK421 plasmid pTK421_2, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tttgcagctggccgtcgagctgacggaggccgg	Protospacer
..************************* *****

607. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

608. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_017627 (Escherichia coli 042 plasmid pAA, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggcagtggagctgacggatgccgg	Protospacer
.*********** ** *****************

609. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP025625 (Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

610. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to MF679144 (Escherichia coli plasmid pBJ114-78, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

611. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KX058576 (Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

612. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KX808482 (Escherichia coli O55:H7 strain 122262 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

613. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

614. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

615. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KU043116 (Escherichia coli strain Y5 plasmid pECY56, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

616. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KU130396 (Escherichia coli strain S68 plasmid pS68, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

617. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KX276657 (Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

618. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP032991 (Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

619. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

620. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

621. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

622. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

623. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KM085449 (Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

624. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KM052220 (Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

625. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP010130 (Escherichia coli strain C9 plasmid A, complete genome) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

626. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP010233 (Escherichia coli strain S30 plasmid B, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

627. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP023192 (Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

628. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP032799 (Escherichia coli strain ERL06-2497 plasmid pERL06-2497-2, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

629. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP045742 (Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

630. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_KT754162 (Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

631. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

632. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_AP017618 (Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

633. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP013191 (Escherichia coli strain FORC_031 plasmid pFORC31.1, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggcagtggagctgacggatgccgg	Protospacer
.*********** ** *****************

634. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP018116 (Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

635. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 3, identity: 0.909

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcctcttcttcctgacagtcagcacagcgcag	Protospacer
******************.*****.****** *

636. spacer 3.17|2265810|33|NZ_CP019047|CRISPRCasFinder,CRT matches to HQ201308 (Cronobacter phage ENT47670, complete genome) position: , mismatch: 3, identity: 0.909

tcagggtgtcgaatttcttctttttcctggtat	CRISPR spacer
tcagggtgccgaatctcttctttttcctggtac	Protospacer
********.*****.*****************.

637. spacer 2.7|2255931|33|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP041050 (Citrobacter sp. CF971 plasmid pBM527-4, complete sequence) position: , mismatch: 6, identity: 0.818

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacagtgg	Protospacer
.***********.**************.. .**

638. spacer 3.12|2265505|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 6, identity: 0.818

ttcctcttcttcctgacaatcagcgcagcgctg	CRISPR spacer
ttcaaactcttcctggcaatcagcacagcgctg	Protospacer
***   .********.********.********

639. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 7, identity: 0.794

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ttccgatcggcgtccgcgccagggcaatcacgac	Protospacer
* **  .******************.******  

640. spacer 3.9|2265322|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

-tagcggtggtggccatcgataaccttcacgccc	CRISPR spacer
atcgtgat-gtggccgtcgatgaccttcacgccg	Protospacer
 * *.*.* ******.*****.*********** 

641. spacer 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK919470 (Gordonia phage Mellie, complete genome) position: , mismatch: 8, identity: 0.758

ccatttcgatctggtcgtagacgtcttcgcggt	CRISPR spacer
tgtcttcgatctggtcgcagacgtcgtcgagct	Protospacer
.  .*************.******* *** * *

642. spacer 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MN096365 (Gordonia phage Samba, complete genome) position: , mismatch: 8, identity: 0.758

ccatttcgatctggtcgtagacgtcttcgcggt	CRISPR spacer
tgtcttcgatctggtcgcagacgtcgtcgagct	Protospacer
.  .*************.******* *** * *

643. spacer 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NC_030921 (Gordonia phage Utz, complete genome) position: , mismatch: 8, identity: 0.758

ccatttcgatctggtcgtagacgtcttcgcggt	CRISPR spacer
tgtcttcgatctggtcgcagacgtcgtcgagct	Protospacer
.  .*************.******* *** * *

644. spacer 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.758

ccatttcgatctggtcgtagacgtcttcgcggt	CRISPR spacer
tctcgtcgatcaggtcgtagacgtcctcggtgt	Protospacer
.* . ****** *************.***  **

645. spacer 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to JN153085 (Mycobacterium phage Doom, complete genome) position: , mismatch: 8, identity: 0.758

ccatttcgatctggtcgtagacgtcttcgcggt	CRISPR spacer
tctcgtcgatcaggtcgtagacgtcctcggtgt	Protospacer
.* . ****** *************.***  **

646. spacer 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to EU744251 (Mycobacterium phage Jasper, complete genome) position: , mismatch: 8, identity: 0.758

ccatttcgatctggtcgtagacgtcttcgcggt	CRISPR spacer
tctcgtcgatcaggtcgtagacgtcctcggtgt	Protospacer
.* . ****** *************.***  **

647. spacer 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to JN660814 (Mycobacterium phage Dreamboat, complete genome) position: , mismatch: 8, identity: 0.758

ccatttcgatctggtcgtagacgtcttcgcggt	CRISPR spacer
tctcgtcgatcaggtcgtagacgtcctcggtgt	Protospacer
.* . ****** *************.***  **

648. spacer 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MH669011 (Mycobacterium phage PherrisBueller, complete genome) position: , mismatch: 8, identity: 0.758

ccatttcgatctggtcgtagacgtcttcgcggt	CRISPR spacer
tctcgtcgatcaggtcgtagacgtcctcggtgt	Protospacer
.* . ****** *************.***  **

649. spacer 3.24|2266237|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007214 (Burkholderia plantarii strain ATCC 43733 plasmid bpln_1p, complete sequence) position: , mismatch: 8, identity: 0.758

tcgatggcgagctgctggtgaaaaagtcgatac	CRISPR spacer
ccgatggggagctgctggtgcaaaacttggcgc	Protospacer
.****** ************ **** *.*...*

650. spacer 3.32|2266725|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019876 (Komagataeibacter nataicola strain RZS01 plasmid pKNA01, complete sequence) position: , mismatch: 8, identity: 0.758

tgaccttagaggcttcactcagtgccacttttt	CRISPR spacer
agaccttcggggcttcactcagtgcatcattca	Protospacer
 ****** *.***************  * **. 

651. spacer 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

cgcgacgacctcgtcatcctccccgctgcggct	CRISPR spacer
cgcgccgacctcgtcatcctgccctgcaaggtc	Protospacer
**** *************** ***  .. **..

652. spacer 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to EU744249 (Mycobacterium phage Lockley, complete genome) position: , mismatch: 9, identity: 0.727

ccatttcgatctggtcgtagacgtcttcgcggt	CRISPR spacer
tctcgtcgatcaggtcgtagacctcttcggtat	Protospacer
.* . ****** ********** ******  .*

653. spacer 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to EU744252 (Mycobacterium phage DD5, complete genome) position: , mismatch: 9, identity: 0.727

ccatttcgatctggtcgtagacgtcttcgcggt	CRISPR spacer
tctcgtcgatcaggtcgtagacctcttcggtat	Protospacer
.* . ****** ********** ******  .*

654. spacer 3.15|2265688|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK878896 (Gordonia phage Begonia, complete genome) position: , mismatch: 9, identity: 0.727

ccatttcgatctggtcgtagacgtcttcgcggt	CRISPR spacer
tgtcttcgatctggtcgcagacgtcgtcaagct	Protospacer
.  .*************.******* **. * *

655. spacer 2.1|2255564|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to MK448671 (Streptococcus phage Javan115, complete genome) position: , mismatch: 10, identity: 0.697

cggctcttttttatctccttcatccttcgctat	CRISPR spacer
agggtcttttttatctgcttcatccaaaacagc	Protospacer
 ** ************ ********   .* ..

656. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

657. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

658. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

659. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

660. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

661. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

662. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

663. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

664. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

665. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

666. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

667. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

668. spacer 2.6|2255869|34|NZ_CP019047|CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

669. spacer 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgacgacctcgtcatcctccccgctgcggct	CRISPR spacer
cgcgacgacctcgtcatcgtcaccaagatcggc	Protospacer
****************** ** **.  .. * .

670. spacer 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgacgacctcgtcatcctccccgctgcggct	CRISPR spacer
cgcgacgacctcgtcatcgtcaccaagattggc	Protospacer
****************** ** **.  .. * .

671. spacer 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgacgacctcgtcatcctccccgctgcggct	CRISPR spacer
cgcgacgacctcgtcatcgtcaccaagatcggc	Protospacer
****************** ** **.  .. * .

672. spacer 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgacgacctcgtcatcctccccgctgcggct	CRISPR spacer
cgcgacgacctcgtcatcgtcaccaagatcggc	Protospacer
****************** ** **.  .. * .

673. spacer 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgacgacctcgtcatcctccccgctgcggct	CRISPR spacer
cgcgacgacctcgtcatcgtcaccaagatcggc	Protospacer
****************** ** **.  .. * .

674. spacer 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgacgacctcgtcatcctccccgctgcggct	CRISPR spacer
cgcgacgacctcgtcatcgtcaccaagatcggc	Protospacer
****************** ** **.  .. * .

675. spacer 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgacgacctcgtcatcctccccgctgcggct	CRISPR spacer
cgcgacgacctcgtcatcgtcaccaagatcggc	Protospacer
****************** ** **.  .. * .

676. spacer 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgacgacctcgtcatcctccccgctgcggct	CRISPR spacer
cgcgacgacctcgtcatcgtcaccaagatcggc	Protospacer
****************** ** **.  .. * .

677. spacer 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgacgacctcgtcatcctccccgctgcggct	CRISPR spacer
cgcgacgacctcgtcatcgtcaccaagattggc	Protospacer
****************** ** **.  .. * .

678. spacer 3.1|2264834|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgacgacctcgtcatcctccccgctgcggct	CRISPR spacer
cgcgacgacctcgtcatcgtcaccaagatcggc	Protospacer
****************** ** **.  .. * .

679. spacer 3.8|2265261|33|NZ_CP019047|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 10, identity: 0.697

caccacgatctctatcaccgacgcgccgactac	CRISPR spacer
gacgacgatctcgatcaccgacgcgggagacgc	Protospacer
 ** ******** ************  .. ..*

680. spacer 3.28|2266481|33|NZ_CP019047|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 10, identity: 0.697

cacatcgatgaggacttttttaagtctaatctg	CRISPR spacer
atgaatgatgaggatttttttaagtataatgat	Protospacer
   * .********.********** ****   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1413047 : 1465440 71 Enterobacteria_phage(18.97%) head,integrase,holin,terminase attL 1426955:1426970|attR 1465190:1465205
DBSCAN-SWA_2 1690761 : 1697666 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_3 2736689 : 2747576 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_4 3143943 : 3238664 100 Klebsiella_phage(47.62%) portal,tail,tRNA,holin,transposase,terminase,capsid,head,integrase attL 3136473:3136490|attR 3246813:3246830
DBSCAN-SWA_5 3487716 : 3497180 8 Brazilian_cedratvirus(16.67%) protease,tRNA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP019047.1|WP_099119320.1|1411444_1411516_-|membrane-protein-YpdK 1411444_1411516_- 23 aa aa NA NA NA No NA
3. NZ_CP019049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5728 4 uncultured_marine_virus(33.33%) transposase NA
DBSCAN-SWA_2 10011 : 10233 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_3 15203 : 17590 3 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_4 23668 : 25344 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_5 39617 : 42819 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_6 56941 : 122226 49 Bacillus_phage(16.0%) integrase,transposase attL 57921:57971|attR 129639:129689
DBSCAN-SWA_7 131813 : 132698 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_8 142951 : 144451 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_9 153186 : 153828 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_10 157621 : 178113 17 Caulobacter_phage(27.27%) protease,transposase NA
DBSCAN-SWA_11 193625 : 193886 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_12 205630 : 206140 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_13 212653 : 215149 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) transposase NA
DBSCAN-SWA_14 222611 : 224786 1 Acinetobacter_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP019048
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019048_1 227149-227336 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP019048_1 1.1|227203|13|NZ_CP019048|PILER-CR 227203-227215 13 NZ_CP019048.1 222502-222514 0 1.0
NZ_CP019048_1 1.1|227203|13|NZ_CP019048|PILER-CR 227203-227215 13 NZ_CP019048.1 222904-222916 0 1.0
NZ_CP019048_1 1.2|227270|13|NZ_CP019048|PILER-CR 227270-227282 13 NZ_CP019050.1 5440-5452 1 0.923

1. spacer 1.1|227203|13|NZ_CP019048|PILER-CR matches to position: 222502-222514, mismatch: 0, identity: 1.0

gtcatgaaaccgc	CRISPR spacer
gtcatgaaaccgc	Protospacer
*************

2. spacer 1.1|227203|13|NZ_CP019048|PILER-CR matches to position: 222904-222916, mismatch: 0, identity: 1.0

gtcatgaaaccgc	CRISPR spacer
gtcatgaaaccgc	Protospacer
*************

3. spacer 1.2|227270|13|NZ_CP019048|PILER-CR matches to position: 5440-5452, mismatch: 1, identity: 0.923

tccatgaagccgc	CRISPR spacer
tcaatgaagccgc	Protospacer
** **********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 50875 : 84356 35 Escherichia_phage(50.0%) integrase,protease,transposase attL 50057:50071|attR 83265:83279
DBSCAN-SWA_2 93188 : 119421 26 Escherichia_phage(33.33%) integrase,transposase attL 95941:96000|attR 102097:103294
DBSCAN-SWA_3 161921 : 175641 21 Salmonella_phage(53.85%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage