Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021339 Escherichia coli strain 95NR1 chromosome, complete genome 2 crisprs DinG,PrimPol,cas3,c2c9_V-U4,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas14i 0 5 18 0
NZ_CP021341 Escherichia coli strain 95NR1 plasmid p95NR1B, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP021340 Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence 1 crisprs NA 1 0 1 0

Results visualization

1. NZ_CP021340
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021340_1 1880-1987 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP021340_1 1.2|1956|13|NZ_CP021340|PILER-CR 1956-1968 13 NZ_CP021341.1 6350-6362 1 0.923

1. spacer 1.2|1956|13|NZ_CP021340|PILER-CR matches to position: 6350-6362, mismatch: 1, identity: 0.923

caataaatcgtgc	CRISPR spacer
caataaaccgtgc	Protospacer
*******.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 86571 102 Escherichia_phage(61.7%) tail,terminase,head,integrase,transposase,holin attL 28591:28610|attR 75799:75818
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP021339
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021339_1 3356503-3356836 TypeI-E I-E
5 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021339_2 3382538-3382871 Unclear I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021339_1 1.1|3356532|32|NZ_CP021339|CRT 3356532-3356563 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
NZ_CP021339_1 1.2|3356593|32|NZ_CP021339|CRT,PILER-CR,CRISPRCasFinder 3356593-3356624 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
NZ_CP021339_1 1.1|3356532|32|NZ_CP021339|CRT 3356532-3356563 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
NZ_CP021339_1 1.1|3356532|32|NZ_CP021339|CRT 3356532-3356563 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
NZ_CP021339_2 2.1|3382567|32|NZ_CP021339|CRISPRCasFinder 3382567-3382598 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
NZ_CP021339_1 1.1|3356532|32|NZ_CP021339|CRT 3356532-3356563 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
NZ_CP021339_1 1.3|3356654|32|NZ_CP021339|CRT,PILER-CR,CRISPRCasFinder 3356654-3356685 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
NZ_CP021339_1 1.4|3356715|32|NZ_CP021339|CRT,PILER-CR,CRISPRCasFinder 3356715-3356746 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
NZ_CP021339_1 1.4|3356715|32|NZ_CP021339|CRT,PILER-CR,CRISPRCasFinder 3356715-3356746 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719

1. spacer 1.1|3356532|32|NZ_CP021339|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

2. spacer 1.2|3356593|32|NZ_CP021339|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

3. spacer 1.1|3356532|32|NZ_CP021339|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

4. spacer 1.1|3356532|32|NZ_CP021339|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

5. spacer 2.1|3382567|32|NZ_CP021339|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

-gacagaacggcctcagtagtctcgtcaggctc	CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt	Protospacer
  ** *  .****.******.***********.

6. spacer 1.1|3356532|32|NZ_CP021339|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

7. spacer 1.3|3356654|32|NZ_CP021339|CRT,PILER-CR,CRISPRCasFinder matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

gagagtgctgacaggtgtctcgattacctgat	CRISPR spacer
ggctttgctggcaggtctctcgattaccttgg	Protospacer
*.   *****.***** ************ . 

8. spacer 1.4|3356715|32|NZ_CP021339|CRT,PILER-CR,CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
atcggcaatatcacggcgtttttcggcgccgc	Protospacer
.   ****************.* **** .** 

9. spacer 1.4|3356715|32|NZ_CP021339|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
accggcaacatcacggcgttcttcggcgccgc	Protospacer
.   ****.************* **** .** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 327622 : 338499 10 Enterobacteria_phage(25.0%) transposase,integrase attL 321214:321227|attR 335121:335134
DBSCAN-SWA_2 552101 : 631998 69 Escherichia_phage(33.33%) transposase,tRNA,head,tail,protease,capsid NA
DBSCAN-SWA_3 851545 : 882991 39 Enterobacteria_phage(58.82%) transposase,integrase,holin,head,tail,capsid attL 846138:846154|attR 875307:875323
DBSCAN-SWA_4 1095286 : 1135404 52 Escherichia_phage(30.77%) holin,transposase,protease,lysis NA
DBSCAN-SWA_5 1349956 : 1419575 78 Stx2-converting_phage(39.62%) transposase,integrase,tRNA,holin,capsid,head,tail,terminase attL 1364830:1364846|attR 1406314:1406330
DBSCAN-SWA_6 1520791 : 1544942 32 Escherichia_phage(35.48%) tail,holin NA
DBSCAN-SWA_7 1830769 : 1927993 103 Escherichia_phage(27.08%) integrase,tail,transposase,protease attL 1863255:1863270|attR 1931857:1931872
DBSCAN-SWA_8 2003109 : 2087011 82 Enterobacteria_phage(66.67%) integrase,transposase,tRNA,holin,capsid,head,portal,tail,plate,terminase attL 2047876:2047900|attR 2079652:2079676
DBSCAN-SWA_9 2149015 : 2257500 119 Escherichia_phage(32.81%) transposase,integrase,tRNA,holin,head,terminase,tail,protease,capsid attL 2215522:2215538|attR 2255482:2255498
DBSCAN-SWA_10 2359898 : 2449331 104 Enterobacteria_phage(33.33%) transposase,integrase,holin,head,terminase,portal,tail,capsid attL 2390652:2390669|attR 2450001:2450018
DBSCAN-SWA_11 2698506 : 2758151 46 Escherichia_phage(17.86%) integrase,transposase,holin,protease,lysis attL 2710906:2710941|attR 2740867:2740902
DBSCAN-SWA_12 2816424 : 2958228 152 Escherichia_phage(48.18%) integrase,transposase,tRNA,holin,terminase,head,portal,tail,plate,capsid attL 2834753:2834812|attR 2954548:2955860
DBSCAN-SWA_13 3183318 : 3261686 78 Enterobacteria_phage(62.22%) tRNA,holin,portal,tail,protease,terminase NA
DBSCAN-SWA_14 3333074 : 3340214 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_15 4863793 : 4905084 61 Shigella_phage(53.66%) transposase,integrase,head,tail,plate,protease attL 4858534:4858550|attR 4882939:4882955
DBSCAN-SWA_16 4936220 : 4981134 48 Stx2-converting_phage(34.09%) integrase,tRNA,holin,capsid,head,tail,terminase attL 4958476:4958489|attR 4983883:4983896
DBSCAN-SWA_17 5121295 : 5159292 42 Vibrio_phage(11.11%) transposase,tRNA,protease NA
DBSCAN-SWA_18 5164026 : 5284724 152 Escherichia_phage(56.29%) integrase,bacteriocin,holin,capsid,portal,tail,protease,terminase attL 5159309:5159335|attR 5226556:5226582
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP021341
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage