Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP015338 Lactobacillus brevis strain 100D8 chromosome, complete genome 2 crisprs DinG,csa3,cas3,DEDDh 0 5 5 0
NZ_CP015340 Lactobacillus brevis strain 100D8 plasmid unnamed2, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP015339 Lactobacillus brevis strain 100D8 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP015341
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2527 : 37100 49 Lactobacillus_phage(94.59%) terminase,holin,tail,head,portal,integrase,protease,capsid attL 2280:2294|attR 36413:36427
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP015338
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015338_1 793699-794031 Orphan I-E,II-B
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015338_2 1629790-1629940 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015338_1 1.2|793788|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793788-793820 33 MN830254 Lactobacillus phage JNU_P2, complete genome 17234-17266 1 0.97
NZ_CP015338_1 1.2|793788|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793788-793820 33 MN830255 Lactobacillus phage JNU_P4, complete genome 3757-3789 1 0.97
NZ_CP015338_1 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793971-794003 33 NZ_CP014920 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence 5729-5761 1 0.97
NZ_CP015338_1 1.3|793849|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793849-793881 33 NZ_CP014917 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-2, complete sequence 23424-23456 2 0.939
NZ_CP015338_1 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793971-794003 33 MK496698 Capybara microvirus Cap1_SP_87, complete genome 2934-2966 7 0.788
NZ_CP015338_1 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793971-794003 33 NC_017296 Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence 62340-62372 7 0.788
NZ_CP015338_1 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793971-794003 33 NC_015686 Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence 62340-62372 7 0.788
NZ_CP015338_1 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793971-794003 33 NC_001988 Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence 62340-62372 7 0.788
NZ_CP015338_1 1.1|793727|33|NZ_CP015338|CRISPRCasFinder,CRT 793727-793759 33 KY979109 Salmonella phage SHP1, complete genome 32802-32834 8 0.758
NZ_CP015338_1 1.1|793727|33|NZ_CP015338|CRISPRCasFinder,CRT 793727-793759 33 NC_019500 Enterobacteria phage Bp7, complete genome 22258-22290 8 0.758
NZ_CP015338_2 2.2|1629880|33|NZ_CP015338|CRISPRCasFinder 1629880-1629912 33 NC_002669 Lactococcus prophage bIL310, complete genome 2468-2500 8 0.758
NZ_CP015338_2 2.2|1629880|33|NZ_CP015338|CRISPRCasFinder 1629880-1629912 33 AF323671 Bacteriophage bIL310, complete genome 2468-2500 8 0.758
NZ_CP015338_1 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793971-794003 33 NZ_CP047434 Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6 89325-89357 10 0.697
NZ_CP015338_1 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793971-794003 33 NZ_CP047434 Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6 98643-98675 10 0.697
NZ_CP015338_1 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793971-794003 33 NZ_LR214978 Mycoplasma cynos strain NCTC10142 plasmid 5 6-38 10 0.697
NZ_CP015338_1 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR 793971-794003 33 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 771862-771894 10 0.697

1. spacer 1.2|793788|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to MN830254 (Lactobacillus phage JNU_P2, complete genome) position: , mismatch: 1, identity: 0.97

tgacaaccaaaaaatatacgactttaacttctg	CRISPR spacer
tggcaaccaaaaaatatacgactttaacttctg	Protospacer
**.******************************

2. spacer 1.2|793788|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to MN830255 (Lactobacillus phage JNU_P4, complete genome) position: , mismatch: 1, identity: 0.97

tgacaaccaaaaaatatacgactttaacttctg	CRISPR spacer
tggcaaccaaaaaatatacgactttaacttctg	Protospacer
**.******************************

3. spacer 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014920 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence) position: , mismatch: 1, identity: 0.97

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gatgaataagaaaagaaaacaagataatacgca	Protospacer
**********************.**********

4. spacer 1.3|793849|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014917 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-2, complete sequence) position: , mismatch: 2, identity: 0.939

cggaaagtttaaatctattaaagacgcacaata	CRISPR spacer
cggaaagttcaaatctattaaggacgcacaata	Protospacer
*********.***********.***********

5. spacer 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to MK496698 (Capybara microvirus Cap1_SP_87, complete genome) position: , mismatch: 7, identity: 0.788

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gatgaataataaaagaaaataaaataaactaaa	Protospacer
********* *********.*******  .. *

6. spacer 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to NC_017296 (Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence) position: , mismatch: 7, identity: 0.788

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gaataataagaaaagaaaaacaaataatataaa	Protospacer
**  ***************  ********.. *

7. spacer 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to NC_015686 (Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence) position: , mismatch: 7, identity: 0.788

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gaataataagaaaagaaaaacaaataatataaa	Protospacer
**  ***************  ********.. *

8. spacer 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to NC_001988 (Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence) position: , mismatch: 7, identity: 0.788

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gaataataagaaaagaaaaacaaataatataaa	Protospacer
**  ***************  ********.. *

9. spacer 1.1|793727|33|NZ_CP015338|CRISPRCasFinder,CRT matches to KY979109 (Salmonella phage SHP1, complete genome) position: , mismatch: 8, identity: 0.758

gcttaaaatcaagcagtcgttgggctacgtcaa	CRISPR spacer
tcttaacatcaagcagtcgtttggcattatcac	Protospacer
 ***** ************** ***  ..*** 

10. spacer 1.1|793727|33|NZ_CP015338|CRISPRCasFinder,CRT matches to NC_019500 (Enterobacteria phage Bp7, complete genome) position: , mismatch: 8, identity: 0.758

gcttaaaatcaagcagtcgttgggctacgtcaa	CRISPR spacer
tcttaacatcaagcagtcgtttggcattatcac	Protospacer
 ***** ************** ***  ..*** 

11. spacer 2.2|1629880|33|NZ_CP015338|CRISPRCasFinder matches to NC_002669 (Lactococcus prophage bIL310, complete genome) position: , mismatch: 8, identity: 0.758

accgttatgggtctgagccataacgaatttgga	CRISPR spacer
attgttatgggtttgagccataacaaaatgata	Protospacer
*..*********.***********.** * . *

12. spacer 2.2|1629880|33|NZ_CP015338|CRISPRCasFinder matches to AF323671 (Bacteriophage bIL310, complete genome) position: , mismatch: 8, identity: 0.758

accgttatgggtctgagccataacgaatttgga	CRISPR spacer
attgttatgggtttgagccataacaaaatgata	Protospacer
*..*********.***********.** * . *

13. spacer 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047434 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6) position: , mismatch: 10, identity: 0.697

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gtattataagaaaagaaaaaagaataataaaag	Protospacer
*    ************** *.******* . .

14. spacer 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047434 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6) position: , mismatch: 10, identity: 0.697

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gtattataagaaaagaaaaaagaataataaaag	Protospacer
*    ************** *.******* . .

15. spacer 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214978 (Mycoplasma cynos strain NCTC10142 plasmid 5) position: , mismatch: 10, identity: 0.697

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
atagaataagaaaagaaaacaacaaaaacatta	Protospacer
.  ******************* * **    .*

16. spacer 1.5|793971|33|NZ_CP015338|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 10, identity: 0.697

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
atagaataagaaaagaaaacaacaaaaacatta	Protospacer
.  ******************* * **    .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3349 : 15595 22 Lactobacillus_phage(83.33%) integrase attL 9377:9390|attR 19146:19159
DBSCAN-SWA_2 1617370 : 1629765 15 Lactobacillus_phage(28.57%) terminase,integrase,portal,head,capsid attL 1611826:1611841|attR 1634837:1634852
DBSCAN-SWA_3 2041522 : 2050754 9 Staphylococcus_phage(42.86%) tRNA NA
DBSCAN-SWA_4 2311693 : 2337323 32 Lactobacillus_phage(100.0%) plate,tail,terminase,capsid NA
DBSCAN-SWA_5 2341257 : 2351266 20 Lactobacillus_phage(81.82%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage