Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019753 Lactobacillus brevis strain TMW 1.2113 plasmid pl12113-3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP019754 Lactobacillus brevis strain TMW 1.2113 plasmid pl12113-4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP019750 Lactobacillus brevis strain TMW 1.2113 chromosome, complete genome 2 crisprs cas2,csn2,DinG,csa3,DEDDh,cas3 0 11 3 0
NZ_CP019751 Lactobacillus brevis strain TMW 1.2113 plasmid pl12113-1, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP019752 Lactobacillus brevis strain TMW 1.2113 plasmid pl12113-2, complete sequence 0 crisprs NA 0 0 2 0

Results visualization

1. NZ_CP019750
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019750_1 10605-10731 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019750_2 217436-218131 TypeII-A NA
10 spacers
csn2,cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019750_2 2.12|217538|30|NZ_CP019750|CRISPRCasFinder,CRT 217538-217567 30 MN830254 Lactobacillus phage JNU_P2, complete genome 3717-3746 1 0.967
NZ_CP019750_2 2.12|217538|30|NZ_CP019750|CRISPRCasFinder,CRT 217538-217567 30 MN830255 Lactobacillus phage JNU_P4, complete genome 39261-39290 1 0.967
NZ_CP019750_2 2.20|218066|30|NZ_CP019750|CRISPRCasFinder,CRT 218066-218095 30 MK504446 Lactobacillus phage SAC12B, complete genome 117378-117407 1 0.967
NZ_CP019750_2 2.20|218066|30|NZ_CP019750|CRISPRCasFinder,CRT 218066-218095 30 MN830254 Lactobacillus phage JNU_P2, complete genome 43134-43163 1 0.967
NZ_CP019750_2 2.20|218066|30|NZ_CP019750|CRISPRCasFinder,CRT 218066-218095 30 MN830255 Lactobacillus phage JNU_P4, complete genome 29657-29686 1 0.967
NZ_CP019750_2 2.2|217537|31|NZ_CP019750|PILER-CR 217537-217567 31 MN830254 Lactobacillus phage JNU_P2, complete genome 3716-3746 2 0.935
NZ_CP019750_2 2.2|217537|31|NZ_CP019750|PILER-CR 217537-217567 31 MN830255 Lactobacillus phage JNU_P4, complete genome 39260-39290 2 0.935
NZ_CP019750_2 2.10|218065|31|NZ_CP019750|PILER-CR 218065-218095 31 MK504446 Lactobacillus phage SAC12B, complete genome 117378-117408 2 0.935
NZ_CP019750_2 2.10|218065|31|NZ_CP019750|PILER-CR 218065-218095 31 MN830254 Lactobacillus phage JNU_P2, complete genome 43134-43164 2 0.935
NZ_CP019750_2 2.10|218065|31|NZ_CP019750|PILER-CR 218065-218095 31 MN830255 Lactobacillus phage JNU_P4, complete genome 29657-29687 2 0.935
NZ_CP019750_2 2.7|217867|31|NZ_CP019750|PILER-CR 217867-217897 31 NC_013384 Staphylococcus epidermidis plasmid SAP110B, complete sequence 355-385 6 0.806
NZ_CP019750_2 2.11|217472|30|NZ_CP019750|CRISPRCasFinder,CRT 217472-217501 30 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 646916-646945 6 0.8
NZ_CP019750_2 2.17|217868|30|NZ_CP019750|CRISPRCasFinder,CRT 217868-217897 30 NC_013384 Staphylococcus epidermidis plasmid SAP110B, complete sequence 356-385 6 0.8
NZ_CP019750_2 2.1|217471|31|NZ_CP019750|PILER-CR 217471-217501 31 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 646915-646945 7 0.774
NZ_CP019750_2 2.14|217670|30|NZ_CP019750|CRISPRCasFinder,CRT 217670-217699 30 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 165551-165580 7 0.767
NZ_CP019750_2 2.17|217868|30|NZ_CP019750|CRISPRCasFinder,CRT 217868-217897 30 NC_004528 Leuconostoc citreum pLC22R plasmid, complete genome 2593-2622 7 0.767
NZ_CP019750_2 2.1|217471|31|NZ_CP019750|PILER-CR 217471-217501 31 NZ_CP041766 Tomitella sp. HY188 plasmid unnamed, complete sequence 18561-18591 8 0.742
NZ_CP019750_2 2.4|217669|31|NZ_CP019750|PILER-CR 217669-217699 31 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 165550-165580 8 0.742
NZ_CP019750_2 2.10|218065|31|NZ_CP019750|PILER-CR 218065-218095 31 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 184884-184914 8 0.742
NZ_CP019750_2 2.11|217472|30|NZ_CP019750|CRISPRCasFinder,CRT 217472-217501 30 NZ_CP041766 Tomitella sp. HY188 plasmid unnamed, complete sequence 18561-18590 8 0.733
NZ_CP019750_2 2.14|217670|30|NZ_CP019750|CRISPRCasFinder,CRT 217670-217699 30 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 166487-166516 8 0.733
NZ_CP019750_2 2.14|217670|30|NZ_CP019750|CRISPRCasFinder,CRT 217670-217699 30 MG969414 UNVERIFIED: Salmonella phage GE_vB_NS7, complete genome 44307-44336 8 0.733
NZ_CP019750_2 2.14|217670|30|NZ_CP019750|CRISPRCasFinder,CRT 217670-217699 30 MK574078 Pseudomonas phage KP1, complete sequence 37487-37516 8 0.733
NZ_CP019750_2 2.19|218000|30|NZ_CP019750|CRISPRCasFinder,CRT 218000-218029 30 NC_047962 Xanthomonas phage Carpasina, complete genome 9906-9935 8 0.733
NZ_CP019750_2 2.4|217669|31|NZ_CP019750|PILER-CR 217669-217699 31 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 166486-166516 9 0.71
NZ_CP019750_2 2.4|217669|31|NZ_CP019750|PILER-CR 217669-217699 31 MG969414 UNVERIFIED: Salmonella phage GE_vB_NS7, complete genome 44307-44337 9 0.71
NZ_CP019750_2 2.10|218065|31|NZ_CP019750|PILER-CR 218065-218095 31 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 335554-335584 9 0.71
NZ_CP019750_2 2.10|218065|31|NZ_CP019750|PILER-CR 218065-218095 31 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 154551-154581 9 0.71
NZ_CP019750_2 2.10|218065|31|NZ_CP019750|PILER-CR 218065-218095 31 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 202590-202620 9 0.71

1. spacer 2.12|217538|30|NZ_CP019750|CRISPRCasFinder,CRT matches to MN830254 (Lactobacillus phage JNU_P2, complete genome) position: , mismatch: 1, identity: 0.967

ctatgcggttgatggtgtgctgtcagtatc	CRISPR spacer
ctatgcggttgatggtgtgttgtcagtatc	Protospacer
*******************.**********

2. spacer 2.12|217538|30|NZ_CP019750|CRISPRCasFinder,CRT matches to MN830255 (Lactobacillus phage JNU_P4, complete genome) position: , mismatch: 1, identity: 0.967

ctatgcggttgatggtgtgctgtcagtatc	CRISPR spacer
ctatgcggttgatggtgtgttgtcagtatc	Protospacer
*******************.**********

3. spacer 2.20|218066|30|NZ_CP019750|CRISPRCasFinder,CRT matches to MK504446 (Lactobacillus phage SAC12B, complete genome) position: , mismatch: 1, identity: 0.967

atattcttcaatcgtatcggcccatgcttt	CRISPR spacer
atattcttcaatcgtatcggcccttgcttt	Protospacer
*********************** ******

4. spacer 2.20|218066|30|NZ_CP019750|CRISPRCasFinder,CRT matches to MN830254 (Lactobacillus phage JNU_P2, complete genome) position: , mismatch: 1, identity: 0.967

atattcttcaatcgtatcggcccatgcttt	CRISPR spacer
atattcttcaatcgtatcggcccatacttt	Protospacer
*************************.****

5. spacer 2.20|218066|30|NZ_CP019750|CRISPRCasFinder,CRT matches to MN830255 (Lactobacillus phage JNU_P4, complete genome) position: , mismatch: 1, identity: 0.967

atattcttcaatcgtatcggcccatgcttt	CRISPR spacer
atattcttcaatcgtatcggcccatacttt	Protospacer
*************************.****

6. spacer 2.2|217537|31|NZ_CP019750|PILER-CR matches to MN830254 (Lactobacillus phage JNU_P2, complete genome) position: , mismatch: 2, identity: 0.935

cctatgcggttgatggtgtgctgtcagtatc	CRISPR spacer
actatgcggttgatggtgtgttgtcagtatc	Protospacer
 *******************.**********

7. spacer 2.2|217537|31|NZ_CP019750|PILER-CR matches to MN830255 (Lactobacillus phage JNU_P4, complete genome) position: , mismatch: 2, identity: 0.935

cctatgcggttgatggtgtgctgtcagtatc	CRISPR spacer
actatgcggttgatggtgtgttgtcagtatc	Protospacer
 *******************.**********

8. spacer 2.10|218065|31|NZ_CP019750|PILER-CR matches to MK504446 (Lactobacillus phage SAC12B, complete genome) position: , mismatch: 2, identity: 0.935

catattcttcaatcgtatcggcccatgcttt	CRISPR spacer
tatattcttcaatcgtatcggcccttgcttt	Protospacer
.*********************** ******

9. spacer 2.10|218065|31|NZ_CP019750|PILER-CR matches to MN830254 (Lactobacillus phage JNU_P2, complete genome) position: , mismatch: 2, identity: 0.935

catattcttcaatcgtatcggcccatgcttt	CRISPR spacer
tatattcttcaatcgtatcggcccatacttt	Protospacer
.*************************.****

10. spacer 2.10|218065|31|NZ_CP019750|PILER-CR matches to MN830255 (Lactobacillus phage JNU_P4, complete genome) position: , mismatch: 2, identity: 0.935

catattcttcaatcgtatcggcccatgcttt	CRISPR spacer
tatattcttcaatcgtatcggcccatacttt	Protospacer
.*************************.****

11. spacer 2.7|217867|31|NZ_CP019750|PILER-CR matches to NC_013384 (Staphylococcus epidermidis plasmid SAP110B, complete sequence) position: , mismatch: 6, identity: 0.806

ccacaatttgaaaaagatcttaacgcgatgt	CRISPR spacer
ccacaattagaaaaagatcttaaagagcttc	Protospacer
******** ************** * * * .

12. spacer 2.11|217472|30|NZ_CP019750|CRISPRCasFinder,CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 6, identity: 0.8

ccaaacgctccccaatgaagaggctctggg	CRISPR spacer
tcaatttctcccgaaggaagaggctctggg	Protospacer
.*** . ***** ** **************

13. spacer 2.17|217868|30|NZ_CP019750|CRISPRCasFinder,CRT matches to NC_013384 (Staphylococcus epidermidis plasmid SAP110B, complete sequence) position: , mismatch: 6, identity: 0.8

cacaatttgaaaaagatcttaacgcgatgt	CRISPR spacer
cacaattagaaaaagatcttaaagagcttc	Protospacer
******* ************** * * * .

14. spacer 2.1|217471|31|NZ_CP019750|PILER-CR matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 7, identity: 0.774

cccaaacgctccccaatgaagaggctctggg	CRISPR spacer
gtcaatttctcccgaaggaagaggctctggg	Protospacer
 .*** . ***** ** **************

15. spacer 2.14|217670|30|NZ_CP019750|CRISPRCasFinder,CRT matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

ttatcggtgcaaccattgccgtcacaactg	CRISPR spacer
gtatcggtgccgccattgccgtcatcgatg	Protospacer
 ********* .************. . **

16. spacer 2.17|217868|30|NZ_CP019750|CRISPRCasFinder,CRT matches to NC_004528 (Leuconostoc citreum pLC22R plasmid, complete genome) position: , mismatch: 7, identity: 0.767

cacaatttgaaaaagatctta---acgcgatgt	CRISPR spacer
cacaatttgaaaaagatattacacgagcaa---	Protospacer
***************** ***   . **.*   

17. spacer 2.1|217471|31|NZ_CP019750|PILER-CR matches to NZ_CP041766 (Tomitella sp. HY188 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

cccaaa---cgctccccaatgaagaggctctggg	CRISPR spacer
---aggttccgctccccgatgaagaggttctgcg	Protospacer
   *..   ********.*********.**** *

18. spacer 2.4|217669|31|NZ_CP019750|PILER-CR matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

cttatcggtgcaaccattgccgtcacaactg	CRISPR spacer
ggtatcggtgccgccattgccgtcatcgatg	Protospacer
  ********* .************. . **

19. spacer 2.10|218065|31|NZ_CP019750|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 8, identity: 0.742

catattcttcaatcgtatcggcccatgcttt	CRISPR spacer
catagtcttcaagcgtatcggccagttgctc	Protospacer
**** ******* ********** .*  .*.

20. spacer 2.11|217472|30|NZ_CP019750|CRISPRCasFinder,CRT matches to NZ_CP041766 (Tomitella sp. HY188 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

ccaaacgctccccaatgaagaggctctggg	CRISPR spacer
ggttccgctccccgatgaagaggttctgcg	Protospacer
     ********.*********.**** *

21. spacer 2.14|217670|30|NZ_CP019750|CRISPRCasFinder,CRT matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

ttatcggtgcaaccattgccgtcacaactg	CRISPR spacer
atatcggtgccgccattgccgtcatcgacg	Protospacer
 ********* .************. . .*

22. spacer 2.14|217670|30|NZ_CP019750|CRISPRCasFinder,CRT matches to MG969414 (UNVERIFIED: Salmonella phage GE_vB_NS7, complete genome) position: , mismatch: 8, identity: 0.733

ttatcggtgcaaccattgccgtcacaactg	CRISPR spacer
ctccaagtgcaaccattgctttcacaactc	Protospacer
.* . .*************. ******** 

23. spacer 2.14|217670|30|NZ_CP019750|CRISPRCasFinder,CRT matches to MK574078 (Pseudomonas phage KP1, complete sequence) position: , mismatch: 8, identity: 0.733

ttatcggtgcaaccattgccgtcacaactg	CRISPR spacer
aaattattgcaactattgccgtcacaacga	Protospacer
  **.. ******.************** .

24. spacer 2.19|218000|30|NZ_CP019750|CRISPRCasFinder,CRT matches to NC_047962 (Xanthomonas phage Carpasina, complete genome) position: , mismatch: 8, identity: 0.733

atatcgtcccggtcttcccagttgccatct	CRISPR spacer
acgatttcctggtcttcccagttgccaacc	Protospacer
*.. . ***.***************** *.

25. spacer 2.4|217669|31|NZ_CP019750|PILER-CR matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

cttatcggtgcaaccattgccgtcacaactg	CRISPR spacer
gatatcggtgccgccattgccgtcatcgacg	Protospacer
  ********* .************. . .*

26. spacer 2.4|217669|31|NZ_CP019750|PILER-CR matches to MG969414 (UNVERIFIED: Salmonella phage GE_vB_NS7, complete genome) position: , mismatch: 9, identity: 0.71

cttatcggtgcaaccattgccgtcacaactg	CRISPR spacer
tctccaagtgcaaccattgctttcacaactc	Protospacer
..* . .*************. ******** 

27. spacer 2.10|218065|31|NZ_CP019750|PILER-CR matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 9, identity: 0.71

catattcttcaatcgtatcggcccatgcttt	CRISPR spacer
catagtcttcaagcgtatcggccagctgctc	Protospacer
**** ******* ********** ..  .*.

28. spacer 2.10|218065|31|NZ_CP019750|PILER-CR matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 9, identity: 0.71

catattcttcaatcgtatcggcccatgcttt	CRISPR spacer
catagtcttcaagcgtatcggccagctgctc	Protospacer
**** ******* ********** ..  .*.

29. spacer 2.10|218065|31|NZ_CP019750|PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 9, identity: 0.71

catattcttcaatcgtatcggcccatgcttt	CRISPR spacer
catagtcttcaagcgtatcggccagctgctc	Protospacer
**** ******* ********** ..  .*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 870913 : 995836 159 Lactobacillus_phage(80.81%) terminase,protease,integrase,plate,capsid,tail,transposase attL 870691:870711|attR 991467:991487
DBSCAN-SWA_2 1275918 : 1285172 9 Staphylococcus_phage(42.86%) tRNA NA
DBSCAN-SWA_3 1742936 : 1749164 9 Staphylococcus_phage(16.67%) integrase attL 1733593:1733611|attR 1757345:1757363
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP019751
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 8948 7 unidentified_phage(40.0%) transposase NA
DBSCAN-SWA_2 18616 : 20752 1 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP019752
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 28230 24 unidentified_phage(30.0%) holin,transposase NA
DBSCAN-SWA_2 32550 : 33480 1 unidentified_phage(100.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage