1. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 4.15|1580004|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 4.15|1580004|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 4.15|1580004|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 4.15|1580004|22|NZ_CP017595|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 1.10|343015|24|NZ_CP017595|CRT matches to AWQW01000318 (Streptomyces niveus NCIMB 11891 plasmid pSniv4, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.917
ccgttgccgatgagcccgccggcg CRISPR spacer
ccggtgcggatgagcccgccggcg Protospacer
*** *** ****************
9. spacer 4.2|1579078|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
10. spacer 4.2|1579078|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
11. spacer 4.2|1579078|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
12. spacer 4.2|1579078|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
13. spacer 4.2|1579078|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
14. spacer 4.3|1579132|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
15. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
16. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
17. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
18. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
19. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
20. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
23. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
24. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
25. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
26. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
27. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
28. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
29. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
30. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
31. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
32. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
33. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
34. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
35. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
36. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
37. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
38. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
39. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
40. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
41. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 2, identity: 0.923
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaaaggcggcaacggcgg Protospacer
******************* *****
42. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
43. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
gcgttgcggctgagcccgccggcg Protospacer
****** * **************
44. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
45. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
46. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
47. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
48. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
49. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
50. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
51. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
52. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
53. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
54. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
55. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
56. spacer 1.10|343015|24|NZ_CP017595|CRT matches to MT188704 (Mesorhizobium phage Cp1R7A-A1, complete genome) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgccgatgcgcccgccgaca Protospacer
************ ********.*.
57. spacer 1.10|343015|24|NZ_CP017595|CRT matches to KR080200 (Mycobacterium phage AlanGrant, complete genome) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
tcgttgccgatgaccccgccgccg Protospacer
.************ ******* **
58. spacer 1.10|343015|24|NZ_CP017595|CRT matches to KR080194 (Mycobacterium phage Vincenzo, complete genome) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
tcgttgccgatgaccccgccgccg Protospacer
.************ ******* **
59. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
60. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
61. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
62. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
63. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
64. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
65. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
66. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
67. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
68. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgatgccgatgatcccgccggcc Protospacer
*** ********* *********
69. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
70. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
71. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
72. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
73. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
74. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
gcgttgcggctgagcccgccggcg Protospacer
****** * **************
75. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
76. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
tcgttgccgatcagcccgcgggcg Protospacer
.********** ******* ****
77. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
78. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
79. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
80. spacer 4.4|1579186|22|NZ_CP017595|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
81. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
82. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
83. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
84. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
85. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
86. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
87. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
88. spacer 4.15|1580004|22|NZ_CP017595|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
89. spacer 5.5|2077518|24|NZ_CP017595|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
90. spacer 5.5|2077518|24|NZ_CP017595|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
91. spacer 11.19|3969424|26|NZ_CP017595|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.885
gccggcggtagcggcggggccaactt CRISPR spacer
gccggcggtatcggcgggcccaactg Protospacer
********** ******* ******
92. spacer 11.19|3969424|26|NZ_CP017595|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 3, identity: 0.885
gccggcggtagcggcggggccaactt CRISPR spacer
gccggcggtatcggcgggcccaactg Protospacer
********** ******* ******
93. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
ctcggcggcaaaggcggcattggcgg Protospacer
.****************** *****
94. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
cccggcggcaaaggcgcaatgggcgg Protospacer
*************** ********
95. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
atcggcggcaagggcggcatggccgg Protospacer
*.*********.********** ***
96. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaagggcgg Protospacer
* ********* ******* ******
97. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MG944221 (Mycobacterium phage Scowl, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaagggcgg Protospacer
* ********* ******* ******
98. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to KT309034 (Mycobacterium phage Dante, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaagggcgg Protospacer
* ********* ******* ******
99. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_021538 (Mycobacterium phage Job42, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaagggcgg Protospacer
* ********* ******* ******
100. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_026584 (Mycobacterium phage Minerva, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaagggcgg Protospacer
* ********* ******* ******
101. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to KJ409696 (Mycobacterium phage Lamina13, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaggggcgg Protospacer
* ********* ******* ******
102. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_028784 (Mycobacterium phage Tasp14, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaggggcgg Protospacer
* ********* ******* ******
103. spacer 1.10|343015|24|NZ_CP017595|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 4, identity: 0.833
ccgttgccgatgagcccgccggcg CRISPR spacer
gctgcgccgatgagcccgccggcg Protospacer
* .*******************
104. spacer 2.1|370925|27|NZ_CP017595|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
105. spacer 2.1|370925|27|NZ_CP017595|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
106. spacer 2.7|371321|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
107. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
108. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
109. spacer 4.1|1579018|28|NZ_CP017595|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
110. spacer 4.1|1579018|28|NZ_CP017595|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
111. spacer 4.1|1579018|28|NZ_CP017595|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
112. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
113. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
114. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
115. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
116. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
117. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
118. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
119. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
120. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
121. spacer 5.5|2077518|24|NZ_CP017595|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
122. spacer 5.5|2077518|24|NZ_CP017595|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
123. spacer 5.5|2077518|24|NZ_CP017595|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
124. spacer 11.19|3969424|26|NZ_CP017595|CRT matches to NZ_CP047220 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846
gccggcggtagcggcggggccaactt CRISPR spacer
gccggcggtagcggcgtggcaaaaat Protospacer
**************** *** ** *
125. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP013224 (Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
126. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KX470734 (Escherichia coli strain Ecoli14-55 plasmid pEC55-NDM4, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
127. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KY296103 (Enterobacter cloacae strain 13E169 plasmid pHN84NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
128. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KY978629 (Cronobacter sakazakii strain 505108 plasmid p505108-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
129. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF072961 (Citrobacter freundii strain P10159 plasmid pP10159-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
130. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF042356 (Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
131. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF042359 (Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
132. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KU726616 (Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
133. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KU314941 (Klebsiella pneumoniae isolate KP04 plasmid pKP04NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
134. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KX094555 (Escherichia coli strain ZHDC33 plasmid pZHDC33, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
135. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
136. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KR059864 (Klebsiella pneumoniae strain KP-YQ13450 plasmid pYQ12450, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
137. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KP987216 (Citrobacter freundii strain 112298 plasmid p112298-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
138. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP022126 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
139. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
140. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
141. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
142. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
143. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
144. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
145. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP028560 (Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
146. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
147. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
148. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_019153 (Klebsiella pneumoniae plasmid pNDM-KN, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
149. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_019162 (Klebsiella pneumoniae strain CRE380 plasmid pNDM-HN380, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
150. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
151. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP018817 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
152. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ctcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
153. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ctcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
154. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
155. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
156. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
157. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
158. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP021206 (Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
159. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
160. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
161. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_020811 (Klebsiella pneumoniae strain KPN5047 plasmid pKPN5047, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
162. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
163. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
164. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_023914 (Enterobacter cloacae strain CRE727 plasmid pNDM-HF727, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
165. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
166. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
167. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_019123 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
168. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
169. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN178638 (Kluyvera cryocrescens strain SCW13 plasmid pNDM1_SCW13, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
170. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP038280 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
171. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
172. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to CP050158 (Enterobacter cloacae plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
173. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
174. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to CP050161 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
175. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
176. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_021501 (Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
177. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
178. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP023914 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
179. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP029386 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
180. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaaagcggcctgggcgg Protospacer
. **********.***** *******
181. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
182. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
183. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
184. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtcggcggcaatggcggcgtgggcgg Protospacer
..********* ******.*******
185. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_020552 (Citrobacter freundii plasmid pYE315203, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
186. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP040598 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
187. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP014297 (Klebsiella pneumoniae strain KP38731 plasmid unnamed13 sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
188. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaatggcggcattggcct Protospacer
*********** ******** ***
189. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP020056 (Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
190. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP031884 (Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
191. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
192. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
193. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
194. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP041229 (Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
195. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
196. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
197. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
198. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MK372385 (Morganella morganii strain ABC140 plasmid pABC140-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
199. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MK372381 (Klebsiella pneumoniae strain ABC52 plasmid pABC52-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
200. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
201. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
202. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
203. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH909333 (Klebsiella pneumoniae strain 7-SP plasmid p7SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
204. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH909346 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
205. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH909335 (Klebsiella pneumoniae strain 11-SP plasmid p11SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
206. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH234505 (Escherichia coli strain CRE3694 plasmid pNDM-HK3694, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
207. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH917282 (Klebsiella pneumoniae strain A457 plasmid pA457-NDA, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
208. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH349095 (Escherichia coli strain 948 plasmid pMTC948, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
209. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MK372386 (Klebsiella pneumoniae strain BC700 plasmid pBC700-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
210. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MK372380 (Enterobacter cloacae strain ABC40 plasmid pABC40-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
211. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MK372382 (Escherichia coli strain ABC54 plasmid pABC54-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
212. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
213. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN657242 (Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
214. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
215. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN657244 (Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
216. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN657247 (Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
217. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
218. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
219. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH105052 (Escherichia coli strain EC600 plasmid pSL131T_IncX3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
220. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP044464 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
221. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF042350 (Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
222. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF042354 (Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
223. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF042353 (Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
224. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF042351 (Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
225. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF042358 (Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
226. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF415608 (Enterobacter cloacae strain hhy03 plasmid pNDM-BJ03, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
227. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF042352 (Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
228. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF042357 (Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
229. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MG252893 (Raoultella ornithinolytica strain pRor-30818cz plasmid Ror-30818cz, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
230. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP041048 (Citrobacter sp. CF971 plasmid pBM527-2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
231. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
232. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KX786648 (Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
233. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KY399975 (Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
234. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KY399974 (Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
235. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
236. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
237. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP034756 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
238. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
239. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
240. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
241. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KJ588779 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
242. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KR351290 (Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
243. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KJ802405 (Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
244. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KJ812998 (Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
245. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KP900016 (Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
246. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KP765744 (Enterobacter cloacae strain ECN49 plasmid pNDM-ECN49, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
247. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KP868647 (Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
248. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KJ802404 (Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
249. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KT965092 (Acinetobacter towneri strain G165 plasmid pNDM-GJ01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
250. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KT965093 (Acinetobacter towneri strain G295 plasmid pNDM-GJ02, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
251. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
252. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_023322 (Acinetobacter bereziniae strain CHI-40-1 plasmid pNDM-40-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
253. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
254. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
255. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KC887916 (Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
256. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_KC887917 (Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
257. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP020524 (Escherichia coli strain 190 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
258. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
259. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
260. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP010370 (Acinetobacter nosocomialis strain 6411 plasmid p6411-9.012kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
261. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP013221 (Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
262. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
263. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN061454 (Enterobacter cloacae strain EC-14-60 plasmid pECL-14-60-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
264. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP032278 (Acinetobacter sp. WCHAc010034 plasmid pNDM1_010034, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
265. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP045561 (Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
266. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_019045 (Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
267. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_025130 (Raoultella planticola strain RJA274 plasmid NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
268. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_019158 (Klebsiella pneumoniae plasmid pNDM10469, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
269. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN310375 (Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
270. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN310377 (Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
271. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
272. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
273. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP037965 (Klebsiella pneumoniae strain SCKP020135 plasmid pNDM1_020135, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
274. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_025184 (Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
275. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcagaggcggcaagggcgg Protospacer
. ********.******** ******
276. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
277. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP021962 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
278. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP022350 (Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
279. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP046274 (Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
280. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP039811 (Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
281. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
282. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ctcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
283. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_025000 (Acinetobacter lwoffii strain Iz4b plasmid pNDM-Iz4b, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
284. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_024959 (Acinetobacter calcoaceticus strain NDM-WS2 plasmid pNDM-WS2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
285. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
286. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP012168 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
287. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
288. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP010399 (Acinetobacter baumannii strain 6200 plasmid p6200-47.274kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
289. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP035935 (Acinetobacter cumulans strain WCHAc060092 plasmid pNDM1_060092, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
290. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP006661 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
291. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaaggcggcaagagcgg Protospacer
. ***************** *.****
292. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
293. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to CP050164 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
294. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MK933278 (Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
295. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
296. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaacgcggcctgggcgg Protospacer
. ********** ***** *******
297. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to CP048298 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
298. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
299. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_019069 (Escherichia coli plasmid pNDM10505, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
300. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to AMXH01000087 (Acinetobacter pittii strain XM1570 plasmid pXM1, complete sequence, whole genome shotgun sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
301. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_JQ739158 (Acinetobacter lwoffii strain ABZ78 plasmid pABZ78, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
302. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
303. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_019985 (Acinetobacter baumannii ZW85-1 plasmid pAbNDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
304. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
305. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP018366 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
306. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP023187 (Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
307. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_021813 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
308. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP028786 (Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
309. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP021936 (Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
310. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
311. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
312. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP041938 (Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
313. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
314. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
315. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP015835 (Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
316. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
317. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP014478 (Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
318. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_023908 (Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
319. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
320. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_019268 (Acinetobacter lwoffii plasmid pNDM-BJ01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
321. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_019281 (Acinetobacter lwoffii plasmid pNDM-BJ02, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
322. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_025116 (Acinetobacter sp. M131 plasmid pM131_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
323. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP040884 (Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
324. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP026015 (Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
325. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
326. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ctcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
327. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP048797 (Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
328. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN937240 (Enterobacter cloacae strain BSI034 plasmid pBSI034-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
329. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
330. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN603981 (Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
331. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
332. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_LN833432 (Acinetobacter baumannii isolate CHI-32 plasmid pNDM-32, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
333. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MK123268 (Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
334. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
335. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP032132 (Acinetobacter chinensis strain WCHAc010005 plasmid pNDM1_010005, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
336. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH995508 (Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
337. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH995506 (Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
338. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH917283 (Klebsiella pneumoniae strain A575 plasmid pA575-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
339. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH909345 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
340. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
341. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH909343 (Klebsiella pneumoniae strain 1012018 plasmid p12018-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
342. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH909347 (Klebsiella pneumoniae strain 362713 plasmid p362713-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
343. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH263652 (Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
344. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MH917281 (Klebsiella pneumoniae strain 14504 plasmid p14504-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
345. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MK101346 (Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
346. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
347. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP020090 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
348. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
349. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
350. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MF344560 (Enterobacter hormaechei strain 128379 plasmid p128379-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
351. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MG462729 (Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
352. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP035537 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
353. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
354. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
355. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
356. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
357. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MK994522 (Methanobacterium virus PhiF1, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaaggcggcaagggagg Protospacer
. ***************** *** **
358. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
359. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
360. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
361. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
362. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
363. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcatgggcggcatgggcgg Protospacer
*. ******* .**************
364. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
365. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
aagggcggcaagggcggcatcggcgg Protospacer
* ********.******** *****
366. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
cctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
367. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
368. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcatgggcggcatgggcgg Protospacer
*. ******* .**************
369. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
aagggcggcaatggcggcatcggcgg Protospacer
* ******** ******** *****
370. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
tcaggcggcaaaggcggcagcggcgg Protospacer
* **************** *****
371. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
gcgggcggcacagccggcatgggcgg Protospacer
.* ******* ** ************
372. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcatgggcggcatgggcgg Protospacer
* ******* .**************
373. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
tcaggcggcaaaggcggcagcggcgg Protospacer
* **************** *****
374. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
tcaggcggcaaaggcggcagcggcgg Protospacer
* **************** *****
375. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
cctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
376. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
gcgggcggcaacggcggcaggggcgg Protospacer
.* ******** ******* ******
377. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcaagggcggcaagggcgg Protospacer
*. ********.******* ******
378. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcatgggcggcatgggcgg Protospacer
*. ******* .**************
379. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcatgggcggcatgggcgg Protospacer
*. ******* .**************
380. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcatgggcggcatgggcgg Protospacer
*. ******* .**************
381. spacer 2.1|370925|27|NZ_CP017595|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
382. spacer 2.1|370925|27|NZ_CP017595|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
383. spacer 2.7|371321|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
384. spacer 2.7|371321|27|NZ_CP017595|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
385. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
386. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
387. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
388. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
389. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
390. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
391. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
392. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
393. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
394. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
395. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
396. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
397. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
398. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
399. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
400. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
401. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
402. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
403. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
404. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
405. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
406. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
407. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
408. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
409. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
410. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
411. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
412. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
413. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
414. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
415. spacer 4.1|1579018|28|NZ_CP017595|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
416. spacer 4.1|1579018|28|NZ_CP017595|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
417. spacer 4.1|1579018|28|NZ_CP017595|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
418. spacer 4.1|1579018|28|NZ_CP017595|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
419. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
420. spacer 4.5|1579240|25|NZ_CP017595|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
421. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
422. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
423. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
424. spacer 4.13|1579882|34|NZ_CP017595|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
425. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 5, identity: 0.844
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
agcagcgccaccggcggggccggcggcgactc Protospacer
*. .*** *****************.******
426. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.857
agcagcggtgccggcggcaccaacggctccggcgg- CRISPR spacer
cgcatcggtgccggcggcaccatcggc-acggcggc Protospacer
*** ***************** **** ******
427. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 5, identity: 0.844
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
agcagcgccaccggcggggccggcggcgactc Protospacer
*. .*** *****************.******
428. spacer 11.19|3969424|26|NZ_CP017595|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 5, identity: 0.808
gccggcggtagcggcggggccaactt CRISPR spacer
cccggcggcagcggcggggccgacaa Protospacer
*******.************.**
429. spacer 11.19|3969424|26|NZ_CP017595|CRT matches to MK510999 (Pseudomonas phage BR58, partial genome) position: , mismatch: 5, identity: 0.808
gccggcggtagcggcggggccaactt CRISPR spacer
gccggcggtagcggcggttccaaggc Protospacer
***************** **** .
430. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggccaaggcggcatcggcgc Protospacer
. ******* ********** ****
431. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaaaggcggcatccacct Protospacer
******************** .*
432. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gacggcggcgaaggcggcacgggcgc Protospacer
. *******.*********.*****
433. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_007713 (Sodalis glossinidius str. 'morsitans' plasmid pSG1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
cccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
434. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
atcgtcggcaaaggcggcatggggcc Protospacer
*.** ******************
435. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaaggtggcatcggcga Protospacer
. ************.***** ****.
436. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gccggcggcaatgtcggcatgggcac Protospacer
.********** * **********.
437. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_LN854558 (Sodalis glossinidius str. 'morsitans' isolate B4 plasmid pSG1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
cccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
438. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gccggcggcaaaggcggcatctgtgt Protospacer
.******************* *.*
439. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
atcgtcggcaaaggcggcatggggcc Protospacer
*.** ******************
440. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcgacggcggcatgggcgt Protospacer
. *******.* *************
441. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_007182 (Sodalis glossinidius pSG1 plasmid from Glossina austeni) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
cccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
442. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_007183 (Sodalis glossinidius pSG1 plasmid from Glossina palpalis palpalis) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
cccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
443. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaacggcggcatcgggca Protospacer
*********** ******** ** .
444. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
acaggcggcaagggcggcatgggtca Protospacer
** ********.***********. .
445. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaccggcggcatgggcaa Protospacer
********* ************..
446. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_042098 (Erwinia phage vB_EamM_Desertfox, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
447. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MG655267 (Erwinia phage vB_EamM_Bosolaphorus, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
448. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MG655269 (Erwinia phage vB_EamM_MadMel, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
449. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to KF806589 (Erwinia phage Ea35-70, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
450. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to KU886223 (Erwinia phage vB_EamM_Simmy50, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
451. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaacggcggcatcgggca Protospacer
*********** ******** ** .
452. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
453. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcacaggcggcacgggcgg Protospacer
.. ******* ********.******
454. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaacggcggcatcgggca Protospacer
*********** ******** ** .
455. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gccggcggcaagggcggcacgggcct Protospacer
.**********.*******.****
456. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaaggcggcgagggcga Protospacer
. ****************. *****.
457. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaacggcggcatcgggca Protospacer
*********** ******** ** .
458. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
459. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
460. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MG099943 (Mycobacterium phage Familton, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
461. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
462. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to KJ829260 (Mycobacterium phage YungJamal, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
463. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
464. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
465. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggtggcggcgcaggcggcatgggcgg Protospacer
. .******. ***************
466. spacer 2.1|370925|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
467. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
468. spacer 2.7|371321|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
469. spacer 2.9|371471|27|NZ_CP017595|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
470. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
471. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
472. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
473. spacer 2.10|371531|27|NZ_CP017595|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
474. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
475. spacer 4.1|1579018|28|NZ_CP017595|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
476. spacer 4.1|1579018|28|NZ_CP017595|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
477. spacer 4.1|1579018|28|NZ_CP017595|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
478. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
479. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
480. spacer 4.13|1579882|34|NZ_CP017595|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
481. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.812
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aagcgcggcaccggcgggaccggcggcgtgtc Protospacer
**. **************.******.** **
482. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.812
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aagcgcggcaccggcgggaccggcggcgtgtc Protospacer
**. **************.******.** **
483. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 6, identity: 0.769
accggcggcaaaggcggcatgggcgg CRISPR spacer
cttctcggcaaaggcggcatgggcga Protospacer
.. ********************.
484. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.769
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaaaggcggcaacctctt Protospacer
******************* *
485. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 6, identity: 0.769
accggcggcaaaggcggcatgggcgg CRISPR spacer
gccggcggcaagggcggcatggcgtc Protospacer
.**********.**********
486. spacer 11.20|3969487|26|NZ_CP017595|CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 6, identity: 0.769
accggcggcaaaggcggcatgggcgg CRISPR spacer
gccggcggcaagggcggcatggcgtc Protospacer
.**********.**********
487. spacer 2.4|371120|27|NZ_CP017595|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
488. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
489. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
490. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
491. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
492. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
493. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
494. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
495. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
496. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
497. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
498. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
499. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
500. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
501. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
502. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
503. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
504. spacer 4.1|1579018|28|NZ_CP017595|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
505. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
506. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
507. spacer 5.3|2077428|30|NZ_CP017595|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
508. spacer 5.3|2077428|30|NZ_CP017595|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
509. spacer 5.3|2077428|30|NZ_CP017595|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
510. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttgagatccgcgacgatgggtgtggcgccggc Protospacer
** .********.**** ***********
511. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttcccgcaggcgacggtgcgggcggcgccggc Protospacer
**..* * ********* ***.*********
512. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
aacggcggggccggcggtagcggcggcgcaggcgc Protospacer
*.************************ ** ..* .
513. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
agcggcggggacggcggcagcggcggcgggctctt Protospacer
********** ******.******** * ***
514. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
515. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
516. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
517. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
518. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
519. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
520. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
521. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
522. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
523. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcggggccaactt-- CRISPR spacer
ggcggcgcggccggcggcagcggc--ggccaacccgg Protospacer
.****** *********.****** *******..
524. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 7, identity: 0.781
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacggaacctcctc Protospacer
**** ************** *** . * ***
525. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.781
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagacggcgccggcggggccgggatcggcgc Protospacer
****.****.************* . **.* *
526. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 7, identity: 0.8
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
cgctgatgcgccggcgacaccaaaggctccggcgg Protospacer
** * *.*******.****** ***********
527. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 7, identity: 0.781
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacggaacctcctc Protospacer
**** ************** *** . * ***
528. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.781
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagacggcgccggcggggccgggatcggcgc Protospacer
****.****.************* . **.* *
529. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
530. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
531. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
atcgccggcaccggcggcaccaccggccagcc Protospacer
* ******************** ****.
532. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
533. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
atcgccggcaccggcggcaccaccggccagcc Protospacer
* ******************** ****.
534. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cccgccggcaccggcggcgccaacggatcgaa Protospacer
****************.******* ** ..
535. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
atcgccggcaccggcggcaccaccgcctattc Protospacer
* ******************** ** ** .
536. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
ggcggcggcaccggcggcaccaccggctggcg Protospacer
..** ***************** ***** *
537. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
atctgctacaccggcggcaccaccggctccgc Protospacer
* * * .************** ********
538. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
539. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
540. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
541. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
542. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
543. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
atctgctacaccggcggcaccaccggctccgc Protospacer
* * * .************** ********
544. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
545. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
546. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
547. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
548. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
549. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aacgccggcaccggcggcaccaacggctccgg--- CRISPR spacer
ggcgcgggcaccggcggcaccaccg---ccgggct Protospacer
..*** **************** ** ****
550. spacer 11.18|3969349|38|NZ_CP017595|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.816
gacggcggcaacgcaggcaccgg---cgccggcgaccccgg CRISPR spacer
gacggcgccaacgcaggcaccggcgacgcaggcgatct--- Protospacer
******* *************** *** *****.*.
551. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
552. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
553. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
554. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
555. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
556. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
557. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
558. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
559. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
560. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
561. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
562. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
563. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
564. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
565. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
566. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
567. spacer 5.3|2077428|30|NZ_CP017595|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
568. spacer 5.3|2077428|30|NZ_CP017595|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
569. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agcgcggccgcgtcggtgggggtggcgcccgc Protospacer
. * ***** **************** **
570. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcaccaccgcggcggtgcgggtggcgccggc Protospacer
. . *. *****.***** *************
571. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaaggcggccccggcggtgccggcgataccga Protospacer
.******** ******* ********.. *
572. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcggcggcgccggcggggccggcggcgggac Protospacer
.. ******.***************.**. *
573. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtgacggcaccggcggtgccggcggcgatgc Protospacer
.. *.************ *******.***. *
574. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcg-gcaccggcggggccggcgacgactc CRISPR spacer
-ctgccgcgcaccgggggggacggcgacgacgg Protospacer
* ** ******* **** **********
575. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtacccggcaccgccgaggccggcgacgagtt Protospacer
. * ******** **.************ *.
576. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcggcggcgccggtggggccggcgaagcggc Protospacer
* ******.****.*********** * *
577. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacggaacgtcctc Protospacer
**** ************** *** . ***
578. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagacggcgccggcggggccgggatcaccac Protospacer
****.****.************* . *. * *
579. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagacggcgccggcggggccgggatcaccac Protospacer
****.****.************* . *. * *
580. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcgccgcgccggcggggccggcgaccgctt Protospacer
.*. ** **.***************** .**.
581. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacggaacgtcctc Protospacer
**** ************** *** . ***
582. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtcgacgacaccggcgaggccggcgacgccgc Protospacer
. *.**.********.*********** * *
583. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacgggacatcctc Protospacer
**** ************** *** . ***
584. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcgccgcaacggcggggccggcgaccgctt Protospacer
.*. ** *** **************** .**.
585. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcgtcgggaccggcggggcgggcgacggcga Protospacer
* * *** *********** *******.*
586. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacgggacatcctc Protospacer
**** ************** *** . ***
587. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcgccgcaacggcggggccggcgaccgctt Protospacer
.*. ** *** **************** .**.
588. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgtcggcaccggcggcgccggcggcggcaa Protospacer
.* * ************ *******.**.*
589. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaaggcggccccggcggtgccggcgataccga Protospacer
.******** ******* ********.. *
590. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcggcggcgccggcggggccggcggcgggac Protospacer
.. ******.***************.**. *
591. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtgacggcaccggcggtgccggcggcgatgc Protospacer
.. *.************ *******.***. *
592. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcg-gcaccggcggggccggcgacgactc CRISPR spacer
-ctgccgcgcaccgggggggacggcgacgacgg Protospacer
* ** ******* **** **********
593. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtacccggcaccgccgaggccggcgacgagtt Protospacer
. * ******** **.************ *.
594. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcggcggcgccggtggggccggcgaagcggc Protospacer
* ******.****.*********** * *
595. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacggaacgtcctc Protospacer
**** ************** *** . ***
596. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagacggcgccggcggggccgggatcaccac Protospacer
****.****.************* . *. * *
597. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagacggcgccggcggggccgggatcaccac Protospacer
****.****.************* . *. * *
598. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcgccgcgccggcggggccggcgaccgctt Protospacer
.*. ** **.***************** .**.
599. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacggaacgtcctc Protospacer
**** ************** *** . ***
600. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtcgacgacaccggcgaggccggcgacgccgc Protospacer
. *.**.********.*********** * *
601. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacgggacatcctc Protospacer
**** ************** *** . ***
602. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcgccgcaacggcggggccggcgaccgctt Protospacer
.*. ** *** **************** .**.
603. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcgtcgggaccggcggggcgggcgacggcga Protospacer
* * *** *********** *******.*
604. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacgggacatcctc Protospacer
**** ************** *** . ***
605. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcgccgcaacggcggggccggcgaccgctt Protospacer
.*. ** *** **************** .**.
606. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgtcggcaccggcggcgccggcggcggcaa Protospacer
.* * ************ *******.**.*
607. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
agcgccgccaccgacggcaccaacggcctgca Protospacer
*.***** *****.*************.. .
608. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gaagcctgcaccggcggcacccacggcacaaa Protospacer
.* *** ************** ***** * ..
609. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP041197 (Pseudarthrobacter sp. NIBRBAC000502770 plasmid pMK-1, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gccccctgcaccggcggaaccaacggctaagc Protospacer
. * ** ********** ********** *
610. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
atcgccggcaccagcggcaccaccgtcagggc Protospacer
* **********.********* ** * *
611. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
atcgccggcaccagcggcaccaccgtcagggc Protospacer
* **********.********* ** * *
612. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to KT281796 (Mycobacterium phage Zakhe101, complete genome) position: , mismatch: 8, identity: 0.75
aacgccgg----caccggcggcaccaacggctccgg CRISPR spacer
----ttggggtccaccggcgggaccagcggctccgg Protospacer
..** ********* ****.*********
613. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 8, identity: 0.75
aacgccgg----caccggcggcaccaacggctccgg CRISPR spacer
----ttggggtccaccggcgggaccagcggctccgg Protospacer
..** ********* ****.*********
614. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to MN428058 (Mycobacterium phage Krili, complete genome) position: , mismatch: 8, identity: 0.75
aacgccgg----caccggcggcaccaacggctccgg CRISPR spacer
----ttggggtccaccggcgggaccagcggctccgg Protospacer
..** ********* ****.*********
615. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 8, identity: 0.75
aacgccgg----caccggcggcaccaacggctccgg CRISPR spacer
----ttggggtccaccggcgggaccagcggctccgg Protospacer
..** ********* ****.*********
616. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 8, identity: 0.75
aacgccgg----caccggcggcaccaacggctccgg CRISPR spacer
----ttggggtccaccggcgggaccagcggctccgg Protospacer
..** ********* ****.*********
617. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to MK524502 (Microbacterium phage TimoTea, complete genome) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gacaacggccccggcggcaccaccggctcata Protospacer
.**. **** ************ ****** .
618. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 8, identity: 0.75
aacgccgg----caccggcggcaccaacggctccgg CRISPR spacer
----ttggggtccaccggcgggaccagcggctccgg Protospacer
..** ********* ****.*********
619. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 8, identity: 0.75
aacgccgg----caccggcggcaccaacggctccgg CRISPR spacer
----ttggggtccaccggcgggaccagcggctccgg Protospacer
..** ********* ****.*********
620. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to MT818425 (Mycobacterium phage NiebruSaylor, complete genome) position: , mismatch: 8, identity: 0.75
aacgccgg----caccggcggcaccaacggctccgg CRISPR spacer
----ttggggtccaccggcgggaccagcggctccgg Protospacer
..** ********* ****.*********
621. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_022325 (Mycobacterium phage Dylan, complete genome) position: , mismatch: 8, identity: 0.75
aacgccgg----caccggcggcaccaacggctccgg CRISPR spacer
----ttggggtccaccggcgggaccagcggctccgg Protospacer
..** ********* ****.*********
622. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 8, identity: 0.75
aacgccgg----caccggcggcaccaacggctccgg CRISPR spacer
----ttggggtccaccggcgggaccagcggctccgg Protospacer
..** ********* ****.*********
623. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gacgacggcaccggcggccccaacacccctga Protospacer
.*** ************* *****. *.*.*.
624. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gacgacggcaccggcggccccaacacccctga Protospacer
.*** ************* *****. *.*.*.
625. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cacgccggcaccggcaggaccaaccaccgccg Protospacer
**************.* ****** .*. * *
626. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gacgatttcaccggcggcgccaacgactccgc Protospacer
.*** . **********.******.*****
627. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gacgatttcaccggcggcgccaacgactccgc Protospacer
.*** . **********.******.*****
628. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_014214 (Meiothermus silvanus DSM 9946 plasmid pMESIL02, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
agcaccggcaccggcggcagcagcggcggcac Protospacer
*.*.*************** **.**** *.
629. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
630. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
631. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
632. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
633. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
634. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
635. spacer 3.1|696344|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
636. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
637. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
638. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
639. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
640. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
641. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
642. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
643. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
644. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
645. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
646. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcccccggcgtgacggtggaggtggcgccggc Protospacer
...*. **.********.************
647. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
648. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
649. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
650. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gtggcggtggcggcggtgggggtggcggcggc Protospacer
* * . ***.************** ****
651. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tgcgaccgggcgacggtggaggtggcgccagc Protospacer
* . .* **********.*********.**
652. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
caacattcagcgacggtgggtgtggcggcggc Protospacer
. . *.* *********** ****** ****
653. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcacgacggcggcggtgcgggtggcgccggc Protospacer
. . * * ***.***** *************
654. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.743
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
655. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
agcggcggggacggcggcagcggcgtgcagcgctg Protospacer
********** ******.******* * .**
656. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 9, identity: 0.743
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggcggcggcgccggcggtaacggcggcgtgggcat Protospacer
.******* **********.****** *. ..* *
657. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggccgcggcaccggcggggccgccgccgatca Protospacer
.. ****************** ** ***..
658. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
659. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
660. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
acgcgcggcaccggctggtccggcgacgcgcg Protospacer
* . *********** ** ********* .
661. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
662. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
663. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
664. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaaggcggcaccggcggtgacggcggaaccgg Protospacer
.**************** * *****. . *
665. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaaggcggcaccggcggtgacggcggaaccgg Protospacer
.**************** * *****. . *
666. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcaggcggcgccggcgaggccggcgaggggca Protospacer
. *******.******.********* *. .
667. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
668. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
669. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
670. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
671. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
672. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atgaccggcaccggcagggctggcgacgagca Protospacer
* .. **********.****.******** .
673. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atgaccggcaccggcagggctggcgacgagca Protospacer
* .. **********.****.******** .
674. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
675. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggggaccgccccggcgggaccggcgacgacga Protospacer
...*.* ** ********.***********
676. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cacgtcggccccgtcggggccggcgacgcgga Protospacer
* * **** *** **************
677. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcggcggcaccagcggtgccggcgaggcgcg Protospacer
* *********.**** ******** * .
678. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgac---gactc CRISPR spacer
gcgcgcggcaccggcgaggccgtcgacctgga--- Protospacer
. . ************.***** **** **
679. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaatt Protospacer
. * ********** ******** *** *.
680. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP017564 (Paraburkholderia sprentiae WSM5005 plasmid pl3WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcggcggaaccggcgcggccggcgaagccgg Protospacer
.. ***** ******* ********* * *
681. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcggcggcaccagcggtgccggcgaggcgcg Protospacer
* *********.**** ******** * .
682. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
accggcggcaccggcggtggcggcgaggcact Protospacer
* ************** * ****** * ..
683. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gttgcgggcaccggcgcggccggcgccgaatt Protospacer
. * ********** ******** *** *.
684. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgtcggcaccggcggcgccggcggcgcgaa Protospacer
.* * ************ *******.**
685. spacer 11.9|3968671|35|NZ_CP017595|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
gctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
gccccaatcagcttcagcaacggcagcaccgcacc Protospacer
**. ********************** **
686. spacer 11.11|3968827|35|NZ_CP017595|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.743
gccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
gccggcggtatcggcgggcccaactggctcgacct Protospacer
********** ******* ****** **.*
687. spacer 11.11|3968827|35|NZ_CP017595|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.743
gccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
gccggcggtatcggcgggcccaactggctcgacct Protospacer
********** ******* ****** **.*
688. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggccgcggcaccggcggggccgccgccgatca Protospacer
.. ****************** ** ***..
689. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
690. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
691. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
acgcgcggcaccggctggtccggcgacgcgcg Protospacer
* . *********** ** ********* .
692. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
693. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
694. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
695. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaaggcggcaccggcggtgacggcggaaccgg Protospacer
.**************** * *****. . *
696. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaaggcggcaccggcggtgacggcggaaccgg Protospacer
.**************** * *****. . *
697. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcaggcggcgccggcgaggccggcgaggggca Protospacer
. *******.******.********* *. .
698. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
699. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
700. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
701. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
702. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
703. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atgaccggcaccggcagggctggcgacgagca Protospacer
* .. **********.****.******** .
704. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atgaccggcaccggcagggctggcgacgagca Protospacer
* .. **********.****.******** .
705. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
706. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggggaccgccccggcgggaccggcgacgacga Protospacer
...*.* ** ********.***********
707. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cacgtcggccccgtcggggccggcgacgcgga Protospacer
* * **** *** **************
708. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcggcggcaccagcggtgccggcgaggcgcg Protospacer
* *********.**** ******** * .
709. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgac---gactc CRISPR spacer
gcgcgcggcaccggcgaggccgtcgacctgga--- Protospacer
. . ************.***** **** **
710. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaatt Protospacer
. * ********** ******** *** *.
711. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP017564 (Paraburkholderia sprentiae WSM5005 plasmid pl3WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcggcggaaccggcgcggccggcgaagccgg Protospacer
.. ***** ******* ********* * *
712. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcggcggcaccagcggtgccggcgaggcgcg Protospacer
* *********.**** ******** * .
713. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
accggcggcaccggcggtggcggcgaggcact Protospacer
* ************** * ****** * ..
714. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gttgcgggcaccggcgcggccggcgccgaatt Protospacer
. * ********** ******** *** *.
715. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgtcggcaccggcggcgccggcggcgcgaa Protospacer
.* * ************ *******.**
716. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
ttcgccggccccggcggcaccgacgccgggag Protospacer
******* ***********.*** * .*
717. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
tccgccgtcaccggcggcaccaccgtcctgag Protospacer
***** ************** ** *.. .*
718. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gccgccggcaccgccggcaccaccgagtgcat Protospacer
. *********** ******** **. * *.
719. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_049478 (Arthrobacter phage Mufasa8, complete genome) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gcgtccggcaccggcggcaccatcggcgcttc Protospacer
. ****************** **** *.
720. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP009405 (Mycobacterium avium subsp. hominissuis strain OCU464 plasmid p78K, complete sequence) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
atcgccgtcaccggcggcaccatcggggttat Protospacer
* ***** ************** *** ...
721. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP042515 (Serratia marcescens strain E28 plasmid pE28_003) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
tccttcggcttcggcggcaccaacggctcgct Protospacer
* .**** .******************
722. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gccgccggcaccgccggcaccaccgattgcat Protospacer
. *********** ******** **..* *.
723. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
ggcgccggcaccggcggcacgagcgaagcggt Protospacer
..****************** *.**. * *
724. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to MT498059 (Gordonia phage Doggs, complete genome) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cgcccccgcaccggcggcaccaccggccgacg Protospacer
.* ** *************** ****. *
725. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_019909 (Yersinia phage phiR1-RT complete genome) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gtcgccgccaccgtcggcaccaacgaaatcag Protospacer
. ***** ***** ***********. .*.*
726. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to KY697807 (Microcystis phage MACPNOA1, complete genome) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
ctcgccggcacgggcggcacccacgttgcgga Protospacer
********* ********* *** . * *.
727. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NC_028820 (Yersinia phage vB_YenM_TG1, complete genome) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gtcgccgccaccgtcggcaccaacgaaatcag Protospacer
. ***** ***** ***********. .*.*
728. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to MN284893 (Mycobacterium phage LilMcDreamy, complete genome) position: , mismatch: 9, identity: 0.719
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
tacgccgtcaccggcggcatcaacaagaacga Protospacer
****** ***********.****.. **.
729. spacer 11.17|3969277|35|NZ_CP017595|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
gctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
gccccaatcagcttcagcaacggcagcaccgcacc Protospacer
**. ********************** **
730. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
731. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
732. spacer 2.6|371255|33|NZ_CP017595|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
733. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
734. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
735. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
736. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
737. spacer 4.10|1579633|31|NZ_CP017595|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
738. spacer 4.13|1579882|34|NZ_CP017595|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
739. spacer 7.8|3130306|35|NZ_CP017595|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
740. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
aggacggccgcggcggtggcggtggcgccgta Protospacer
* *****.****** **********
741. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ctgctggccgcgacggtgctggtggcgccgat Protospacer
.* .. *********** **********..
742. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tcgcggatcgggatggtgggggtggcgccgga Protospacer
*. . .** **.*****************
743. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcgagggcggcgacggtgggcgtgtcgccggc Protospacer
. * *********** *** *******
744. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 10, identity: 0.714
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggcggcgggtccggcggtaacggcggtttcttcac Protospacer
.******** *********.****** .* * .
745. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 10, identity: 0.714
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
atcggcgcggccggcggtaccggcgggaagtatgg Protospacer
* ***** *********** *******. *.
746. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtcatccgcagcggcggggccggcgaggaccg Protospacer
. . * *** *************** ***.
747. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .
748. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggttcccgcacccgcggggcccgcgacgaccg Protospacer
.. * ***** ******** ********.
749. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggtccggccccggcggggccggagacgggtt Protospacer
.. **** ************* ****. *.
750. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaact Protospacer
. * ********** ******** *** ..
751. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcgcgtccggccagcgtga Protospacer
*************** * ***** * ..
752. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
agtacgggcaccggcggggcgggcgccgaaag Protospacer
*. . ************** **** ***
753. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gccgcgggcaccggcgcggccggcgccgaact Protospacer
. * ********** ******** *** ..
754. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaact Protospacer
. * ********** ******** *** ..
755. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
756. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
757. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
758. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
759. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
760. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
761. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
762. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
763. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
764. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
765. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
766. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
767. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
768. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
769. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
770. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to MH142220 (UNVERIFIED: Acidithiobacillus phage AcaML1 strain BC13 genomic sequence) position: , mismatch: 10, identity: 0.714
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
ttcctgggtgccggcggcagctacggctccgccac Protospacer
* ************* * ********* *.
771. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to MH142219 (UNVERIFIED: Acidithiobacillus phage AcaML1 strain F genomic sequence) position: , mismatch: 10, identity: 0.714
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
ttcctgggtgccggcggcagctacggctccgccac Protospacer
* ************* * ********* *.
772. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to JX507079 (Acidithiobacillus phage AcaML1, complete genome) position: , mismatch: 10, identity: 0.714
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
ttcctgggtgccggcggcagctacggctccgccac Protospacer
* ************* * ********* *.
773. spacer 11.9|3968671|35|NZ_CP017595|CRT matches to MK310141 (Mycobacterium phage Fenn, complete genome) position: , mismatch: 10, identity: 0.714
gctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
aacgacctcagcatcagcagcggcagcaacggaac Protospacer
. .*.* ***** ******.************ .
774. spacer 11.9|3968671|35|NZ_CP017595|CRT matches to MK524523 (Mycobacterium phage Naira, complete genome) position: , mismatch: 10, identity: 0.714
gctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
aacgacctcagcatcagcagcggcagcaacggaac Protospacer
. .*.* ***** ******.************ .
775. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtcatccgcagcggcggggccggcgaggaccg Protospacer
. . * *** *************** ***.
776. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .
777. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggttcccgcacccgcggggcccgcgacgaccg Protospacer
.. * ***** ******** ********.
778. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggtccggccccggcggggccggagacgggtt Protospacer
.. **** ************* ****. *.
779. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaact Protospacer
. * ********** ******** *** ..
780. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcgcgtccggccagcgtga Protospacer
*************** * ***** * ..
781. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
agtacgggcaccggcggggcgggcgccgaaag Protospacer
*. . ************** **** ***
782. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gccgcgggcaccggcgcggccggcgccgaact Protospacer
. * ********** ******** *** ..
783. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaact Protospacer
. * ********** ******** *** ..
784. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
785. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
786. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
787. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
788. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
789. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
790. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
791. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
792. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
793. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
794. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
795. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
796. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
797. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
798. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
799. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
tggcccggcaccgtcggcaccatcggcagctt Protospacer
. ********* ******** **** *
800. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
tggaccggaaccggcggcaacaacggcgaggc Protospacer
. .**** ********** ******* *
801. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_CP041350 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pB, complete sequence) position: , mismatch: 10, identity: 0.688
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
ttgcccggaaccggcggcacgaacggcgtgga Protospacer
**** *********** ****** . *.
802. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.688
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gtgcccggcgccggcggcaccatcggcctggc Protospacer
. *****.************ ****.. *
803. spacer 11.17|3969277|35|NZ_CP017595|CRT matches to MK310141 (Mycobacterium phage Fenn, complete genome) position: , mismatch: 10, identity: 0.714
gctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
aacgacctcagcatcagcagcggcagcaacggaac Protospacer
. .*.* ***** ******.************ .
804. spacer 11.17|3969277|35|NZ_CP017595|CRT matches to MK524523 (Mycobacterium phage Naira, complete genome) position: , mismatch: 10, identity: 0.714
gctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
aacgacctcagcatcagcagcggcagcaacggaac Protospacer
. .*.* ***** ******.************ .
805. spacer 9.6|3756887|32|NZ_CP017595|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcagcagcgcgacggtgtcggtggcgccggt Protospacer
. . . ********** ***********.
806. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.686
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcacc Protospacer
. .********************.** ** ..
807. spacer 11.3|3968209|35|NZ_CP017595|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.686
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcacc Protospacer
. .********************.** ** ..
808. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 11, identity: 0.656
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcttcggcaccggcgggccgggcgacgcgct Protospacer
.. ************* * ******* ..
809. spacer 11.5|3968362|32|NZ_CP017595|CRT matches to NZ_CP022194 (Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence) position: , mismatch: 11, identity: 0.656
-----aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
agttcaaggccggcaccgccggggccgccttc----- Protospacer
**.* ******** ******** * *
810. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
811. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
812. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
813. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
814. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
815. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
816. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
817. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
818. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
819. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
820. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
821. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
822. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
823. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
824. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
825. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
826. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
827. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
828. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
829. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
830. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
831. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
832. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
833. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
834. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
835. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
836. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
837. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
838. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
839. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
840. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
841. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
842. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
843. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
844. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
845. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
846. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
847. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
848. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
849. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
850. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
851. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
852. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
853. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
854. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
855. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
856. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
857. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
858. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
859. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
860. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
861. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
862. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
863. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
864. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
865. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
866. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
867. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
868. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
869. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
870. spacer 11.8|3968599|35|NZ_CP017595|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
871. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 11, identity: 0.656
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcttcggcaccggcgggccgggcgacgcgct Protospacer
.. ************* * ******* ..
872. spacer 11.13|3968971|32|NZ_CP017595|CRT matches to NZ_CP022194 (Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence) position: , mismatch: 11, identity: 0.656
-----aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
agttcaaggccggcaccgccggggccgccttc----- Protospacer
**.* ******** ******** * *
873. spacer 11.16|3969208|32|NZ_CP017595|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 11, identity: 0.656
aacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gtttccggcaccggcggcgccgacggcgagaa Protospacer
. . **************.**.***** ..