Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020739 [Pseudomonas] mesoacidophila strain ATCC 31433 chromosome 3, complete sequence 0 crisprs NA 0 0 39 0
NZ_CP020737 [Pseudomonas] mesoacidophila strain ATCC 31433 chromosome 1, complete sequence 4 crisprs csa3,cas3,RT,DEDDh,Cas14u_CAS-V,DinG 1 1 3 0
NZ_CP020738 [Pseudomonas] mesoacidophila strain ATCC 31433 chromosome 2, complete sequence 1 crisprs cas3,Cas14u_CAS-V,csa3,DinG,2OG_CAS,WYL 0 2 1 0
NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 0 crisprs PD-DExK 0 0 0 0

Results visualization

1. NZ_CP020739
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 14336 10 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_2 20830 : 23947 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_3 27099 : 28944 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_4 59815 : 61945 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_5 70966 : 79675 3 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_6 85409 : 92239 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_7 113823 : 114519 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_8 120345 : 121644 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_9 138811 : 139336 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_10 144968 : 146858 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_11 150460 : 174782 6 Paenibacillus_phage(33.33%) NA NA
DBSCAN-SWA_12 195280 : 196600 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_13 203091 : 208362 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_14 216944 : 221244 4 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_15 224307 : 225945 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_16 244800 : 245571 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_17 251452 : 253921 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_18 267812 : 272622 2 uncultured_virus(50.0%) transposase NA
DBSCAN-SWA_19 292020 : 292773 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_20 302436 : 303372 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_21 308651 : 324041 10 Burkholderia_virus(33.33%) NA NA
DBSCAN-SWA_22 341429 : 342983 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_23 351965 : 353496 2 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_24 359216 : 376008 14 Hokovirus(16.67%) NA NA
DBSCAN-SWA_25 380630 : 386517 6 Cyanophage(33.33%) NA NA
DBSCAN-SWA_26 422179 : 424324 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_27 434512 : 443493 5 Hokovirus(100.0%) transposase NA
DBSCAN-SWA_28 447000 : 448587 1 Peridroma_alphabaculovirus(100.0%) NA NA
DBSCAN-SWA_29 453949 : 455371 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_30 459036 : 480796 12 Tupanvirus(22.22%) NA NA
DBSCAN-SWA_31 503110 : 504271 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_32 511240 : 511834 1 Thermoanaerobacterium_phage(100.0%) NA NA
DBSCAN-SWA_33 518700 : 521007 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_34 527126 : 529823 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_35 542885 : 547363 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_36 557796 : 559557 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_37 573067 : 573654 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_38 580909 : 599697 4 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_39 621128 : 623693 1 Tupanvirus(100.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP020737
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020737_1 93770-93842 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020737_2 1208671-1208822 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020737_3 2355817-2355935 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020737_4 3435938-3436070 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP020737_4 4.1|3435983|43|NZ_CP020737|CRISPRCasFinder 3435983-3436025 43 NZ_CP020737.1 3435806-3435848 1 0.977
NZ_CP020737_4 4.1|3435983|43|NZ_CP020737|CRISPRCasFinder 3435983-3436025 43 NZ_CP020737.1 3436337-3436379 2 0.953

1. spacer 4.1|3435983|43|NZ_CP020737|CRISPRCasFinder matches to position: 3435806-3435848, mismatch: 1, identity: 0.977

gggctcactctcaccgttagaatccacagccgtccgagtggcc	CRISPR spacer
gggctcactctcaccgttagaatccacagccttccgagtggcc	Protospacer
******************************* ***********

2. spacer 4.1|3435983|43|NZ_CP020737|CRISPRCasFinder matches to position: 3436337-3436379, mismatch: 2, identity: 0.953

gggctcactctcaccgttagaatccacagccgtccgagtggcc	CRISPR spacer
ggtctcaccctcaccgttagaatccacagccgtccgagtggcc	Protospacer
** *****.**********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020737_3 3.1|2355858|37|NZ_CP020737|CRISPRCasFinder 2355858-2355894 37 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 132969-133005 5 0.865

1. spacer 3.1|2355858|37|NZ_CP020737|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.865

caggaggctggccgccccctcggggggcag--cgagcaa	CRISPR spacer
ctggaggcgggccgcaccctcggggggcaggacgagc--	Protospacer
* ****** ****** **************  *****  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 177799 : 206545 34 Burkholderia_phage(66.67%) holin,plate,integrase,tail attL 177701:177721|attR 202368:202388
DBSCAN-SWA_2 431732 : 500038 59 uncultured_Caudovirales_phage(33.33%) plate,integrase,protease attL 432304:432349|attR 446180:446225
DBSCAN-SWA_3 3613367 : 3647335 26 Erwinia_phage(25.0%) plate,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP020738
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020738_1 97173-97285 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MN234223 Mycobacterium phage Philly, complete genome 18275-18300 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 KP027207 Mycobacterium phage Chandler, complete genome 19183-19208 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MN096360 Mycobacterium phage Rita1961, complete genome 18405-18430 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MG839014 Mycobacterium phage RagingRooster, complete genome 18410-18435 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 KJ194581 Mycobacterium phage Audrey, complete genome 18409-18434 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 KR080203 Mycobacterium phage OrangeOswald, complete genome 18409-18434 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MH513976 Mycobacterium phage Morty007, complete genome 19191-19216 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MH051265 Mycobacterium phage Yahalom, complete genome 18419-18444 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MH316565 Mycobacterium phage Mortcellus, complete genome 19047-19072 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MT310871 Mycobacterium phage Jackstina, complete genome 18335-18360 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MK359357 Mycobacterium phage RomaT, complete genome 19189-19214 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 JF704095 Mycobacterium phage Daisy, complete sequence 18430-18455 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 EU816589 Mycobacterium phage Phaedrus, complete genome 18325-18350 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MN096359 Mycobacterium phage Obutu, complete genome 18404-18429 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MK061414 Mycobacterium phage Marley1013, complete genome 19191-19216 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MT952851 Mycobacterium phage Gervas, complete genome 18390-18415 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MG925353 Mycobacterium phage Nozo, complete genome 19171-19196 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 KJ194584 Mycobacterium phage Heathcliff, complete genome 18371-18396 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MN444872 Mycobacterium phage SynergyX, complete genome 18410-18435 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MH576977 Mycobacterium phage Tydolla, complete genome 19147-19172 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MG925338 Mycobacterium phage ChaChing, complete genome 18424-18449 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 NC_023742 Mycobacterium phage Akoma, complete genome 18407-18432 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MG920059 Mycobacterium phage Baloo, complete genome 18406-18431 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 NC_023686 Mycobacterium phage Gadjet, complete genome 18413-18438 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 KR080205 Mycobacterium phage Corofin, complete genome 18434-18459 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 NC_041965 Mycobacterium phage Athena, complete genome 19172-19197 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 DQ398049 Mycobacterium phage Pipefish, complete genome 19291-19316 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 KF493879 Mycobacterium phage Bernardo, complete genome 18406-18431 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MT310892 Mycobacterium phage Compostia, complete genome 18842-18867 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 JN699018 Mycobacterium phage Kamiyu, complete genome 18378-18403 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 NC_012027 Mycobacterium phage Phlyer, complete genome 19144-19169 5 0.808
NZ_CP020738_1 1.2|97243|26|NZ_CP020738|PILER-CR 97243-97268 26 MN444873 Mycobacterium phage Abinghost, complete genome 18409-18434 5 0.808
NZ_CP020738_1 1.1|97194|28|NZ_CP020738|PILER-CR 97194-97221 28 NC_001949 Lactococcus lactis DPC3147 plasmid pMRC01, complete sequence 1843-1870 7 0.75

1. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

2. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to KP027207 (Mycobacterium phage Chandler, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

3. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MN096360 (Mycobacterium phage Rita1961, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

4. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MG839014 (Mycobacterium phage RagingRooster, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

5. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

6. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to KR080203 (Mycobacterium phage OrangeOswald, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

7. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MH513976 (Mycobacterium phage Morty007, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

8. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

9. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

10. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

11. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MK359357 (Mycobacterium phage RomaT, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

12. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to JF704095 (Mycobacterium phage Daisy, complete sequence) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

13. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

14. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MN096359 (Mycobacterium phage Obutu, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

15. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MK061414 (Mycobacterium phage Marley1013, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

16. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

17. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MG925353 (Mycobacterium phage Nozo, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

18. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to KJ194584 (Mycobacterium phage Heathcliff, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

19. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MN444872 (Mycobacterium phage SynergyX, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

20. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MH576977 (Mycobacterium phage Tydolla, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

21. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MG925338 (Mycobacterium phage ChaChing, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

22. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to NC_023742 (Mycobacterium phage Akoma, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

23. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

24. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

25. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to KR080205 (Mycobacterium phage Corofin, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

26. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

27. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

28. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to KF493879 (Mycobacterium phage Bernardo, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

29. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

30. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

31. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to NC_012027 (Mycobacterium phage Phlyer, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

32. spacer 1.2|97243|26|NZ_CP020738|PILER-CR matches to MN444873 (Mycobacterium phage Abinghost, complete genome) position: , mismatch: 5, identity: 0.808

ttagggccacaggtcgacctccggca	CRISPR spacer
ggcgagccagaggtcgacctccggca	Protospacer
   *.**** ****************

33. spacer 1.1|97194|28|NZ_CP020738|PILER-CR matches to NC_001949 (Lactococcus lactis DPC3147 plasmid pMRC01, complete sequence) position: , mismatch: 7, identity: 0.75

ttgaccattttttcgagcaaatacctct	CRISPR spacer
gataccattttttcgagcaattacacca	Protospacer
   ***************** *** .* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2255254 : 2293351 46 Burkholderia_phage(71.88%) protease,portal,tail,holin,terminase,capsid,integrase,head attL 2253557:2253582|attR 2293571:2293596
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage