Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020616 Coxiella burnetii strain RSA 439, complete genome 1 crisprs cas7f,cas3,DEDDh,cas8f 0 1 2 0
NZ_CP020617 Coxiella burnetii strain RSA 439 plasmid, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP020616
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020616_1 676278-676359 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020616_1 1.1|676303|32|NZ_CP020616|CRISPRCasFinder 676303-676334 32 NZ_CP036488 Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence 30343-30374 8 0.75
NZ_CP020616_1 1.1|676303|32|NZ_CP020616|CRISPRCasFinder 676303-676334 32 NZ_CP032297 Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence 532636-532667 8 0.75
NZ_CP020616_1 1.1|676303|32|NZ_CP020616|CRISPRCasFinder 676303-676334 32 NC_017060 Rahnella aquatilis HX2 plasmid PRA1, complete sequence 112646-112677 8 0.75
NZ_CP020616_1 1.1|676303|32|NZ_CP020616|CRISPRCasFinder 676303-676334 32 NC_015062 Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence 115816-115847 8 0.75
NZ_CP020616_1 1.1|676303|32|NZ_CP020616|CRISPRCasFinder 676303-676334 32 NZ_CP034838 Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence 116094-116125 8 0.75
NZ_CP020616_1 1.1|676303|32|NZ_CP020616|CRISPRCasFinder 676303-676334 32 NZ_CP034839 Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence 116094-116125 8 0.75
NZ_CP020616_1 1.1|676303|32|NZ_CP020616|CRISPRCasFinder 676303-676334 32 NZ_CP034837 Rahnella aquatilis strain KM05 plasmid pKM05, complete sequence 94007-94038 8 0.75
NZ_CP020616_1 1.1|676303|32|NZ_CP020616|CRISPRCasFinder 676303-676334 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 1120014-1120045 9 0.719
NZ_CP020616_1 1.1|676303|32|NZ_CP020616|CRISPRCasFinder 676303-676334 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1684755-1684786 10 0.688

1. spacer 1.1|676303|32|NZ_CP020616|CRISPRCasFinder matches to NZ_CP036488 (Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence) position: , mismatch: 8, identity: 0.75

cttcgtccttcggcgaggcctttttcaaagcc	CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc	Protospacer
* ..** ******.*************..* *

2. spacer 1.1|676303|32|NZ_CP020616|CRISPRCasFinder matches to NZ_CP032297 (Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence) position: , mismatch: 8, identity: 0.75

cttcgtccttcggcgaggcctttttcaaagcc	CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc	Protospacer
* ..** ******.*************..* *

3. spacer 1.1|676303|32|NZ_CP020616|CRISPRCasFinder matches to NC_017060 (Rahnella aquatilis HX2 plasmid PRA1, complete sequence) position: , mismatch: 8, identity: 0.75

cttcgtccttcggcgaggcctttttcaaagcc	CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc	Protospacer
* ..** ******.*************..* *

4. spacer 1.1|676303|32|NZ_CP020616|CRISPRCasFinder matches to NC_015062 (Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence) position: , mismatch: 8, identity: 0.75

cttcgtccttcggcgaggcctttttcaaagcc	CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc	Protospacer
* ..** ******.*************..* *

5. spacer 1.1|676303|32|NZ_CP020616|CRISPRCasFinder matches to NZ_CP034838 (Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence) position: , mismatch: 8, identity: 0.75

cttcgtccttcggcgaggcctttttcaaagcc	CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc	Protospacer
* ..** ******.*************..* *

6. spacer 1.1|676303|32|NZ_CP020616|CRISPRCasFinder matches to NZ_CP034839 (Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence) position: , mismatch: 8, identity: 0.75

cttcgtccttcggcgaggcctttttcaaagcc	CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc	Protospacer
* ..** ******.*************..* *

7. spacer 1.1|676303|32|NZ_CP020616|CRISPRCasFinder matches to NZ_CP034837 (Rahnella aquatilis strain KM05 plasmid pKM05, complete sequence) position: , mismatch: 8, identity: 0.75

cttcgtccttcggcgaggcctttttcaaagcc	CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc	Protospacer
* ..** ******.*************..* *

8. spacer 1.1|676303|32|NZ_CP020616|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

cttcgtccttcggcgaggcctttttcaaagcc	CRISPR spacer
atcccggctacggcgaggcctttttccaaggg	Protospacer
 *.*   ** **************** ***  

9. spacer 1.1|676303|32|NZ_CP020616|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cttcgtccttcggcgaggcctttttcaaagcc	CRISPR spacer
tctcgtccatcggcgatgcctttttgttgagc	Protospacer
..****** ******* ********   .. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 255668 : 264700 12 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_2 605779 : 660276 56 Tupanvirus(13.33%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage