Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015011 Rickettsia bellii isolate An04 plasmid unnamed, complete sequence 0 crisprs RT 0 0 0 0
NZ_CP015010 Rickettsia bellii isolate An04 chromosome, complete genome 2 crisprs DEDDh,cas3 1 0 2 0

Results visualization

1. NZ_CP015010
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015010_1 353111-353206 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015010_2 767881-768134 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP015010_1 1.1|353138|42|NZ_CP015010|CRISPRCasFinder 353138-353179 42 NZ_CP015010.1 122041-122082 2 0.952

1. spacer 1.1|353138|42|NZ_CP015010|CRISPRCasFinder matches to position: 122041-122082, mismatch: 2, identity: 0.952

ttctttgccataatagctttttcttcttctctaccttgttgc	CRISPR spacer
ttctttaccatgatagctttttcttcttctctaccttgttgc	Protospacer
******.****.******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 704453 : 754519 50 Wolbachia_phage(18.18%) capsid,head,transposase,tail,protease NA
DBSCAN-SWA_2 1249194 : 1259594 7 Catovirus(16.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage