Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014842 Bacillus licheniformis strain SCDB 14 chromosome, complete genome 1 crisprs csa3,DEDDh,cas3,DinG,WYL 0 1 5 0
NZ_CP014843 Bacillus licheniformis strain SCDB 14 plasmid pSCDB14, complete sequence 0 crisprs cas4 0 0 1 0

Results visualization

1. NZ_CP014842
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014842_1 2016848-2016921 Unclear NA
1 spacers
cas3,DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014842_1 1.1|2016874|22|NZ_CP014842|CRISPRCasFinder 2016874-2016895 22 JQ680357 Unidentified phage clone 2011_scaffold13 genomic sequence 29666-29687 2 0.909

1. spacer 1.1|2016874|22|NZ_CP014842|CRISPRCasFinder matches to JQ680357 (Unidentified phage clone 2011_scaffold13 genomic sequence) position: , mismatch: 2, identity: 0.909

tttgcaaggcttgtggtaatcg	CRISPR spacer
gttgcaaggcttgtgataatcg	Protospacer
 **************.******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 832694 : 899053 84 Bacillus_phage(55.26%) plate,tRNA,protease,tail,holin,head,coat,integrase,terminase,portal,capsid attL 842492:842509|attR 886496:886513
DBSCAN-SWA_2 1447636 : 1504342 54 Bacillus_phage(30.0%) tRNA,protease,coat,integrase,terminase attL 1445561:1445586|attR 1450277:1450302
DBSCAN-SWA_3 1902178 : 1914358 15 Staphylococcus_phage(55.56%) NA NA
DBSCAN-SWA_4 2886067 : 2956500 87 Bacillus_phage(28.21%) plate,tail,holin,coat,terminase,portal NA
DBSCAN-SWA_5 3528833 : 3538757 9 Synechococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014843
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 32821 : 40709 18 Bacillus_phage(87.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage