Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020428 Vibrio parahaemolyticus strain FDAARGOS_191 chromosome 2, complete sequence 2 crisprs cas3,csa3,WYL,DEDDh,cas6f,cas7f,cas5f 0 2 147 0
NZ_CP020427 Vibrio parahaemolyticus strain FDAARGOS_191 chromosome 1, complete sequence 0 crisprs DEDDh,DinG,cas3,csx1,csa3 0 0 259 0

Results visualization

1. NZ_CP020428
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020428_1 621691-621788 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020428_2 1106039-1106185 Unclear NA
2 spacers
cas6f,cas7f,cas5f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020428_2 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder 1106126-1106157 32 NZ_CP017904 Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence 201007-201038 3 0.906
NZ_CP020428_2 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder 1106126-1106157 32 NZ_CP017901 Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence 206663-206694 3 0.906
NZ_CP020428_2 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder 1106126-1106157 32 NZ_CP017909 Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence 203227-203258 3 0.906
NZ_CP020428_2 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder 1106126-1106157 32 NZ_CP017893 Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence 184601-184632 3 0.906
NZ_CP020428_2 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder 1106126-1106157 32 NZ_CP017898 Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence 206028-206059 3 0.906
NZ_CP020428_2 2.4|1106134|32|NZ_CP020428|PILER-CR 1106134-1106165 32 NZ_CP017904 Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence 201007-201038 3 0.906
NZ_CP020428_2 2.4|1106134|32|NZ_CP020428|PILER-CR 1106134-1106165 32 NZ_CP017901 Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence 206663-206694 3 0.906
NZ_CP020428_2 2.4|1106134|32|NZ_CP020428|PILER-CR 1106134-1106165 32 NZ_CP017909 Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence 203227-203258 3 0.906
NZ_CP020428_2 2.4|1106134|32|NZ_CP020428|PILER-CR 1106134-1106165 32 NZ_CP017893 Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence 184601-184632 3 0.906
NZ_CP020428_2 2.4|1106134|32|NZ_CP020428|PILER-CR 1106134-1106165 32 NZ_CP017898 Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence 206028-206059 3 0.906
NZ_CP020428_2 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder 1106126-1106157 32 NC_023007 Bacillus phage vB_BanS-Tsamsa, complete genome 126510-126541 7 0.781
NZ_CP020428_2 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder 1106126-1106157 32 KT070867 Bacillus phage PBC2, complete genome 65851-65882 7 0.781
NZ_CP020428_2 2.4|1106134|32|NZ_CP020428|PILER-CR 1106134-1106165 32 NC_023007 Bacillus phage vB_BanS-Tsamsa, complete genome 126510-126541 7 0.781
NZ_CP020428_2 2.4|1106134|32|NZ_CP020428|PILER-CR 1106134-1106165 32 KT070867 Bacillus phage PBC2, complete genome 65851-65882 7 0.781
NZ_CP020428_2 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder 1106126-1106157 32 AP014358 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS *** 7471-7502 8 0.75
NZ_CP020428_2 2.4|1106134|32|NZ_CP020428|PILER-CR 1106134-1106165 32 AP014358 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS *** 7471-7502 8 0.75
NZ_CP020428_2 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder 1106126-1106157 32 MN693953 Marine virus AFVG_250M577, complete genome 29125-29156 9 0.719
NZ_CP020428_2 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder 1106126-1106157 32 MN693129 Marine virus AFVG_25M62, complete genome 17784-17815 9 0.719
NZ_CP020428_2 2.4|1106134|32|NZ_CP020428|PILER-CR 1106134-1106165 32 MN693953 Marine virus AFVG_250M577, complete genome 29125-29156 9 0.719
NZ_CP020428_2 2.4|1106134|32|NZ_CP020428|PILER-CR 1106134-1106165 32 MN693129 Marine virus AFVG_25M62, complete genome 17784-17815 9 0.719

1. spacer 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder matches to NZ_CP017904 (Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence) position: , mismatch: 3, identity: 0.906

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ctgttagcatctgcttgagcctgtggtatccg	Protospacer
********************.*********. 

2. spacer 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder matches to NZ_CP017901 (Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence) position: , mismatch: 3, identity: 0.906

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ctgttagcatctgcttgagcctgtggtatccg	Protospacer
********************.*********. 

3. spacer 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder matches to NZ_CP017909 (Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence) position: , mismatch: 3, identity: 0.906

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ctgttagcatctgcttgagcctgtggtatccg	Protospacer
********************.*********. 

4. spacer 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder matches to NZ_CP017893 (Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence) position: , mismatch: 3, identity: 0.906

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ctgttagcatctgcttgagcctgtggtatccg	Protospacer
********************.*********. 

5. spacer 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder matches to NZ_CP017898 (Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence) position: , mismatch: 3, identity: 0.906

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ctgttagcatctgcttgagcctgtggtatccg	Protospacer
********************.*********. 

6. spacer 2.4|1106134|32|NZ_CP020428|PILER-CR matches to NZ_CP017904 (Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence) position: , mismatch: 3, identity: 0.906

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ctgttagcatctgcttgagcctgtggtatccg	Protospacer
********************.*********. 

7. spacer 2.4|1106134|32|NZ_CP020428|PILER-CR matches to NZ_CP017901 (Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence) position: , mismatch: 3, identity: 0.906

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ctgttagcatctgcttgagcctgtggtatccg	Protospacer
********************.*********. 

8. spacer 2.4|1106134|32|NZ_CP020428|PILER-CR matches to NZ_CP017909 (Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence) position: , mismatch: 3, identity: 0.906

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ctgttagcatctgcttgagcctgtggtatccg	Protospacer
********************.*********. 

9. spacer 2.4|1106134|32|NZ_CP020428|PILER-CR matches to NZ_CP017893 (Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence) position: , mismatch: 3, identity: 0.906

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ctgttagcatctgcttgagcctgtggtatccg	Protospacer
********************.*********. 

10. spacer 2.4|1106134|32|NZ_CP020428|PILER-CR matches to NZ_CP017898 (Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence) position: , mismatch: 3, identity: 0.906

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ctgttagcatctgcttgagcctgtggtatccg	Protospacer
********************.*********. 

11. spacer 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder matches to NC_023007 (Bacillus phage vB_BanS-Tsamsa, complete genome) position: , mismatch: 7, identity: 0.781

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ttagtagcatctgctttagcttgtgataattc	Protospacer
.*. ************ ********.** .**

12. spacer 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder matches to KT070867 (Bacillus phage PBC2, complete genome) position: , mismatch: 7, identity: 0.781

ctgttagcatctgcttgagcttgtggtatctc-	CRISPR spacer
cggttagcatctgcttctgcttgt-gcatcaat	Protospacer
* **************  ****** *.***   

13. spacer 2.4|1106134|32|NZ_CP020428|PILER-CR matches to NC_023007 (Bacillus phage vB_BanS-Tsamsa, complete genome) position: , mismatch: 7, identity: 0.781

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ttagtagcatctgctttagcttgtgataattc	Protospacer
.*. ************ ********.** .**

14. spacer 2.4|1106134|32|NZ_CP020428|PILER-CR matches to KT070867 (Bacillus phage PBC2, complete genome) position: , mismatch: 7, identity: 0.781

ctgttagcatctgcttgagcttgtggtatctc-	CRISPR spacer
cggttagcatctgcttctgcttgt-gcatcaat	Protospacer
* **************  ****** *.***   

15. spacer 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder matches to AP014358 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
gtattagcatctgcttgagctagtgttactag	Protospacer
 *.****************** *** **..  

16. spacer 2.4|1106134|32|NZ_CP020428|PILER-CR matches to AP014358 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
gtattagcatctgcttgagctagtgttactag	Protospacer
 *.****************** *** **..  

17. spacer 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder matches to MN693953 (Marine virus AFVG_250M577, complete genome) position: , mismatch: 9, identity: 0.719

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
gcaacagcatctgcttgagcttttgttatttt	Protospacer
 .. .***************** ** ***.*.

18. spacer 2.2|1106126|32|NZ_CP020428|CRISPRCasFinder matches to MN693129 (Marine virus AFVG_25M62, complete genome) position: , mismatch: 9, identity: 0.719

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ggtttagcctctgcttgagtttgtggttgttt	Protospacer
   ***** **********.*******  .*.

19. spacer 2.4|1106134|32|NZ_CP020428|PILER-CR matches to MN693953 (Marine virus AFVG_250M577, complete genome) position: , mismatch: 9, identity: 0.719

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
gcaacagcatctgcttgagcttttgttatttt	Protospacer
 .. .***************** ** ***.*.

20. spacer 2.4|1106134|32|NZ_CP020428|PILER-CR matches to MN693129 (Marine virus AFVG_25M62, complete genome) position: , mismatch: 9, identity: 0.719

ctgttagcatctgcttgagcttgtggtatctc	CRISPR spacer
ggtttagcctctgcttgagtttgtggttgttt	Protospacer
   ***** **********.*******  .*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 23322 5 Salicola_phage(100.0%) NA NA
DBSCAN-SWA_2 27480 : 30117 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_3 44055 : 50297 7 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_4 58798 : 60535 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_5 68373 : 82613 10 Pike_perch_iridovirus(16.67%) NA NA
DBSCAN-SWA_6 92113 : 95371 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_7 102177 : 103470 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_8 108774 : 116840 8 Chrysochromulina_ericina_virus(33.33%) NA NA
DBSCAN-SWA_9 127315 : 132080 4 Clostridium_phage(33.33%) NA NA
DBSCAN-SWA_10 135437 : 139598 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_11 148428 : 153251 3 Flavobacterium_phage(50.0%) NA NA
DBSCAN-SWA_12 161469 : 162084 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_13 165431 : 168588 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_14 173007 : 174879 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_15 192498 : 196302 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_16 212969 : 215191 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_17 224361 : 228299 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_18 241669 : 242140 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_19 247424 : 249329 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_20 255134 : 257643 2 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_21 260839 : 268266 8 Proteus_phage(25.0%) NA NA
DBSCAN-SWA_22 275525 : 276308 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_23 282303 : 283134 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_24 302130 : 303699 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_25 310758 : 313136 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_26 317086 : 326695 7 Brazilian_cedratvirus(33.33%) tRNA NA
DBSCAN-SWA_27 335895 : 336912 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_28 341211 : 342795 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_29 347424 : 348444 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_30 352544 : 355703 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_31 367211 : 369236 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_32 376079 : 376964 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_33 380409 : 385633 5 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_34 399089 : 407074 9 Burkholderia_virus(20.0%) NA NA
DBSCAN-SWA_35 426417 : 428184 2 Halocynthia_phage(50.0%) NA NA
DBSCAN-SWA_36 437333 : 438311 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_37 446747 : 447866 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_38 457086 : 459120 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_39 462363 : 465505 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_40 472393 : 473080 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_41 482479 : 494422 9 Bacillus_thuringiensis_phage(14.29%) NA NA
DBSCAN-SWA_42 519170 : 520061 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_43 524946 : 533964 7 Chrysochromulina_ericina_virus(25.0%) NA NA
DBSCAN-SWA_44 545307 : 551164 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_45 563558 : 564317 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_46 569230 : 574322 4 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_47 578096 : 580766 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_48 586439 : 593332 9 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_49 604786 : 605965 1 Agrotis_ipsilon_multiple_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_50 620829 : 634694 14 Chrysochromulina_ericina_virus(20.0%) NA NA
DBSCAN-SWA_51 639109 : 644767 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_52 651807 : 652290 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_53 661858 : 662716 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_54 667707 : 672622 5 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_55 676017 : 676716 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_56 680172 : 686653 6 Hokovirus(25.0%) NA NA
DBSCAN-SWA_57 690630 : 698798 6 Enterobacteria_phage(20.0%) tRNA NA
DBSCAN-SWA_58 708669 : 710784 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_59 719320 : 721692 2 Vibrio_virus(50.0%) NA NA
DBSCAN-SWA_60 729097 : 734448 6 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_61 742226 : 743693 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_62 749301 : 750540 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_63 754783 : 758475 4 Burkholderia_virus(33.33%) NA NA
DBSCAN-SWA_64 761833 : 763402 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_65 773994 : 785700 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_66 799320 : 810110 7 Planktothrix_phage(20.0%) NA NA
DBSCAN-SWA_67 818535 : 820152 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_68 836137 : 836434 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_69 843326 : 845780 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_70 857731 : 858106 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_71 870146 : 871610 1 Apis_mellifera_filamentous_virus(100.0%) NA NA
DBSCAN-SWA_72 875616 : 876774 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_73 895859 : 904607 8 Salmonella_phage(20.0%) NA NA
DBSCAN-SWA_74 909078 : 909456 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_75 933542 : 934580 1 Emiliania_huxleyi_virus(100.0%) protease NA
DBSCAN-SWA_76 944398 : 947071 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_77 952552 : 954943 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_78 967667 : 971569 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_79 974938 : 976567 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_80 979770 : 980541 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_81 983697 : 989669 5 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_82 994887 : 1002561 6 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_83 1009140 : 1017122 6 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_84 1024416 : 1030988 6 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_85 1052884 : 1059774 5 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_86 1074993 : 1077437 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_87 1093124 : 1094243 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_88 1103610 : 1107960 5 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_89 1113755 : 1114643 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_90 1156792 : 1158256 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_91 1173001 : 1173970 1 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_92 1196209 : 1201038 7 Stx2-converting_phage(33.33%) NA NA
DBSCAN-SWA_93 1212135 : 1215031 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_94 1222203 : 1224231 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_95 1245038 : 1250185 5 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_96 1255722 : 1257045 1 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_97 1265669 : 1268306 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_98 1272553 : 1276900 3 Invertebrate_iridovirus(50.0%) NA NA
DBSCAN-SWA_99 1282057 : 1282681 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_100 1287059 : 1290407 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_101 1304251 : 1306248 2 Xanthomonas_phage(50.0%) NA NA
DBSCAN-SWA_102 1309520 : 1326650 12 uncultured_Caudovirales_phage(16.67%) tRNA NA
DBSCAN-SWA_103 1330739 : 1333676 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_104 1339092 : 1340504 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_105 1344368 : 1347501 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_106 1351278 : 1354031 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_107 1357361 : 1358183 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_108 1372207 : 1380370 5 Hokovirus(33.33%) NA NA
DBSCAN-SWA_109 1388249 : 1402390 12 Escherichia_phage(20.0%) holin NA
DBSCAN-SWA_110 1408281 : 1410639 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_111 1422772 : 1433624 11 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_112 1440342 : 1442256 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_113 1454203 : 1455040 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_114 1464202 : 1466344 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_115 1484786 : 1492309 6 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_116 1496228 : 1497888 3 Leuconostoc_phage(50.0%) NA NA
DBSCAN-SWA_117 1504324 : 1506771 2 Lactobacillus_virus(50.0%) NA NA
DBSCAN-SWA_118 1514612 : 1516244 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_119 1550891 : 1551326 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_120 1556019 : 1557282 1 Archaeal_BJ1_virus(100.0%) NA NA
DBSCAN-SWA_121 1588236 : 1596537 5 Vibrio_phage(66.67%) NA NA
DBSCAN-SWA_122 1605409 : 1610476 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_123 1616396 : 1617059 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_124 1622710 : 1625554 5 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_125 1632225 : 1632696 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_126 1644450 : 1647480 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_127 1654424 : 1655117 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_128 1661708 : 1662548 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_129 1674090 : 1675110 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_130 1686351 : 1690288 3 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_131 1694294 : 1694768 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_132 1698546 : 1703034 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_133 1714982 : 1715717 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_134 1727278 : 1730338 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_135 1735810 : 1741959 4 Aeromonas_phage(33.33%) NA NA
DBSCAN-SWA_136 1747170 : 1749719 2 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_137 1754663 : 1755170 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_138 1758436 : 1758973 1 Ochrobactrum_phage(100.0%) NA NA
DBSCAN-SWA_139 1764915 : 1766766 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_140 1788776 : 1790354 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_141 1794861 : 1801646 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_142 1818512 : 1819421 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_143 1830324 : 1837881 6 Ectocarpus_siliculosus_virus(33.33%) NA NA
DBSCAN-SWA_144 1848886 : 1851300 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_145 1857002 : 1861014 3 Sulfolobus_monocaudavirus(50.0%) NA NA
DBSCAN-SWA_146 1864474 : 1867879 2 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_147 1871246 : 1874213 1 Hokovirus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP020427
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 8119 6 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_2 21730 : 23290 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_3 26348 : 27536 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_4 30786 : 32448 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_5 46508 : 50212 3 Cyanophage(50.0%) NA NA
DBSCAN-SWA_6 107494 : 117990 8 Staphylococcus_phage(20.0%) protease NA
DBSCAN-SWA_7 142693 : 153987 12 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_8 163024 : 168138 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_9 182061 : 183981 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_10 191009 : 192827 1 Pseudoalteromonas_phage(100.0%) NA NA
DBSCAN-SWA_11 199486 : 213458 18 Vibrio_phage(84.62%) NA NA
DBSCAN-SWA_12 219144 : 229332 10 uncultured_virus(50.0%) tRNA NA
DBSCAN-SWA_13 233442 : 235762 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_14 239130 : 248726 5 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_15 254211 : 258095 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_16 261435 : 262155 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_17 270354 : 274512 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_18 280572 : 281415 1 Mimivirus(100.0%) NA NA
DBSCAN-SWA_19 300259 : 314086 11 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_20 319768 : 327053 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_21 330964 : 334486 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_22 342327 : 342621 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_23 365627 : 367631 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_24 371649 : 377446 3 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_25 399481 : 401407 2 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_26 424392 : 425199 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_27 444085 : 447865 3 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_28 453545 : 454667 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_29 467627 : 468437 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_30 476378 : 477800 2 Shewanella_sp._phage(50.0%) NA NA
DBSCAN-SWA_31 495436 : 502179 5 Geobacillus_virus(25.0%) tRNA NA
DBSCAN-SWA_32 510603 : 513087 2 Agrobacterium_phage(50.0%) tRNA NA
DBSCAN-SWA_33 520279 : 521815 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_34 536397 : 538752 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_35 543531 : 544869 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_36 548371 : 555538 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_37 564251 : 568993 4 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_38 575728 : 576880 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_39 580768 : 581440 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_40 594796 : 597784 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_41 614858 : 615506 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_42 623225 : 624839 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_43 632493 : 635595 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_44 645089 : 645872 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_45 650796 : 653259 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_46 660838 : 663580 3 Serratia_phage(33.33%) tRNA NA
DBSCAN-SWA_47 667723 : 668461 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_48 684472 : 688833 5 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_49 694460 : 707671 11 Streptococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_50 714142 : 715471 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_51 724570 : 726208 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_52 731293 : 734713 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_53 741344 : 742583 1 Vibrio_phage(100.0%) integrase attL 735586:735598|attR 745470:745482
DBSCAN-SWA_54 745885 : 754583 6 Vibrio_phage(33.33%) integrase NA
DBSCAN-SWA_55 767131 : 772852 5 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_56 788210 : 788924 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_57 795980 : 800425 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_58 806103 : 809660 3 Agrobacterium_phage(33.33%) protease NA
DBSCAN-SWA_59 815553 : 820032 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_60 825352 : 826123 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_61 830128 : 834422 3 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_62 838376 : 839648 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_63 843224 : 844973 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_64 849232 : 849940 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_65 863561 : 870433 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_66 874719 : 876723 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_67 897689 : 899132 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_68 912142 : 917069 4 Sodalis_phage(25.0%) protease NA
DBSCAN-SWA_69 925780 : 927250 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_70 933974 : 937459 3 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_71 946561 : 948115 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_72 953764 : 954490 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_73 957941 : 958802 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_74 965936 : 975895 9 Hepacivirus(25.0%) tRNA NA
DBSCAN-SWA_75 984718 : 985507 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_76 1001980 : 1006667 6 Mycobacterium_phage(50.0%) tRNA NA
DBSCAN-SWA_77 1013230 : 1021246 6 Mimivirus(33.33%) NA NA
DBSCAN-SWA_78 1034923 : 1042522 6 Serratia_phage(33.33%) NA NA
DBSCAN-SWA_79 1051194 : 1052121 1 Sulfitobacter_phage(100.0%) NA NA
DBSCAN-SWA_80 1059970 : 1060897 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_81 1071905 : 1074641 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_82 1085644 : 1086496 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_83 1092696 : 1093641 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_84 1101392 : 1102490 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_85 1106242 : 1108816 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_86 1114516 : 1120322 6 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_87 1129336 : 1130371 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_88 1133417 : 1134263 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_89 1141072 : 1141825 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_90 1154365 : 1165056 11 Staphylococcus_phage(42.86%) NA NA
DBSCAN-SWA_91 1170882 : 1176668 2 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_92 1183166 : 1186430 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_93 1194967 : 1205887 10 Staphylococcus_phage(16.67%) integrase attL 1195872:1195891|attR 1201889:1201908
DBSCAN-SWA_94 1209136 : 1215271 4 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_95 1227450 : 1230481 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_96 1240846 : 1246643 8 Moumouvirus(20.0%) NA NA
DBSCAN-SWA_97 1250532 : 1257656 6 uncultured_Mediterranean_phage(75.0%) tRNA,protease NA
DBSCAN-SWA_98 1266555 : 1267374 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_99 1276057 : 1280793 4 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_100 1289168 : 1296078 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_101 1299088 : 1307057 6 Pseudomonas_phage(25.0%) NA NA
DBSCAN-SWA_102 1313219 : 1320716 6 Enterobacteria_phage(33.33%) tRNA NA
DBSCAN-SWA_103 1328637 : 1333453 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_104 1339274 : 1345649 5 Catovirus(25.0%) tRNA NA
DBSCAN-SWA_105 1348897 : 1350121 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_106 1354345 : 1356901 3 Equid_alphaherpesvirus(33.33%) NA NA
DBSCAN-SWA_107 1365388 : 1367740 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_108 1394336 : 1395476 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_109 1418456 : 1423405 6 Streptococcus_phage(33.33%) protease NA
DBSCAN-SWA_110 1430458 : 1437300 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_111 1441917 : 1443348 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_112 1446377 : 1456926 9 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_113 1460490 : 1466296 5 Moraxella_phage(25.0%) tRNA NA
DBSCAN-SWA_114 1474355 : 1481036 6 Verrucomicrobia_phage(33.33%) NA NA
DBSCAN-SWA_115 1486613 : 1489227 2 Escherichia_phage(50.0%) integrase attL 1475436:1475449|attR 1494230:1494243
DBSCAN-SWA_116 1509562 : 1514150 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_117 1520276 : 1524260 2 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_118 1543045 : 1543528 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_119 1547233 : 1548205 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_120 1554661 : 1555867 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_121 1561049 : 1563605 4 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_122 1572261 : 1572990 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_123 1576056 : 1580085 3 Freshwater_phage(50.0%) NA NA
DBSCAN-SWA_124 1584914 : 1586294 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_125 1608815 : 1610147 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_126 1617001 : 1624068 4 Clostridium_botulinum_C_phage(25.0%) NA NA
DBSCAN-SWA_127 1627490 : 1628054 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_128 1632399 : 1635232 3 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_129 1644671 : 1645613 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_130 1655939 : 1656659 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_131 1660675 : 1661827 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_132 1665456 : 1669368 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_133 1673148 : 1676206 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_134 1681126 : 1682860 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_135 1687625 : 1690226 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_136 1695567 : 1696191 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_137 1701978 : 1705552 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_138 1724597 : 1731099 5 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_139 1737033 : 1742760 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_140 1754338 : 1757134 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_141 1760797 : 1770710 9 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_142 1788915 : 1790958 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_143 1803614 : 1804967 1 Marseillevirus(100.0%) NA NA
DBSCAN-SWA_144 1816349 : 1818065 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_145 1821110 : 1823126 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_146 1839145 : 1839769 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_147 1846119 : 1846368 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_148 1854770 : 1861131 5 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_149 1864559 : 1866267 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_150 1872925 : 1874604 2 Natrialba_phage(50.0%) NA NA
DBSCAN-SWA_151 1881901 : 1883263 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_152 1892045 : 1893692 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_153 1908464 : 1910060 2 Prochlorococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_154 1915309 : 1915867 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_155 1925830 : 1926214 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_156 1932970 : 1934761 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_157 1940323 : 1954454 11 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_158 1977091 : 1978024 1 Virus_Rctr41k(100.0%) NA NA
DBSCAN-SWA_159 1988297 : 1988633 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_160 1992370 : 1993384 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_161 1999324 : 2001993 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_162 2008515 : 2009136 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_163 2035369 : 2038183 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_164 2042153 : 2050460 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_165 2058587 : 2058863 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_166 2071402 : 2078461 5 Vibrio_phage(66.67%) NA NA
DBSCAN-SWA_167 2098052 : 2101096 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_168 2107456 : 2109409 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_169 2113676 : 2117108 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_170 2131343 : 2134117 3 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_171 2138797 : 2142252 4 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_172 2146315 : 2147719 1 Vibrio_virus(100.0%) NA NA
DBSCAN-SWA_173 2151573 : 2155912 5 Catovirus(50.0%) NA NA
DBSCAN-SWA_174 2162403 : 2164284 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_175 2168308 : 2168854 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_176 2173038 : 2176786 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_177 2182174 : 2188830 5 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_178 2195663 : 2197824 2 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_179 2205322 : 2207242 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_180 2214831 : 2220564 7 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_181 2228629 : 2229169 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_182 2239997 : 2240726 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_183 2247274 : 2249017 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_184 2252495 : 2253335 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_185 2256941 : 2258342 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_186 2283821 : 2289028 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_187 2294208 : 2299752 4 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_188 2319387 : 2320431 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_189 2330278 : 2338544 5 Vibrio_phage(33.33%) tRNA NA
DBSCAN-SWA_190 2342527 : 2350705 10 Thermobifida_phage(25.0%) NA NA
DBSCAN-SWA_191 2356447 : 2357377 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_192 2363623 : 2368649 3 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_193 2391790 : 2395723 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_194 2400217 : 2401396 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_195 2412968 : 2414123 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_196 2417541 : 2419500 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_197 2427728 : 2428961 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_198 2439996 : 2453590 13 Sinorhizobium_phage(20.0%) NA NA
DBSCAN-SWA_199 2457160 : 2476236 17 uncultured_Mediterranean_phage(16.67%) tRNA NA
DBSCAN-SWA_200 2509153 : 2531267 18 Erysipelothrix_phage(14.29%) tRNA NA
DBSCAN-SWA_201 2535153 : 2541870 5 Ostreococcus_tauri_virus(33.33%) NA NA
DBSCAN-SWA_202 2550136 : 2551120 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_203 2555898 : 2559285 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_204 2563589 : 2569610 4 Lake_Baikal_phage(33.33%) NA NA
DBSCAN-SWA_205 2577068 : 2579048 1 Ostreococcus_lucimarinus_virus(100.0%) protease NA
DBSCAN-SWA_206 2595359 : 2596373 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_207 2601552 : 2603142 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_208 2607127 : 2608456 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_209 2616493 : 2621766 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_210 2640965 : 2646797 3 Herpes_simplex_virus(50.0%) NA NA
DBSCAN-SWA_211 2677345 : 2683167 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_212 2689695 : 2690907 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_213 2710025 : 2715999 4 Diadromus_pulchellus_ascovirus(50.0%) NA NA
DBSCAN-SWA_214 2736975 : 2738586 2 Flavobacterium_phage(50.0%) NA NA
DBSCAN-SWA_215 2747894 : 2752092 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_216 2757013 : 2764761 7 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_217 2769330 : 2771148 2 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_218 2775509 : 2776433 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_219 2818753 : 2819902 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_220 2824147 : 2827888 5 Natrialba_phage(50.0%) NA NA
DBSCAN-SWA_221 2839350 : 2839926 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_222 2844545 : 2851087 5 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_223 2857595 : 2858729 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_224 2868595 : 2876085 6 Mollivirus(25.0%) NA NA
DBSCAN-SWA_225 2891178 : 2893215 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_226 2903693 : 2907902 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_227 2917225 : 2918338 1 Pseudomonas_virus(100.0%) integrase attL 2908067:2908096|attR 2924638:2924667
DBSCAN-SWA_228 2927030 : 2928029 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_229 2933831 : 2934689 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_230 2940554 : 2944590 5 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_231 2957267 : 2959982 3 Feldmannia_irregularis_virus(50.0%) NA NA
DBSCAN-SWA_232 2967332 : 2969293 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_233 2990480 : 2994599 3 Indivirus(50.0%) tRNA NA
DBSCAN-SWA_234 2998177 : 2999737 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_235 3009330 : 3010544 2 Diadromus_pulchellus_ascovirus(50.0%) NA NA
DBSCAN-SWA_236 3013823 : 3014456 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_237 3026303 : 3030390 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_238 3033629 : 3037886 4 Bodo_saltans_virus(50.0%) protease NA
DBSCAN-SWA_239 3043491 : 3044502 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_240 3053481 : 3056574 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_241 3073813 : 3074533 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_242 3086238 : 3092037 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_243 3100963 : 3105192 4 Xanthomonas_phage(50.0%) NA NA
DBSCAN-SWA_244 3108322 : 3109864 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_245 3112885 : 3115947 3 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_246 3123593 : 3125957 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_247 3131101 : 3133978 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_248 3139716 : 3147647 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_249 3156659 : 3157256 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_250 3164794 : 3165451 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_251 3173347 : 3177029 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_252 3184961 : 3193158 6 Bandra_megavirus(25.0%) tRNA NA
DBSCAN-SWA_253 3196346 : 3196718 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_254 3203968 : 3207161 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_255 3215325 : 3216288 1 Virus_Rctr41k(100.0%) integrase attL 3206603:3206614|attR 3217177:3217188
DBSCAN-SWA_256 3220970 : 3221798 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_257 3262533 : 3263683 1 Acinetobacter_phage(100.0%) transposase NA
DBSCAN-SWA_258 3269495 : 3277635 7 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_259 3291343 : 3294499 1 Hokovirus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage