Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020410 Corynebacterium diphtheriae strain FDAARGOS_197 chromosome, complete genome 5 crisprs DEDDh,cas3,WYL,cas4,csa3,DinG,cas5,cas7,cse2gr11,cas8e,cas6e,cas1,cas2,cas9 1 31 5 0

Results visualization

1. NZ_CP020410
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020410_1 357502-357601 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020410_2 877268-877380 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020410_3 1203024-1203131 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020410_4 1684657-1686273 TypeI-E I-C,I-E,II-B
26 spacers
cas2,cas1,cas3,cas6e,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020410_5 1906284-1906766 TypeII NA
7 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP020410_1 1.1|357538|28|NZ_CP020410|CRISPRCasFinder 357538-357565 28 NZ_CP020410.2 1149239-1149266 0 1.0

1. spacer 1.1|357538|28|NZ_CP020410|CRISPRCasFinder matches to position: 1149239-1149266, mismatch: 0, identity: 1.0

gccaaaagcgaggtcggtgaagtaacgg	CRISPR spacer
gccaaaagcgaggtcggtgaagtaacgg	Protospacer
****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020410_5 5.6|1906640|28|NZ_CP020410|CRISPRCasFinder,CRT 1906640-1906667 28 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 439432-439459 4 0.857
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 MK977714 Corynebacterium phage Bran, complete genome 22540-22566 4 0.852
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NC_048780 Corynebacterium phage StAB, complete genome 22546-22572 4 0.852
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 MK977706 Corynebacterium phage Dina, complete genome 22371-22397 4 0.852
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 MH926061 Corynebacterium phage Troy, complete genome 22111-22137 4 0.852
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NC_048789 Corynebacterium phage Stiles, complete genome 22038-22064 4 0.852
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NC_048069 Corynebacterium phage SamW, complete genome 22111-22137 4 0.852
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NC_048790 Corynebacterium phage Lederberg, complete genome 22496-22522 4 0.852
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NC_008713 Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence 175979-176006 5 0.821
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NZ_CP050151 Hafnia alvei strain A23BA plasmid pA23BA, complete sequence 49256-49283 5 0.821
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NC_006462 Thermus thermophilus HB8 plasmid pTT27, complete sequence 83692-83719 5 0.821
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NC_005838 Thermus thermophilus HB27 plasmid pTT27, complete sequence 44685-44712 5 0.821
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NZ_LR723672 Rhizobium flavum strain YW14 plasmid 3 116009-116036 5 0.821
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NZ_AP019802 Thermus thermophilus strain HC11 plasmid pHC11, complete sequence 206666-206693 5 0.821
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 169770-169797 5 0.821
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 109618-109645 5 0.821
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NZ_LS974446 Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence 8763-8790 5 0.821
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 48591-48617 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 59503-59529 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 48165-48191 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 48287-48313 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 48835-48861 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 48957-48983 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 59231-59257 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 59292-59318 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 59686-59712 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 323967-323993 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NC_048789 Corynebacterium phage Stiles, complete genome 22100-22126 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 107125-107151 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 116966-116992 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 125669-125695 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP038146 Streptomyces sp. S501 plasmid unnamed, complete sequence 170756-170782 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP038146 Streptomyces sp. S501 plasmid unnamed, complete sequence 170817-170843 5 0.815
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP038146 Streptomyces sp. S501 plasmid unnamed, complete sequence 171189-171215 5 0.815
NZ_CP020410_5 5.10|1906639|29|NZ_CP020410|PILER-CR 1906639-1906667 29 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 439432-439460 5 0.828
NZ_CP020410_1 1.1|357538|28|NZ_CP020410|CRISPRCasFinder 357538-357565 28 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 257868-257895 6 0.786
NZ_CP020410_1 1.1|357538|28|NZ_CP020410|CRISPRCasFinder 357538-357565 28 NZ_AP018531 Butyricicoccus sp. GAM44 plasmid pGAM44_1, complete sequence 9899-9926 6 0.786
NZ_CP020410_4 4.47|1685908|32|NZ_CP020410|CRISPRCasFinder,CRT 1685908-1685939 32 MK620899 Gordonia phage GodonK, complete genome 105655-105686 6 0.812
NZ_CP020410_4 4.51|1686152|32|NZ_CP020410|CRISPRCasFinder,CRT 1686152-1686183 32 MK620899 Gordonia phage GodonK, complete genome 105655-105686 6 0.812
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NC_007353 Sphingomonas sp. A1 plasmid pA1 DNA, complete sequence 43724-43751 6 0.786
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NZ_CP021147 Vibrio campbellii strain LA16-V1 plasmid pLA16-1, complete sequence 104200-104227 6 0.786
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NZ_CP020811 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence 49791-49818 6 0.786
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 NZ_CP020811 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence 136125-136152 6 0.786
NZ_CP020410_5 5.5|1906576|28|NZ_CP020410|CRISPRCasFinder,CRT 1906576-1906603 28 KM507819 Escherichia phage 121Q, complete genome 237274-237301 6 0.786
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 49140-49166 6 0.778
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 60296-60322 6 0.778
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 372956-372982 6 0.778
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 117390-117416 6 0.778
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP038146 Streptomyces sp. S501 plasmid unnamed, complete sequence 171311-171337 6 0.778
NZ_CP020410_5 5.7|1906704|27|NZ_CP020410|CRT 1906704-1906730 27 NZ_CP038146 Streptomyces sp. S501 plasmid unnamed, complete sequence 171372-171398 6 0.778
NZ_CP020410_4 4.13|1685419|33|NZ_CP020410|PILER-CR 1685419-1685451 33 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 688346-688378 7 0.788
NZ_CP020410_4 4.21|1685907|33|NZ_CP020410|PILER-CR 1685907-1685939 33 MK620899 Gordonia phage GodonK, complete genome 105655-105687 7 0.788
NZ_CP020410_4 4.25|1686151|33|NZ_CP020410|PILER-CR 1686151-1686183 33 MK620899 Gordonia phage GodonK, complete genome 105655-105687 7 0.788
NZ_CP020410_4 4.33|1685054|32|NZ_CP020410|CRISPRCasFinder,CRT 1685054-1685085 32 NC_049970 Bacillus phage Karezi, complete genome 1033-1064 7 0.781
NZ_CP020410_4 4.34|1685115|32|NZ_CP020410|CRISPRCasFinder,CRT 1685115-1685146 32 NC_049970 Bacillus phage Karezi, complete genome 1033-1064 7 0.781
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 688347-688378 7 0.781
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 NZ_CP005961 Pseudomonas mandelii JR-1 plasmid unnamed, complete sequence 168781-168812 7 0.781
NZ_CP020410_5 5.1|1906320|28|NZ_CP020410|CRISPRCasFinder,CRT 1906320-1906347 28 NZ_CP053812 Vibrio cholerae strain W6G plasmid pW6G, complete sequence 21099-21126 7 0.75
NZ_CP020410_5 5.1|1906320|28|NZ_CP020410|CRISPRCasFinder,CRT 1906320-1906347 28 NZ_CP053815 Vibrio cholerae strain W7G plasmid pW7G, complete sequence 283411-283438 7 0.75
NZ_CP020410_5 5.2|1906384|28|NZ_CP020410|CRISPRCasFinder,CRT 1906384-1906411 28 NC_021534 Vibrio phage pYD38-A genomic sequence 40923-40950 7 0.75
NZ_CP020410_5 5.2|1906384|28|NZ_CP020410|CRISPRCasFinder,CRT 1906384-1906411 28 JF974294 Aeromonas phage pIS4-A genomic sequence 31488-31515 7 0.75
NZ_CP020410_5 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT 1906448-1906475 28 KR053194 Gordonia phage GAL1, complete genome 25514-25541 7 0.75
NZ_CP020410_5 5.4|1906512|28|NZ_CP020410|CRISPRCasFinder,CRT 1906512-1906539 28 NZ_CP023524 Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence 99389-99416 7 0.75
NZ_CP020410_5 5.9|1906575|29|NZ_CP020410|PILER-CR 1906575-1906603 29 KM507819 Escherichia phage 121Q, complete genome 237273-237301 7 0.759
NZ_CP020410_4 4.7|1685053|33|NZ_CP020410|PILER-CR 1685053-1685085 33 NC_049970 Bacillus phage Karezi, complete genome 1033-1065 8 0.758
NZ_CP020410_4 4.8|1685114|33|NZ_CP020410|PILER-CR 1685114-1685146 33 NC_049970 Bacillus phage Karezi, complete genome 1033-1065 8 0.758
NZ_CP020410_4 4.9|1685175|33|NZ_CP020410|PILER-CR 1685175-1685207 33 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 290839-290871 8 0.758
NZ_CP020410_4 4.35|1685176|32|NZ_CP020410|CRISPRCasFinder,CRT 1685176-1685207 32 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 290840-290871 8 0.75
NZ_CP020410_4 4.36|1685237|32|NZ_CP020410|CRISPRCasFinder,CRT 1685237-1685268 32 NZ_AP018393 Lactobacillus paracasei strain IJH-SONE68 plasmid pLPS-1, complete sequence 33030-33061 8 0.75
NZ_CP020410_4 4.37|1685298|32|NZ_CP020410|CRISPRCasFinder,CRT 1685298-1685329 32 NZ_CP041042 Paracoccus sp. AK26 plasmid pAK4, complete sequence 13705-13736 8 0.75
NZ_CP020410_4 4.47|1685908|32|NZ_CP020410|CRISPRCasFinder,CRT 1685908-1685939 32 NZ_LS974446 Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence 72354-72385 8 0.75
NZ_CP020410_4 4.47|1685908|32|NZ_CP020410|CRISPRCasFinder,CRT 1685908-1685939 32 MN096369 Gordonia phage Phendrix, complete genome 104211-104242 8 0.75
NZ_CP020410_4 4.47|1685908|32|NZ_CP020410|CRISPRCasFinder,CRT 1685908-1685939 32 NZ_CP010729 Phaeobacter inhibens strain P88 plasmid pP88_d, complete sequence 10826-10857 8 0.75
NZ_CP020410_4 4.51|1686152|32|NZ_CP020410|CRISPRCasFinder,CRT 1686152-1686183 32 NZ_LS974446 Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence 72354-72385 8 0.75
NZ_CP020410_4 4.51|1686152|32|NZ_CP020410|CRISPRCasFinder,CRT 1686152-1686183 32 MN096369 Gordonia phage Phendrix, complete genome 104211-104242 8 0.75
NZ_CP020410_4 4.51|1686152|32|NZ_CP020410|CRISPRCasFinder,CRT 1686152-1686183 32 NZ_CP010729 Phaeobacter inhibens strain P88 plasmid pP88_d, complete sequence 10826-10857 8 0.75
NZ_CP020410_5 5.8|1906511|29|NZ_CP020410|PILER-CR 1906511-1906539 29 NZ_CP023524 Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence 99388-99416 8 0.724
NZ_CP020410_4 4.3|1684807|33|NZ_CP020410|PILER-CR 1684807-1684839 33 NZ_CP020932 Marinobacter salarius strain SMR5 plasmid pSMR5, complete sequence 69972-70004 9 0.727
NZ_CP020410_4 4.13|1685419|33|NZ_CP020410|PILER-CR 1685419-1685451 33 NC_002147 Agrobacterium tumefaciens MAFF301001 plasmid pTi-SAKURA, complete sequence 44204-44236 9 0.727
NZ_CP020410_4 4.13|1685419|33|NZ_CP020410|PILER-CR 1685419-1685451 33 NZ_MK439386 Agrobacterium tumefaciens strain T37 plasmid pTiT37, complete sequence 77049-77081 9 0.727
NZ_CP020410_4 4.13|1685419|33|NZ_CP020410|PILER-CR 1685419-1685451 33 NZ_KY000041 Agrobacterium tumefaciens strain CFBP296 plasmid pTi_CFBP296, complete sequence 98834-98866 9 0.727
NZ_CP020410_4 4.13|1685419|33|NZ_CP020410|PILER-CR 1685419-1685451 33 NZ_KY000044 Agrobacterium fabrum strain CFBP1933 plasmid pTi_CFBP1933, complete sequence 33264-33296 9 0.727
NZ_CP020410_4 4.13|1685419|33|NZ_CP020410|PILER-CR 1685419-1685451 33 NZ_KY000057 Agrobacterium fabrum strain CFBP5505 plasmid pTi_CFBP5505, complete sequence 76774-76806 9 0.727
NZ_CP020410_4 4.13|1685419|33|NZ_CP020410|PILER-CR 1685419-1685451 33 NZ_KY000046 Agrobacterium genomosp. 1 strain CFBP2177 plasmid pTi_CFBP2177, complete sequence 87895-87927 9 0.727
NZ_CP020410_4 4.21|1685907|33|NZ_CP020410|PILER-CR 1685907-1685939 33 NZ_LS974446 Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence 72353-72385 9 0.727
NZ_CP020410_4 4.21|1685907|33|NZ_CP020410|PILER-CR 1685907-1685939 33 MN096369 Gordonia phage Phendrix, complete genome 104211-104243 9 0.727
NZ_CP020410_4 4.25|1686151|33|NZ_CP020410|PILER-CR 1686151-1686183 33 NZ_LS974446 Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence 72353-72385 9 0.727
NZ_CP020410_4 4.25|1686151|33|NZ_CP020410|PILER-CR 1686151-1686183 33 MN096369 Gordonia phage Phendrix, complete genome 104211-104243 9 0.727
NZ_CP020410_4 4.29|1684808|32|NZ_CP020410|CRISPRCasFinder,CRT 1684808-1684839 32 NZ_CP020932 Marinobacter salarius strain SMR5 plasmid pSMR5, complete sequence 69973-70004 9 0.719
NZ_CP020410_4 4.36|1685237|32|NZ_CP020410|CRISPRCasFinder,CRT 1685237-1685268 32 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 344093-344124 9 0.719
NZ_CP020410_4 4.36|1685237|32|NZ_CP020410|CRISPRCasFinder,CRT 1685237-1685268 32 NZ_CP017303 Rhodococcus sp. YL-1 plasmid pYLL1 sequence 234855-234886 9 0.719
NZ_CP020410_4 4.36|1685237|32|NZ_CP020410|CRISPRCasFinder,CRT 1685237-1685268 32 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 437424-437455 9 0.719
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 NC_002147 Agrobacterium tumefaciens MAFF301001 plasmid pTi-SAKURA, complete sequence 44205-44236 9 0.719
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 NZ_MK439386 Agrobacterium tumefaciens strain T37 plasmid pTiT37, complete sequence 77050-77081 9 0.719
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 NZ_KY000041 Agrobacterium tumefaciens strain CFBP296 plasmid pTi_CFBP296, complete sequence 98835-98866 9 0.719
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 NZ_KY000044 Agrobacterium fabrum strain CFBP1933 plasmid pTi_CFBP1933, complete sequence 33265-33296 9 0.719
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 NZ_KY000057 Agrobacterium fabrum strain CFBP5505 plasmid pTi_CFBP5505, complete sequence 76775-76806 9 0.719
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 NZ_KY000046 Agrobacterium genomosp. 1 strain CFBP2177 plasmid pTi_CFBP2177, complete sequence 87896-87927 9 0.719
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 NC_042008 Streptomyces phage Mildred21, complete genome 55245-55276 9 0.719
NZ_CP020410_4 4.40|1685481|32|NZ_CP020410|CRISPRCasFinder,CRT 1685481-1685512 32 NZ_CP022991 Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence 642143-642174 9 0.719
NZ_CP020410_4 4.47|1685908|32|NZ_CP020410|CRISPRCasFinder,CRT 1685908-1685939 32 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 461105-461136 9 0.719
NZ_CP020410_4 4.51|1686152|32|NZ_CP020410|CRISPRCasFinder,CRT 1686152-1686183 32 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 461105-461136 9 0.719
NZ_CP020410_4 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT 1686213-1686244 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1784205-1784236 9 0.719
NZ_CP020410_4 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT 1686213-1686244 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1843098-1843129 9 0.719
NZ_CP020410_4 4.21|1685907|33|NZ_CP020410|PILER-CR 1685907-1685939 33 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 461104-461136 10 0.697
NZ_CP020410_4 4.25|1686151|33|NZ_CP020410|PILER-CR 1686151-1686183 33 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 461104-461136 10 0.697
NZ_CP020410_4 4.26|1686212|33|NZ_CP020410|PILER-CR 1686212-1686244 33 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1784205-1784237 10 0.697
NZ_CP020410_4 4.26|1686212|33|NZ_CP020410|PILER-CR 1686212-1686244 33 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1843097-1843129 10 0.697
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 704429-704460 10 0.688
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 MN694320 Marine virus AFVG_250M198, complete genome 40917-40948 10 0.688
NZ_CP020410_4 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT 1685420-1685451 32 KT898133 Aeromonas phage phiARM81ld, complete genome 17895-17926 10 0.688
NZ_CP020410_4 4.40|1685481|32|NZ_CP020410|CRISPRCasFinder,CRT 1685481-1685512 32 NZ_CP020413 Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence 276941-276972 10 0.688
NZ_CP020410_4 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT 1685664-1685695 32 MN508623 UNVERIFIED: Enterobacter phage EC-F1, complete genome 38136-38167 10 0.688
NZ_CP020410_4 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT 1685664-1685695 32 MN508624 UNVERIFIED: Enterobacter phage EC-F2, complete genome 38187-38218 10 0.688
NZ_CP020410_4 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT 1685664-1685695 32 KM236237 Citrobacter phage Miller, complete genome 94106-94137 10 0.688
NZ_CP020410_4 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT 1685664-1685695 32 KX431560 Cronobacter phage vB_CsaM_leN, complete genome 93931-93962 10 0.688
NZ_CP020410_4 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT 1685664-1685695 32 NC_048646 Cronobacter phage vB_CsaM_leE, complete genome 95152-95183 10 0.688
NZ_CP020410_4 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT 1685664-1685695 32 KC801932 Escherichia phage Lw1, complete genome 92345-92376 10 0.688
NZ_CP020410_4 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT 1685664-1685695 32 MN508621 UNVERIFIED: Enterobacter phage EC-W1, complete genome 109130-109161 10 0.688
NZ_CP020410_4 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT 1685664-1685695 32 MT341500 Enterobacter phage EBPL, complete genome 95779-95810 10 0.688
NZ_CP020410_4 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT 1685664-1685695 32 MN508622 UNVERIFIED: Enterobacter phage EC-W2, complete genome 88868-88899 10 0.688
NZ_CP020410_4 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT 1685664-1685695 32 NC_029013 Citrobacter phage IME-CF2, complete genome 25228-25259 10 0.688
NZ_CP020410_4 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT 1686213-1686244 32 MT889374 Mycobacterium phage Firehouse51, complete genome 27813-27844 10 0.688
NZ_CP020410_4 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT 1686213-1686244 32 MN586005 Mycobacterium phage Lorde, complete genome 26908-26939 10 0.688
NZ_CP020410_4 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT 1686213-1686244 32 MH669001 Mycobacterium phage EleanorGeorge, complete genome 27404-27435 10 0.688
NZ_CP020410_4 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT 1686213-1686244 32 JN699012 Mycobacterium phage SG4, complete genome 27418-27449 10 0.688
NZ_CP020410_4 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT 1686213-1686244 32 MN585987 Mycobacterium phage Enby, complete genome 26933-26964 10 0.688

1. spacer 5.6|1906640|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 4, identity: 0.857

tcggcgcgagcctcgctaggtgctgctg	CRISPR spacer
tcggcgcgagcctcgccaggtcctgcat	Protospacer
****************.**** ****  

2. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to MK977714 (Corynebacterium phage Bran, complete genome) position: , mismatch: 4, identity: 0.852

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
************.**********  * 

3. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NC_048780 (Corynebacterium phage StAB, complete genome) position: , mismatch: 4, identity: 0.852

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
************.**********  * 

4. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to MK977706 (Corynebacterium phage Dina, complete genome) position: , mismatch: 4, identity: 0.852

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
************.**********  * 

5. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to MH926061 (Corynebacterium phage Troy, complete genome) position: , mismatch: 4, identity: 0.852

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
************.**********  * 

6. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NC_048789 (Corynebacterium phage Stiles, complete genome) position: , mismatch: 4, identity: 0.852

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgt	Protospacer
************.**********  * 

7. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NC_048069 (Corynebacterium phage SamW, complete genome) position: , mismatch: 4, identity: 0.852

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
************.**********  * 

8. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NC_048790 (Corynebacterium phage Lederberg, complete genome) position: , mismatch: 4, identity: 0.852

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
************.**********  * 

9. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 5, identity: 0.821

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
ggaaggctctggtggtgtcgacgtccac	Protospacer
 * .****.***********.*******

10. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP050151 (Hafnia alvei strain A23BA plasmid pA23BA, complete sequence) position: , mismatch: 5, identity: 0.821

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
tgcgggcattggtggtgtcggcttaggc	Protospacer
******* ************** *  .*

11. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 5, identity: 0.821

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
tgcgggctttggtggtgggggcgggcat	Protospacer
*****************  ****  **.

12. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_005838 (Thermus thermophilus HB27 plasmid pTT27, complete sequence) position: , mismatch: 5, identity: 0.821

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
tgcgggctttggtggtgggggcgggcat	Protospacer
*****************  ****  **.

13. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_LR723672 (Rhizobium flavum strain YW14 plasmid 3) position: , mismatch: 5, identity: 0.821

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
ttctggctttgctggtgtcggcgtcaaa	Protospacer
* * ******* ************* * 

14. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 5, identity: 0.821

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
tgcgggctttggtggtgggggcgggcat	Protospacer
*****************  ****  **.

15. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 5, identity: 0.821

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
ttctggctttgctggtgtcggcgtcaaa	Protospacer
* * ******* ************* * 

16. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 5, identity: 0.821

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
ttctggctttgctggtgtcggcgtcaaa	Protospacer
* * ******* ************* * 

17. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_LS974446 (Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.821

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
ttctggctttgctggtgtcggcgtcaaa	Protospacer
* * ******* ************* * 

18. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtaccc	Protospacer
****** *******.*********   

19. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtaccg	Protospacer
****** *******.*********  .

20. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgttcca	Protospacer
****** *******.********   *

21. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtcgcc	Protospacer
****** *******.******** *  

22. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtggtc	Protospacer
****** *******.********.*  

23. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtgcta	Protospacer
****** *******.********.  *

24. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtgaca	Protospacer
****** *******.********.. *

25. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtcgtt	Protospacer
****** *******.******** *  

26. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtggcg	Protospacer
****** *******.********.* .

27. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggagatgagccgtcacc	Protospacer
****** **************** .  

28. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NC_048789 (Corynebacterium phage Stiles, complete genome) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgccagcggggatgagtcgtttgc	Protospacer
************.******.***  * 

29. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtcgtg	Protospacer
****** *******.******** * .

30. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtcagc	Protospacer
****** *******.******** .* 

31. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgttgcc	Protospacer
****** *******.******** *  

32. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgttgat	Protospacer
****** *******.******** *. 

33. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtccaa	Protospacer
****** *******.********  .*

34. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtcgct	Protospacer
****** *******.******** *  

35. spacer 5.10|1906639|29|NZ_CP020410|PILER-CR matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 5, identity: 0.828

ttcggcgcgagcctcgctaggtgctgctg	CRISPR spacer
gtcggcgcgagcctcgccaggtcctgcat	Protospacer
 ****************.**** ****  

36. spacer 1.1|357538|28|NZ_CP020410|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 6, identity: 0.786

---gccaaaagcgaggtcggtgaagtaacgg	CRISPR spacer
tgggtc---cgcgaggtcggtgaagtagcgg	Protospacer
   *.*    *****************.***

37. spacer 1.1|357538|28|NZ_CP020410|CRISPRCasFinder matches to NZ_AP018531 (Butyricicoccus sp. GAM44 plasmid pGAM44_1, complete sequence) position: , mismatch: 6, identity: 0.786

gccaaaagcgaggtcggtgaagtaacgg	CRISPR spacer
gcgcaaaccgaggtcggtgaagtaatat	Protospacer
**  *** *****************.. 

38. spacer 4.47|1685908|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MK620899 (Gordonia phage GodonK, complete genome) position: , mismatch: 6, identity: 0.812

aaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
acgaccaggtcgctgcccgtgacgctgccgag	Protospacer
* ..* ********** **************.

39. spacer 4.51|1686152|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MK620899 (Gordonia phage GodonK, complete genome) position: , mismatch: 6, identity: 0.812

aaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
acgaccaggtcgctgcccgtgacgctgccgag	Protospacer
* ..* ********** **************.

40. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_007353 (Sphingomonas sp. A1 plasmid pA1 DNA, complete sequence) position: , mismatch: 6, identity: 0.786

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
tgccggctttggtggtggcggcggtggc	Protospacer
*** ************* ***** . .*

41. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP021147 (Vibrio campbellii strain LA16-V1 plasmid pLA16-1, complete sequence) position: , mismatch: 6, identity: 0.786

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
tgcgggtttgggtggtgtcggcggcgtg	Protospacer
******.** ************* *   

42. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP020811 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
tgcggccgttggtggtgtcggcggcggt	Protospacer
***** * *************** * ..

43. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP020811 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
tgcggccgttggtggtgtcggcggcggt	Protospacer
***** * *************** * ..

44. spacer 5.5|1906576|28|NZ_CP020410|CRISPRCasFinder,CRT matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 6, identity: 0.786

atcgtctaacagttgctaaattttttgc	CRISPR spacer
ctggtctaacagttgctaaatattcagg	Protospacer
 * ****************** **. * 

45. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtcccc	Protospacer
****** *******.********    

46. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtcctc	Protospacer
****** *******.********    

47. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtcccg	Protospacer
****** *******.********   .

48. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgttcat	Protospacer
****** *******.********  . 

49. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgttcac	Protospacer
****** *******.********  . 

50. spacer 5.7|1906704|27|NZ_CP020410|CRT matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcgccagcggagatgagccgtagga	CRISPR spacer
ccgcgcgagcggaggtgagccgtccac	Protospacer
****** *******.********  . 

51. spacer 4.13|1685419|33|NZ_CP020410|PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 7, identity: 0.788

cgatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
cgatgaccgcggcctggtgcaggtcggtgtggg	Protospacer
*************** *********.. .* .*

52. spacer 4.21|1685907|33|NZ_CP020410|PILER-CR matches to MK620899 (Gordonia phage GodonK, complete genome) position: , mismatch: 7, identity: 0.788

taaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
cacgaccaggtcgctgcccgtgacgctgccgag	Protospacer
.* ..* ********** **************.

53. spacer 4.25|1686151|33|NZ_CP020410|PILER-CR matches to MK620899 (Gordonia phage GodonK, complete genome) position: , mismatch: 7, identity: 0.788

taaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
cacgaccaggtcgctgcccgtgacgctgccgag	Protospacer
.* ..* ********** **************.

54. spacer 4.33|1685054|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_049970 (Bacillus phage Karezi, complete genome) position: , mismatch: 7, identity: 0.781

attggtggataataggctaggtgattcttggt	CRISPR spacer
agttcaagataataggctagatgattcttggg	Protospacer
* *   .*************.********** 

55. spacer 4.34|1685115|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_049970 (Bacillus phage Karezi, complete genome) position: , mismatch: 7, identity: 0.781

attggtggataataggctaggtgattcttggt	CRISPR spacer
agttcaagataataggctagatgattcttggg	Protospacer
* *   .*************.********** 

56. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 7, identity: 0.781

gatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
gatgaccgcggcctggtgcaggtcggtgtggg	Protospacer
************** *********.. .* .*

57. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP005961 (Pseudomonas mandelii JR-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gatgaccgcggccttgtgcaggtca-agattag	CRISPR spacer
cttgaccccggcctcgtgcaggtcatcgatca-	Protospacer
  ***** ******.**********  ***.* 

58. spacer 5.1|1906320|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP053812 (Vibrio cholerae strain W6G plasmid pW6G, complete sequence) position: , mismatch: 7, identity: 0.75

gcggttcaacactcaaaaacaattccat	CRISPR spacer
tgggttcaagactcaataacaattcatc	Protospacer
  ******* ****** ********  .

59. spacer 5.1|1906320|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP053815 (Vibrio cholerae strain W7G plasmid pW7G, complete sequence) position: , mismatch: 7, identity: 0.75

gcggttcaacactcaaaaacaattccat	CRISPR spacer
tgggttcaagactcaataacaattcatc	Protospacer
  ******* ****** ********  .

60. spacer 5.2|1906384|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 7, identity: 0.75

acgctgcctgagccttgagcgagtgctg	CRISPR spacer
cctctgcctgagccttgagcgcgttggc	Protospacer
 * ****************** **    

61. spacer 5.2|1906384|28|NZ_CP020410|CRISPRCasFinder,CRT matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 7, identity: 0.75

acgctgcctgagccttgagcgagtgctg	CRISPR spacer
cctctgcctgagccttgagcgcgttggc	Protospacer
 * ****************** **    

62. spacer 5.3|1906448|28|NZ_CP020410|CRISPRCasFinder,CRT matches to KR053194 (Gordonia phage GAL1, complete genome) position: , mismatch: 7, identity: 0.75

tgcgggctttggtggtgtcggcgtccac	CRISPR spacer
tgcgggctttgatggcgtcggcggtgcg	Protospacer
***********.***.******* .   

63. spacer 5.4|1906512|28|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gcgcgagcggcttccacgtaccatagaa	CRISPR spacer
gcgcgagcggcttccgcgtacatgcgtt	Protospacer
***************.*****    *  

64. spacer 5.9|1906575|29|NZ_CP020410|PILER-CR matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 7, identity: 0.759

tatcgtctaacagttgctaaattttttgc	CRISPR spacer
actggtctaacagttgctaaatattcagg	Protospacer
  * ****************** **. * 

65. spacer 4.7|1685053|33|NZ_CP020410|PILER-CR matches to NC_049970 (Bacillus phage Karezi, complete genome) position: , mismatch: 8, identity: 0.758

cattggtggataataggctaggtgattcttggt	CRISPR spacer
gagttcaagataataggctagatgattcttggg	Protospacer
 * *   .*************.********** 

66. spacer 4.8|1685114|33|NZ_CP020410|PILER-CR matches to NC_049970 (Bacillus phage Karezi, complete genome) position: , mismatch: 8, identity: 0.758

cattggtggataataggctaggtgattcttggt	CRISPR spacer
gagttcaagataataggctagatgattcttggg	Protospacer
 * *   .*************.********** 

67. spacer 4.9|1685175|33|NZ_CP020410|PILER-CR matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 8, identity: 0.758

cgacgaaaaaggaggcgatcgccggttctatcg	CRISPR spacer
cgacgaggaaggaggcgatcgccgtcatcagcg	Protospacer
******..**************** . ..* **

68. spacer 4.35|1685176|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 8, identity: 0.75

gacgaaaaaggaggcgatcgccggttctatcg	CRISPR spacer
gacgaggaaggaggcgatcgccgtcatcagcg	Protospacer
*****..**************** . ..* **

69. spacer 4.36|1685237|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_AP018393 (Lactobacillus paracasei strain IJH-SONE68 plasmid pLPS-1, complete sequence) position: , mismatch: 8, identity: 0.75

ctacggctccacagggccaaaagttcgagaaa-----	CRISPR spacer
ctacggcttcacagagccaaaag-----gcaacccgc	Protospacer
********.*****.********     * **     

70. spacer 4.37|1685298|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP041042 (Paracoccus sp. AK26 plasmid pAK4, complete sequence) position: , mismatch: 8, identity: 0.75

aggcaagccgctggaggagctta--ctcgccaat	CRISPR spacer
gggcaagccgctggaggcgctgacccttgtcg--	Protospacer
.**************** *** *  **.*.*.  

71. spacer 4.47|1685908|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_LS974446 (Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

aaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
gaagcgaggtcgctgcgcgcggcgcttggtca	Protospacer
.******************.*.****     *

72. spacer 4.47|1685908|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MN096369 (Gordonia phage Phendrix, complete genome) position: , mismatch: 8, identity: 0.75

aaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
acgatcagatcgctgcccgtgacgctgccgag	Protospacer
* ... **.******* **************.

73. spacer 4.47|1685908|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP010729 (Phaeobacter inhibens strain P88 plasmid pP88_d, complete sequence) position: , mismatch: 8, identity: 0.75

---aaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
ttcagaac---ctcgttgcgcgagacgctgccgaa	Protospacer
   *.*.*    ***.****** ************

74. spacer 4.51|1686152|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_LS974446 (Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

aaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
gaagcgaggtcgctgcgcgcggcgcttggtca	Protospacer
.******************.*.****     *

75. spacer 4.51|1686152|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MN096369 (Gordonia phage Phendrix, complete genome) position: , mismatch: 8, identity: 0.75

aaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
acgatcagatcgctgcccgtgacgctgccgag	Protospacer
* ... **.******* **************.

76. spacer 4.51|1686152|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP010729 (Phaeobacter inhibens strain P88 plasmid pP88_d, complete sequence) position: , mismatch: 8, identity: 0.75

---aaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
ttcagaac---ctcgttgcgcgagacgctgccgaa	Protospacer
   *.*.*    ***.****** ************

77. spacer 5.8|1906511|29|NZ_CP020410|PILER-CR matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

tgcgcgagcggcttccacgtaccatagaa	CRISPR spacer
cgcgcgagcggcttccgcgtacatgcgtt	Protospacer
.***************.*****    *  

78. spacer 4.3|1684807|33|NZ_CP020410|PILER-CR matches to NZ_CP020932 (Marinobacter salarius strain SMR5 plasmid pSMR5, complete sequence) position: , mismatch: 9, identity: 0.727

caggtggttaccgtggcgaaccagtgcgctggg	CRISPR spacer
ccagtggttaccgtggagaaccattgcctcttg	Protospacer
* .************* ****** *** ..  *

79. spacer 4.13|1685419|33|NZ_CP020410|PILER-CR matches to NC_002147 (Agrobacterium tumefaciens MAFF301001 plasmid pTi-SAKURA, complete sequence) position: , mismatch: 9, identity: 0.727

cgatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
caatgcccgcggccttatgcaggtcatcgacgg	Protospacer
*.*** **********.*********  . ..*

80. spacer 4.13|1685419|33|NZ_CP020410|PILER-CR matches to NZ_MK439386 (Agrobacterium tumefaciens strain T37 plasmid pTiT37, complete sequence) position: , mismatch: 9, identity: 0.727

cgatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
caatgcccgcggccttatgcaggtcatcgacgg	Protospacer
*.*** **********.*********  . ..*

81. spacer 4.13|1685419|33|NZ_CP020410|PILER-CR matches to NZ_KY000041 (Agrobacterium tumefaciens strain CFBP296 plasmid pTi_CFBP296, complete sequence) position: , mismatch: 9, identity: 0.727

cgatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
caatgcccgcggccttatgcaggtcatcgacgg	Protospacer
*.*** **********.*********  . ..*

82. spacer 4.13|1685419|33|NZ_CP020410|PILER-CR matches to NZ_KY000044 (Agrobacterium fabrum strain CFBP1933 plasmid pTi_CFBP1933, complete sequence) position: , mismatch: 9, identity: 0.727

cgatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
caatgcccgcggccttatgcaggtcatcgacgg	Protospacer
*.*** **********.*********  . ..*

83. spacer 4.13|1685419|33|NZ_CP020410|PILER-CR matches to NZ_KY000057 (Agrobacterium fabrum strain CFBP5505 plasmid pTi_CFBP5505, complete sequence) position: , mismatch: 9, identity: 0.727

cgatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
caatgcccgcggccttatgcaggtcatcgacgg	Protospacer
*.*** **********.*********  . ..*

84. spacer 4.13|1685419|33|NZ_CP020410|PILER-CR matches to NZ_KY000046 (Agrobacterium genomosp. 1 strain CFBP2177 plasmid pTi_CFBP2177, complete sequence) position: , mismatch: 9, identity: 0.727

cgatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
caatgcccgcggccttatgcaggtcatcgacgg	Protospacer
*.*** **********.*********  . ..*

85. spacer 4.21|1685907|33|NZ_CP020410|PILER-CR matches to NZ_LS974446 (Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727

taaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
cgaagcgaggtcgctgcgcgcggcgcttggtca	Protospacer
..******************.*.****     *

86. spacer 4.21|1685907|33|NZ_CP020410|PILER-CR matches to MN096369 (Gordonia phage Phendrix, complete genome) position: , mismatch: 9, identity: 0.727

taaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
cacgatcagatcgctgcccgtgacgctgccgag	Protospacer
.* ... **.******* **************.

87. spacer 4.25|1686151|33|NZ_CP020410|PILER-CR matches to NZ_LS974446 (Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727

taaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
cgaagcgaggtcgctgcgcgcggcgcttggtca	Protospacer
..******************.*.****     *

88. spacer 4.25|1686151|33|NZ_CP020410|PILER-CR matches to MN096369 (Gordonia phage Phendrix, complete genome) position: , mismatch: 9, identity: 0.727

taaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
cacgatcagatcgctgcccgtgacgctgccgag	Protospacer
.* ... **.******* **************.

89. spacer 4.29|1684808|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP020932 (Marinobacter salarius strain SMR5 plasmid pSMR5, complete sequence) position: , mismatch: 9, identity: 0.719

aggtggttaccgtggcgaaccagtgcgctggg	CRISPR spacer
cagtggttaccgtggagaaccattgcctcttg	Protospacer
 .************* ****** *** ..  *

90. spacer 4.36|1685237|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ctacggctccacagggccaaaagttcgagaaa	CRISPR spacer
caatggctccacagtgccaagagttcggcccg	Protospacer
* *.********** *****.******.   .

91. spacer 4.36|1685237|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 9, identity: 0.719

ctacggctccacagggccaaaagttcgagaaa	CRISPR spacer
caatggctccacagtgccaagagttcggcccg	Protospacer
* *.********** *****.******.   .

92. spacer 4.36|1685237|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

ctacggctccacagggccaaaagttcgagaaa	CRISPR spacer
caatggctccacagtgccaagagttcggcccg	Protospacer
* *.********** *****.******.   .

93. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_002147 (Agrobacterium tumefaciens MAFF301001 plasmid pTi-SAKURA, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
aatgcccgcggccttatgcaggtcatcgacgg	Protospacer
.*** **********.*********  . ..*

94. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_MK439386 (Agrobacterium tumefaciens strain T37 plasmid pTiT37, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
aatgcccgcggccttatgcaggtcatcgacgg	Protospacer
.*** **********.*********  . ..*

95. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_KY000041 (Agrobacterium tumefaciens strain CFBP296 plasmid pTi_CFBP296, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
aatgcccgcggccttatgcaggtcatcgacgg	Protospacer
.*** **********.*********  . ..*

96. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_KY000044 (Agrobacterium fabrum strain CFBP1933 plasmid pTi_CFBP1933, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
aatgcccgcggccttatgcaggtcatcgacgg	Protospacer
.*** **********.*********  . ..*

97. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_KY000057 (Agrobacterium fabrum strain CFBP5505 plasmid pTi_CFBP5505, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
aatgcccgcggccttatgcaggtcatcgacgg	Protospacer
.*** **********.*********  . ..*

98. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_KY000046 (Agrobacterium genomosp. 1 strain CFBP2177 plasmid pTi_CFBP2177, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
aatgcccgcggccttatgcaggtcatcgacgg	Protospacer
.*** **********.*********  . ..*

99. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_042008 (Streptomyces phage Mildred21, complete genome) position: , mismatch: 9, identity: 0.719

gatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
cctgacagcggccttatgcaggtcatttgcag	Protospacer
  **** ********.*********    .**

100. spacer 4.40|1685481|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 9, identity: 0.719

atggaaagaaatcgctgaacgccgactccgcc	CRISPR spacer
gcgcctcgaaatagctgaacgtcgactccgtc	Protospacer
..*    ***** ********.********.*

101. spacer 4.47|1685908|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
gcgattaggtcggtgcgcgtgacgatgccgac	Protospacer
. ... ****** *********** ****** 

102. spacer 4.51|1686152|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
gcgattaggtcggtgcgcgtgacgatgccgac	Protospacer
. ... ****** *********** ****** 

103. spacer 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagcgaccggcatgccatcagacccgaccc	CRISPR spacer
ctcgccgaccgggatgccatccgacccgatca	Protospacer
 . . ******* ******** *******.* 

104. spacer 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719

gcgagcgaccggcatgccatcagacccgaccc	CRISPR spacer
ctcgccgaccgggatgccatccgacccgatca	Protospacer
 . . ******* ******** *******.* 

105. spacer 4.21|1685907|33|NZ_CP020410|PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

taaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
ggcgattaggtcggtgcgcgtgacgatgccgac	Protospacer
 . ... ****** *********** ****** 

106. spacer 4.25|1686151|33|NZ_CP020410|PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

taaagcgaggtcgctgcgcgtgacgctgccgaa	CRISPR spacer
ggcgattaggtcggtgcgcgtgacgatgccgac	Protospacer
 . ... ****** *********** ****** 

107. spacer 4.26|1686212|33|NZ_CP020410|PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgagcgaccggcatgccatcagacccgaccc	CRISPR spacer
tctcgccgaccgggatgccatccgacccgatca	Protospacer
. . . ******* ******** *******.* 

108. spacer 4.26|1686212|33|NZ_CP020410|PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.697

cgcgagcgaccggcatgccatcagacccgaccc	CRISPR spacer
tctcgccgaccgggatgccatccgacccgatca	Protospacer
. . . ******* ******** *******.* 

109. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
cgccagcgcggtcttgtgcaggtcgagatcca	Protospacer
 .. * *****.************.****. .

110. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MN694320 (Marine virus AFVG_250M198, complete genome) position: , mismatch: 10, identity: 0.688

gatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
cctggccgcggccttgtccaggtcatcaccca	Protospacer
  **.************ *******  *.. .

111. spacer 4.39|1685420|32|NZ_CP020410|CRISPRCasFinder,CRT matches to KT898133 (Aeromonas phage phiARM81ld, complete genome) position: , mismatch: 10, identity: 0.688

gatgaccgcggccttgtgcaggtcaagattag	CRISPR spacer
attgaccccggccttgttcaggtcattggtca	Protospacer
. ***** ********* *******  . * .

112. spacer 4.40|1685481|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NZ_CP020413 (Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

atggaaagaaatcgctgaacgccgactccgcc	CRISPR spacer
tcttaaagaaatcgttgaacgtcgacttgact	Protospacer
 .  **********.******.*****. .*.

113. spacer 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MN508623 (UNVERIFIED: Enterobacter phage EC-F1, complete genome) position: , mismatch: 10, identity: 0.688

gtcttcgaggattcgacgggtttccattgtgc	CRISPR spacer
ttcttcgaggattcgaaggatttcggcgcggg	Protospacer
 *************** **.**** ..   * 

114. spacer 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MN508624 (UNVERIFIED: Enterobacter phage EC-F2, complete genome) position: , mismatch: 10, identity: 0.688

gtcttcgaggattcgacgggtttccattgtgc	CRISPR spacer
ttcttcgaggattcgaaggatttcggcgcggg	Protospacer
 *************** **.**** ..   * 

115. spacer 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT matches to KM236237 (Citrobacter phage Miller, complete genome) position: , mismatch: 10, identity: 0.688

gtcttcgaggattcgacgggtttccattgtgc	CRISPR spacer
ttcttcgaggattcgaaggatttcggcgcggg	Protospacer
 *************** **.**** ..   * 

116. spacer 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT matches to KX431560 (Cronobacter phage vB_CsaM_leN, complete genome) position: , mismatch: 10, identity: 0.688

gtcttcgaggattcgacgggtttccattgtgc	CRISPR spacer
ttcttcgaggattcgaaggatttcggcgcggg	Protospacer
 *************** **.**** ..   * 

117. spacer 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_048646 (Cronobacter phage vB_CsaM_leE, complete genome) position: , mismatch: 10, identity: 0.688

gtcttcgaggattcgacgggtttccattgtgc	CRISPR spacer
ttcttcgaggattcgaaggatttcggcgcggg	Protospacer
 *************** **.**** ..   * 

118. spacer 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT matches to KC801932 (Escherichia phage Lw1, complete genome) position: , mismatch: 10, identity: 0.688

gtcttcgaggattcgacgggtttccattgtgc	CRISPR spacer
ttcttcgaggattcgaaggatttcggcgcggg	Protospacer
 *************** **.**** ..   * 

119. spacer 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MN508621 (UNVERIFIED: Enterobacter phage EC-W1, complete genome) position: , mismatch: 10, identity: 0.688

gtcttcgaggattcgacgggtttccattgtgc	CRISPR spacer
ttcttcgaggattcgaaggatttcggcgcggg	Protospacer
 *************** **.**** ..   * 

120. spacer 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MT341500 (Enterobacter phage EBPL, complete genome) position: , mismatch: 10, identity: 0.688

gtcttcgaggattcgacgggtttccattgtgc	CRISPR spacer
ttcttcgaggattcgaaggatttcggcgcggg	Protospacer
 *************** **.**** ..   * 

121. spacer 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MN508622 (UNVERIFIED: Enterobacter phage EC-W2, complete genome) position: , mismatch: 10, identity: 0.688

gtcttcgaggattcgacgggtttccattgtgc	CRISPR spacer
ttcttcgaggattcgaaggatttcggcgcggg	Protospacer
 *************** **.**** ..   * 

122. spacer 4.43|1685664|32|NZ_CP020410|CRISPRCasFinder,CRT matches to NC_029013 (Citrobacter phage IME-CF2, complete genome) position: , mismatch: 10, identity: 0.688

gtcttcgaggattcgacgggtttccattgtgc	CRISPR spacer
ttcttcgaggattcgaaggatttcggcgcggg	Protospacer
 *************** **.**** ..   * 

123. spacer 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MT889374 (Mycobacterium phage Firehouse51, complete genome) position: , mismatch: 10, identity: 0.688

gcgagcgaccggcatgccatcagacccgaccc	CRISPR spacer
aaccgcgaccggcatgccagcacaccccgaca	Protospacer
.   *************** ** **** . * 

124. spacer 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MN586005 (Mycobacterium phage Lorde, complete genome) position: , mismatch: 10, identity: 0.688

gcgagcgaccggcatgccatcagacccgaccc	CRISPR spacer
aaccgcgaccggcatgccagcacaccccgaca	Protospacer
.   *************** ** **** . * 

125. spacer 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MH669001 (Mycobacterium phage EleanorGeorge, complete genome) position: , mismatch: 10, identity: 0.688

gcgagcgaccggcatgccatcagacccgaccc	CRISPR spacer
aaccgcgaccggcatgccagcacaccccgaca	Protospacer
.   *************** ** **** . * 

126. spacer 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT matches to JN699012 (Mycobacterium phage SG4, complete genome) position: , mismatch: 10, identity: 0.688

gcgagcgaccggcatgccatcagacccgaccc	CRISPR spacer
aaccgcgaccggcatgccagcacaccccgaca	Protospacer
.   *************** ** **** . * 

127. spacer 4.52|1686213|32|NZ_CP020410|CRISPRCasFinder,CRT matches to MN585987 (Mycobacterium phage Enby, complete genome) position: , mismatch: 10, identity: 0.688

gcgagcgaccggcatgccatcagacccgaccc	CRISPR spacer
aaccgcgaccggcatgccagcacaccccgaca	Protospacer
.   *************** ** **** . * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 62166 : 116681 47 Bacillus_phage(40.0%) protease,transposase,tRNA NA
DBSCAN-SWA_2 1208571 : 1259079 50 Gordonia_phage(27.78%) integrase,tRNA,terminase,portal,protease attL 1203450:1203465|attR 1262100:1262115
DBSCAN-SWA_3 1376316 : 1429705 54 Escherichia_phage(15.38%) protease,transposase,tRNA NA
DBSCAN-SWA_4 1665616 : 1716856 46 Vibrio_phage(22.22%) protease,transposase,holin,tRNA NA
DBSCAN-SWA_5 1994497 : 2057931 64 Corynebacterium_phage(79.41%) capsid,integrase,tail,portal,protease,head attL 2019329:2019352|attR 2058218:2058241
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage