Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020407 Vibrio cholerae strain FDAARGOS_223 chromosome 2, complete sequence 0 crisprs cas3,csa3,PD-DExK 0 0 95 0
NZ_CP020408 Vibrio cholerae strain FDAARGOS_223 chromosome 1, complete sequence 1 crisprs DinG,csx1,cas3,WYL,DEDDh,csa3,RT 0 1 4 0

Results visualization

1. NZ_CP020407
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7018 5 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_2 11235 : 11865 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_3 20148 : 35071 12 uncultured_Caudovirales_phage(28.57%) NA NA
DBSCAN-SWA_4 41657 : 49235 6 Organic_Lake_phycodnavirus(25.0%) NA NA
DBSCAN-SWA_5 54366 : 55947 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_6 73316 : 79495 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_7 90018 : 92103 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_8 97804 : 100258 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_9 104243 : 106884 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_10 112629 : 118171 4 Enterobacteria_phage(33.33%) tRNA NA
DBSCAN-SWA_11 126798 : 128181 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_12 131998 : 132358 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_13 140177 : 147549 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_14 152429 : 157827 4 Vibrio_virus(33.33%) NA NA
DBSCAN-SWA_15 164333 : 166223 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_16 173508 : 176713 4 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_17 184129 : 184984 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_18 190550 : 204648 13 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_19 218760 : 219234 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_20 222945 : 223563 1 Pseudoalteromonas_phage(100.0%) NA NA
DBSCAN-SWA_21 233326 : 235186 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_22 239617 : 246720 4 Diachasmimorpha_longicaudata_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_23 256537 : 259959 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_24 263317 : 264946 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_25 274038 : 280021 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_26 285116 : 286982 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_27 293624 : 294551 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_28 298563 : 302796 4 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_29 308443 : 310318 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_30 314639 : 315419 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_31 322161 : 334621 11 Cyanophage(40.0%) NA NA
DBSCAN-SWA_32 344725 : 346953 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_33 352788 : 354134 2 Vibrio_phage(50.0%) integrase attL 348637:348652|attR 359760:359775
DBSCAN-SWA_34 364159 : 364342 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_35 367566 : 368847 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_36 377783 : 378467 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_37 381699 : 382779 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_38 393946 : 394927 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_39 399772 : 400258 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_40 413656 : 419026 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_41 423494 : 424424 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_42 427909 : 439492 8 Apis_mellifera_filamentous_virus(20.0%) protease NA
DBSCAN-SWA_43 443055 : 449076 8 Vibrio_phage(33.33%) transposase NA
DBSCAN-SWA_44 457955 : 462632 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_45 467038 : 488010 20 uncultured_Caudovirales_phage(22.22%) NA NA
DBSCAN-SWA_46 494251 : 495106 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_47 498911 : 504376 4 Invertebrate_iridovirus(50.0%) NA NA
DBSCAN-SWA_48 515810 : 532028 15 Planktothrix_phage(20.0%) NA NA
DBSCAN-SWA_49 542864 : 549695 3 Chrysodeixis_chalcites_nucleopolyhedrovirus(33.33%) NA NA
DBSCAN-SWA_50 553214 : 555528 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_51 559041 : 560097 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_52 575719 : 576730 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_53 584530 : 590265 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_54 595066 : 596059 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_55 616588 : 617560 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_56 621495 : 622008 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_57 626783 : 627734 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_58 630810 : 633618 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_59 640843 : 645980 4 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_60 653732 : 654254 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_61 658427 : 660020 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_62 679465 : 680122 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_63 685933 : 691475 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_64 699613 : 700570 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_65 714363 : 715857 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_66 719296 : 721159 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_67 728055 : 734395 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_68 741966 : 744559 2 Vibrio_virus(50.0%) NA NA
DBSCAN-SWA_69 748217 : 749395 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_70 754748 : 758442 5 Aeromonas_virus(33.33%) transposase NA
DBSCAN-SWA_71 764321 : 768249 7 Escherichia_phage(66.67%) transposase NA
DBSCAN-SWA_72 775453 : 776311 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_73 783802 : 786206 4 Brevibacillus_phage(33.33%) NA NA
DBSCAN-SWA_74 791478 : 792336 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_75 806252 : 806768 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_76 814809 : 815425 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_77 826489 : 828359 2 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_78 840340 : 840856 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_79 859112 : 859628 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_80 868004 : 869542 2 Diadromus_pulchellus_ascovirus(50.0%) NA NA
DBSCAN-SWA_81 907865 : 908516 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_82 912219 : 912870 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_83 924459 : 926923 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_84 932386 : 935032 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_85 943091 : 944738 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_86 949608 : 950688 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_87 955688 : 965027 8 Bacillus_phage(25.0%) transposase NA
DBSCAN-SWA_88 969126 : 976282 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_89 981193 : 981403 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_90 990083 : 992000 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_91 1000374 : 1000587 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_92 1016350 : 1016857 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_93 1027594 : 1030933 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_94 1038207 : 1047262 8 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_95 1056055 : 1058665 1 Enterobacteria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP020408
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020408_1 2061343-2061586 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020408_1 1.1|2061392|37|NZ_CP020408|PILER-CR 2061392-2061428 37 NC_049942 Escherichia phage JLK-2012, complete sequence 23524-23560 4 0.892
NZ_CP020408_1 1.1|2061392|37|NZ_CP020408|PILER-CR 2061392-2061428 37 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35464 4 0.892

1. spacer 1.1|2061392|37|NZ_CP020408|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
caggtcgccagttcgattccggtagccggcaccatat	Protospacer
.*********************.***********. *

2. spacer 1.1|2061392|37|NZ_CP020408|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
taggtcaccagttcgattccggtagccggcaccaatc	Protospacer
******.***************.*********** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 110312 : 116929 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 960691 : 996026 28 Satellite_phage(43.48%) coat NA
DBSCAN-SWA_3 1734397 : 1741590 9 Anguillid_herpesvirus(16.67%) NA NA
DBSCAN-SWA_4 1973218 : 1980442 6 uncultured_Mediterranean_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage