1. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtgcc Protospacer
********************.*
2. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
4. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
5. spacer 9.15|1578162|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 9.15|1578162|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 9.15|1578162|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 9.15|1578162|22|NZ_CP020381|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
9. spacer 1.2|335028|21|NZ_CP020381|PILER-CR matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 2, identity: 0.905
gtcacgctggcgccgccgtca CRISPR spacer
ctcacgctggcgccgccgtcc Protospacer
*******************
10. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtggg Protospacer
********************
11. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
agtcggcggtgccgacggtgtc Protospacer
*************.*******
12. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggcgtc Protospacer
.*****************.***
13. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgtcggcggtgtc Protospacer
.**********.**********
14. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggcggcgtc Protospacer
*****************.***
15. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
16. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
17. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggccgtgtc Protospacer
*************** *****
18. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgacggcggtgccggcggtgtg Protospacer
** ******************
19. spacer 8.15|1217500|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909
ggacggtggtaccggcggtcag CRISPR spacer
tgacggtggtgccggcggtcag Protospacer
*********.***********
20. spacer 9.2|1577235|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
21. spacer 9.2|1577235|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
22. spacer 9.2|1577235|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
23. spacer 9.2|1577235|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
24. spacer 9.2|1577235|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
25. spacer 9.3|1577289|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
26. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
27. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
28. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
29. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
30. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
31. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
32. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
33. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
34. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
35. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
36. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
37. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
38. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
39. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
40. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
41. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
42. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
43. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
44. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
45. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
46. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
47. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
48. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
49. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
50. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
51. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
52. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.92
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tcggcggcaaaggcggcattggcgg Protospacer
.****************** *****
53. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 2, identity: 0.92
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaaaggcgcaatgggcgg Protospacer
*************** ********
54. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 2, identity: 0.92
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaaaggcggcaacggcgg Protospacer
****************** *****
55. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
56. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
57. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
58. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
59. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
60. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
61. spacer 6.16|929453|24|NZ_CP020381|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
62. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
63. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
64. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
65. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
66. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
67. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
68. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
69. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
70. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
71. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
72. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
73. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
74. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
75. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
76. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
77. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtggt Protospacer
.******************* .
78. spacer 8.7|1217116|22|NZ_CP020381|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
catcggcggtgccggcggtgtg Protospacer
..*******************
79. spacer 8.11|1217299|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864
gctgtggggcggcggtggtgcc CRISPR spacer
cgtgtggggcggcggtggtgca Protospacer
*******************
80. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
81. spacer 9.4|1577343|22|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
82. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
83. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
84. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
85. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
86. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
87. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
88. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
89. spacer 9.15|1578162|22|NZ_CP020381|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
90. spacer 11.5|2091019|24|NZ_CP020381|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
91. spacer 11.5|2091019|24|NZ_CP020381|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
92. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP013224 (Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
93. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KX470734 (Escherichia coli strain Ecoli14-55 plasmid pEC55-NDM4, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
94. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KY296103 (Enterobacter cloacae strain 13E169 plasmid pHN84NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
95. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KY978629 (Cronobacter sakazakii strain 505108 plasmid p505108-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
96. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF072961 (Citrobacter freundii strain P10159 plasmid pP10159-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
97. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF042356 (Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
98. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF042359 (Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
99. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KU726616 (Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
100. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KU314941 (Klebsiella pneumoniae isolate KP04 plasmid pKP04NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
101. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KX094555 (Escherichia coli strain ZHDC33 plasmid pZHDC33, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
102. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
103. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KR059864 (Klebsiella pneumoniae strain KP-YQ13450 plasmid pYQ12450, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
104. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KP987216 (Citrobacter freundii strain 112298 plasmid p112298-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
105. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP022126 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
106. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
107. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
108. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
109. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
110. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
111. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
112. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP028560 (Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
113. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
114. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
115. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_019153 (Klebsiella pneumoniae plasmid pNDM-KN, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
116. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_019162 (Klebsiella pneumoniae strain CRE380 plasmid pNDM-HN380, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
117. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
118. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP018817 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
119. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
120. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
121. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
122. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
123. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
124. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP021206 (Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
125. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
126. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
127. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_020811 (Klebsiella pneumoniae strain KPN5047 plasmid pKPN5047, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
128. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
129. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
130. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_023914 (Enterobacter cloacae strain CRE727 plasmid pNDM-HF727, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
131. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
132. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
133. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_019123 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
134. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
135. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN178638 (Kluyvera cryocrescens strain SCW13 plasmid pNDM1_SCW13, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
136. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP038280 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
137. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
138. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to CP050158 (Enterobacter cloacae plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
139. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
140. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to CP050161 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
141. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
142. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_021501 (Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
143. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
144. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP023914 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
145. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP029386 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
146. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcaaaagcggcctgggcgg Protospacer
**********.***** *******
147. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
148. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
149. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
150. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tcggcggcaatggcggcgtgggcgg Protospacer
.********* ******.*******
151. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_020552 (Citrobacter freundii plasmid pYE315203, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
152. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP040598 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
153. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP014297 (Klebsiella pneumoniae strain KP38731 plasmid unnamed13 sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
154. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP020056 (Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
155. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP031884 (Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
156. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
157. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
158. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
159. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP041229 (Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
160. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
161. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
162. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
163. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MK372385 (Morganella morganii strain ABC140 plasmid pABC140-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
164. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MK372381 (Klebsiella pneumoniae strain ABC52 plasmid pABC52-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
165. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
166. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
167. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
168. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH909333 (Klebsiella pneumoniae strain 7-SP plasmid p7SP-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
169. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH909346 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
170. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH909335 (Klebsiella pneumoniae strain 11-SP plasmid p11SP-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
171. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH234505 (Escherichia coli strain CRE3694 plasmid pNDM-HK3694, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
172. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH917282 (Klebsiella pneumoniae strain A457 plasmid pA457-NDA, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
173. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH349095 (Escherichia coli strain 948 plasmid pMTC948, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
174. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MK372386 (Klebsiella pneumoniae strain BC700 plasmid pBC700-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
175. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MK372380 (Enterobacter cloacae strain ABC40 plasmid pABC40-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
176. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MK372382 (Escherichia coli strain ABC54 plasmid pABC54-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
177. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
178. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN657242 (Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
179. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
180. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN657244 (Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
181. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN657247 (Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
182. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
183. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
184. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH105052 (Escherichia coli strain EC600 plasmid pSL131T_IncX3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
185. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP044464 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
186. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF042350 (Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
187. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF042354 (Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
188. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF042353 (Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
189. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF042351 (Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
190. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF042358 (Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
191. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF415608 (Enterobacter cloacae strain hhy03 plasmid pNDM-BJ03, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
192. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF042352 (Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
193. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF042357 (Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
194. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MG252893 (Raoultella ornithinolytica strain pRor-30818cz plasmid Ror-30818cz, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
195. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP041048 (Citrobacter sp. CF971 plasmid pBM527-2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
196. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
197. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KX786648 (Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
198. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KY399975 (Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
199. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KY399974 (Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
200. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
201. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
202. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP034756 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
203. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
204. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
205. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
206. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KJ588779 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
207. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KR351290 (Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
208. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KJ802405 (Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
209. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KJ812998 (Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
210. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KP900016 (Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
211. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KP765744 (Enterobacter cloacae strain ECN49 plasmid pNDM-ECN49, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
212. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KP868647 (Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
213. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KJ802404 (Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
214. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KT965092 (Acinetobacter towneri strain G165 plasmid pNDM-GJ01, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
215. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KT965093 (Acinetobacter towneri strain G295 plasmid pNDM-GJ02, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
216. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
217. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_023322 (Acinetobacter bereziniae strain CHI-40-1 plasmid pNDM-40-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
218. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
219. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
220. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KC887916 (Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
221. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_KC887917 (Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
222. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP020524 (Escherichia coli strain 190 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
223. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
224. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
225. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP010370 (Acinetobacter nosocomialis strain 6411 plasmid p6411-9.012kb, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
226. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP013221 (Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
227. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
228. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN061454 (Enterobacter cloacae strain EC-14-60 plasmid pECL-14-60-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
229. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP032278 (Acinetobacter sp. WCHAc010034 plasmid pNDM1_010034, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
230. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP045561 (Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
231. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_019045 (Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
232. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_025130 (Raoultella planticola strain RJA274 plasmid NDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
233. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_019158 (Klebsiella pneumoniae plasmid pNDM10469, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
234. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN310375 (Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
235. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN310377 (Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
236. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
237. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
238. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP037965 (Klebsiella pneumoniae strain SCKP020135 plasmid pNDM1_020135, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
239. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_025184 (Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
240. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcagaggcggcaagggcgg Protospacer
********.******** ******
241. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
242. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP021962 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
243. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP022350 (Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
244. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP046274 (Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
245. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP039811 (Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
246. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
247. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
248. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_025000 (Acinetobacter lwoffii strain Iz4b plasmid pNDM-Iz4b, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
249. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_024959 (Acinetobacter calcoaceticus strain NDM-WS2 plasmid pNDM-WS2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
250. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
251. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tcggcggcaagggcggcatggccgg Protospacer
.*********.********** ***
252. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP012168 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
253. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
254. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP010399 (Acinetobacter baumannii strain 6200 plasmid p6200-47.274kb, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
255. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP035935 (Acinetobacter cumulans strain WCHAc060092 plasmid pNDM1_060092, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
256. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP006661 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
257. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcaaaggcggcaagagcgg Protospacer
***************** *.****
258. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
259. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to CP050164 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
260. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MK933278 (Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
261. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
262. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcaaacgcggcctgggcgg Protospacer
********** ***** *******
263. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to CP048298 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
264. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
265. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_019069 (Escherichia coli plasmid pNDM10505, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
266. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to AMXH01000087 (Acinetobacter pittii strain XM1570 plasmid pXM1, complete sequence, whole genome shotgun sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
267. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_JQ739158 (Acinetobacter lwoffii strain ABZ78 plasmid pABZ78, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
268. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
269. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_019985 (Acinetobacter baumannii ZW85-1 plasmid pAbNDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
270. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
271. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP018366 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
272. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP023187 (Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
273. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_021813 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
274. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP028786 (Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
275. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP021936 (Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
276. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
277. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
278. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP041938 (Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
279. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
280. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
281. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP015835 (Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
282. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
283. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP014478 (Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
284. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_023908 (Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
285. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
286. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_019268 (Acinetobacter lwoffii plasmid pNDM-BJ01, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
287. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_019281 (Acinetobacter lwoffii plasmid pNDM-BJ02, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
288. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_025116 (Acinetobacter sp. M131 plasmid pM131_NDM1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
289. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP040884 (Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
290. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP026015 (Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
291. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
292. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
293. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP048797 (Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
294. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN937240 (Enterobacter cloacae strain BSI034 plasmid pBSI034-NDM1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
295. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
296. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN603981 (Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
297. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
298. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_LN833432 (Acinetobacter baumannii isolate CHI-32 plasmid pNDM-32, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
299. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MK123268 (Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
300. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
301. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP032132 (Acinetobacter chinensis strain WCHAc010005 plasmid pNDM1_010005, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
302. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH995508 (Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
303. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH995506 (Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
304. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH917283 (Klebsiella pneumoniae strain A575 plasmid pA575-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
305. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH909345 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
306. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
307. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH909343 (Klebsiella pneumoniae strain 1012018 plasmid p12018-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
308. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH909347 (Klebsiella pneumoniae strain 362713 plasmid p362713-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
309. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH263652 (Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
310. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MH917281 (Klebsiella pneumoniae strain 14504 plasmid p14504-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
311. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MK101346 (Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
312. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
313. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP020090 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
314. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
315. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
316. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MF344560 (Enterobacter hormaechei strain 128379 plasmid p128379-NDM, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
317. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MG462729 (Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
318. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP035537 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
319. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
320. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
321. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcatgggcggcatgggcgg Protospacer
******** .**************
322. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
acggcggcaacggcggcaagggcgg Protospacer
********* ******* ******
323. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MG944221 (Mycobacterium phage Scowl, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
acggcggcaacggcggcaagggcgg Protospacer
********* ******* ******
324. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MK994522 (Methanobacterium virus PhiF1, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcaaaggcggcaagggagg Protospacer
***************** *** **
325. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to KT309034 (Mycobacterium phage Dante, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
acggcggcaacggcggcaagggcgg Protospacer
********* ******* ******
326. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_021538 (Mycobacterium phage Job42, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
acggcggcaacggcggcaagggcgg Protospacer
********* ******* ******
327. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_026584 (Mycobacterium phage Minerva, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
acggcggcaacggcggcaagggcgg Protospacer
********* ******* ******
328. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to KJ409696 (Mycobacterium phage Lamina13, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
acggcggcaacggcggcaggggcgg Protospacer
********* ******* ******
329. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_028784 (Mycobacterium phage Tasp14, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
acggcggcaacggcggcaggggcgg Protospacer
********* ******* ******
330. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
331. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
332. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
333. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
334. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcagcggcgg Protospacer
* **************** *****
335. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggcggcacagccggcatgggcgg Protospacer
* ******* ** ************
336. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggcggcatgggcggcatgggcgg Protospacer
* ******* .**************
337. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcagcggcgg Protospacer
* **************** *****
338. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcagcggcgg Protospacer
* **************** *****
339. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
340. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggcggcaacggcggcaggggcgg Protospacer
* ******** ******* ******
341. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MK494110 (Mycobacterium phage SwagPigglett, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
342. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MK359354 (Mycobacterium phage PinkPlastic, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
343. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MH632118 (Mycobacterium phage Zeeculate, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
344. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN585999 (Mycobacterium phage Briton15, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
345. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
346. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MG872841 (Mycobacterium phage Priscilla, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
347. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MH155865 (Mycobacterium phage BobaPhett, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
348. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN585985 (Mycobacterium phage Watermelon, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
349. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MH371120 (Mycobacterium phage OlympiaSaint, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
350. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MF190168 (Mycobacterium phage Spoonbill, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
351. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
352. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to KY224001 (Mycobacterium phage Blue, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
353. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to AY500152 (Mycobacteriophage U2, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
354. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MK524517 (Mycobacterium phage James, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
355. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggcggcatgggcggcatgggcgg Protospacer
* ******* .**************
356. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
357. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MG962372 (Mycobacterium phage McGuire, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
358. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MT310893 (Mycobacterium phage DRBy19, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
359. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN617845 (Mycobacterium phage BaconJack, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
360. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_009877 (Mycobacterium phage U2, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
361. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to KJ025956 (Mycobacterium phage Saal, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
362. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
363. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN813700 (Mycobacterium phage Atkinbua, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
364. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_024136 (Mycobacterium phage Seabiscuit, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
365. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN369751 (Mycobacterium phage TDanisky, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
366. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MH590602 (Mycobacterium phage Gorge, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
367. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to JN660814 (Mycobacterium phage Dreamboat, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
368. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MH669011 (Mycobacterium phage PherrisBueller, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
369. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_028654 (Mycobacterium phage Sparkdehlily, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
370. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN444869 (Mycobacterium phage DreamCatcher, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
371. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_023726 (Mycobacterium phage Euphoria, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
372. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MH155871 (Mycobacterium phage Mattes, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
373. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
374. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to KT895281 (Mycobacterium phage Cabrinians, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
375. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
cgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
376. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to KP027205 (Mycobacterium phage Alvin, complete genome) position: , mismatch: 3, identity: 0.88
ccggcggcaaaggcggcatgggcgg CRISPR spacer
caggcggcaaaggcggcaacggcgg Protospacer
* **************** *****
377. spacer 3.1|369521|27|NZ_CP020381|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
378. spacer 3.1|369521|27|NZ_CP020381|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
379. spacer 3.7|369917|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
380. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
381. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
382. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867
accacgccggtgaccacgccg-ccaacgacg CRISPR spacer
accacgccggtggccacgccgaccagcggc- Protospacer
************.******** ***.**.*
383. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggctgggctggcggggatat Protospacer
********** ************* .
384. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
385. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010678 (Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
386. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
387. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
388. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010642 (Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
389. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
390. spacer 6.6|929012|27|NZ_CP020381|CRT matches to AM419438 (Archaeal BJ1 virus complete genome) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcggcggcgggggtggcgggggcgg Protospacer
****.********* ********. **
391. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NC_008695 (Archaeal BJ1 virus, complete genome) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcggcggcgggggtggcgggggcgg Protospacer
****.********* ********. **
392. spacer 6.10|929168|27|NZ_CP020381|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
393. spacer 6.10|929168|27|NZ_CP020381|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
394. spacer 6.10|929168|27|NZ_CP020381|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
395. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
396. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
397. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
398. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
399. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
400. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
401. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
402. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
403. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
404. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
405. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
406. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
407. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
408. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
409. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
410. spacer 6.16|929453|24|NZ_CP020381|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
411. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
412. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
413. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
414. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
gtccggcggccttggcgtagcgcct Protospacer
**********.***********.
415. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
416. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggccccggcgtcgcgcga Protospacer
***********.****** ****
417. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtaatggtc Protospacer
*******************..* .*
418. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcatcggcgtagcggcg Protospacer
.********* *********** *
419. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcctccgcgtcgcgcct Protospacer
.************ **** *****.
420. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcgggc Protospacer
.*.******************* *
421. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggccgcgtcgtagcgcca Protospacer
.********** ** *********
422. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
423. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggtgtcctcggcgtagcgcga Protospacer
******.* **************
424. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
425. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggctgcctcggcatagcgccg Protospacer
****** ********.*******
426. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
427. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggtggcctcggcgtagccccg Protospacer
.*****.************** **
428. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
429. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tggcggcggcctcgccgtagcgctt Protospacer
** *********** ********..
430. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcggac Protospacer
.*.******************* *
431. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
agccggcggcctcggcctcgcgccg Protospacer
*************** * *****
432. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
433. spacer 9.1|1577175|28|NZ_CP020381|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
434. spacer 9.1|1577175|28|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
435. spacer 9.1|1577175|28|NZ_CP020381|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
436. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
437. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
438. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
439. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
440. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
441. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
442. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
443. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
444. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
445. spacer 9.14|1578105|25|NZ_CP020381|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
446. spacer 11.5|2091019|24|NZ_CP020381|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
447. spacer 11.5|2091019|24|NZ_CP020381|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
448. spacer 11.5|2091019|24|NZ_CP020381|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
449. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
acggcggcgaaggcggcacgggcgc Protospacer
*******.*********.*****
450. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcatgggcggcatgggcgg Protospacer
. ******* .**************
451. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_007713 (Sodalis glossinidius str. 'morsitans' plasmid pSG1, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
452. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggccaaggcggcatcggcgc Protospacer
******* ********** ****
453. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcaaaggtggcatcggcga Protospacer
************.***** ****.
454. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaatgtcggcatgggcac Protospacer
********** * **********.
455. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_LN854558 (Sodalis glossinidius str. 'morsitans' isolate B4 plasmid pSG1, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
456. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaaaggcggcatctgtgt Protospacer
******************* *.*
457. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcgacggcggcatgggcgt Protospacer
*******.* *************
458. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_007182 (Sodalis glossinidius pSG1 plasmid from Glossina austeni) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
459. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_007183 (Sodalis glossinidius pSG1 plasmid from Glossina palpalis palpalis) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
460. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
agggcggcaagggcggcatcggcgg Protospacer
********.******** *****
461. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaatggcggcattggcct Protospacer
********** ******** ***
462. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaccggcggcatgggcaa Protospacer
********* ************..
463. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcatgggcggcatgggcgg Protospacer
. ******* .**************
464. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_042098 (Erwinia phage vB_EamM_Desertfox, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
465. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MG655267 (Erwinia phage vB_EamM_Bosolaphorus, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
466. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MG655269 (Erwinia phage vB_EamM_MadMel, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
467. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to KF806589 (Erwinia phage Ea35-70, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
468. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to KU886223 (Erwinia phage vB_EamM_Simmy50, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
469. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
agggcggcaatggcggcatcggcgg Protospacer
******** ******** *****
470. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcaagggcggcaagggcgg Protospacer
. ********.******* ******
471. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcacaggcggcacgggcgg Protospacer
. ******* ********.******
472. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaagggcggcacgggcct Protospacer
**********.*******.****
473. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gcggcggcaaaggcggcgagggcga Protospacer
****************. *****.
474. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcaagggcggcaagggcgg Protospacer
. ********.******* ******
475. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcaagggcggcaagggcgg Protospacer
. ********.******* ******
476. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcaagggcggcaagggcgg Protospacer
. ********.******* ******
477. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MG099943 (Mycobacterium phage Familton, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcaagggcggcaagggcgg Protospacer
. ********.******* ******
478. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcatgggcggcatgggcgg Protospacer
. ******* .**************
479. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcatgggcggcatgggcgg Protospacer
. ******* .**************
480. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcatgggcggcatgggcgg Protospacer
. ******* .**************
481. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcaagggcggcaagggcgg Protospacer
. ********.******* ******
482. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to KJ829260 (Mycobacterium phage YungJamal, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcaagggcggcaagggcgg Protospacer
. ********.******* ******
483. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcaagggcggcaagggcgg Protospacer
. ********.******* ******
484. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tgggcggcaagggcggcaagggcgg Protospacer
. ********.******* ******
485. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 4, identity: 0.84
ccggcggcaaaggcggcatgggcgg CRISPR spacer
gtggcggcgcaggcggcatgggcgg Protospacer
.******. ***************
486. spacer 3.1|369521|27|NZ_CP020381|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
487. spacer 3.1|369521|27|NZ_CP020381|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
488. spacer 3.7|369917|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
489. spacer 3.7|369917|27|NZ_CP020381|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
490. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
491. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
492. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
493. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
494. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
495. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
496. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
497. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
498. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
499. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
500. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
501. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
502. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
503. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
504. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
505. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
506. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
507. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
508. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
509. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
510. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
511. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
512. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
513. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
514. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
515. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
516. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
517. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
518. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
519. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
520. spacer 6.6|929012|27|NZ_CP020381|CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggctgggcaggcggggatat Protospacer
********** **** ******** .
521. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcaccggcggggctggcggcatcgg Protospacer
***** *************** . **
522. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
ccaaagcggcgagactggcggggaggg Protospacer
* *******.*.*************
523. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgttcacggcggggctggcggggacgg Protospacer
.**. .****************** **
524. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cggcagcggcggggctggcggagccgc Protospacer
** ******************.* *
525. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cggcagcggcggggctggcggagccgc Protospacer
** ******************.* *
526. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
actcgccggcgcggctggcggggaggg Protospacer
**. ***** ***************
527. spacer 6.10|929168|27|NZ_CP020381|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
528. spacer 6.10|929168|27|NZ_CP020381|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
529. spacer 6.10|929168|27|NZ_CP020381|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
530. spacer 6.10|929168|27|NZ_CP020381|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
531. spacer 6.10|929168|27|NZ_CP020381|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
532. spacer 6.10|929168|27|NZ_CP020381|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
533. spacer 6.10|929168|27|NZ_CP020381|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
534. spacer 6.10|929168|27|NZ_CP020381|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
535. spacer 6.10|929168|27|NZ_CP020381|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
536. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
537. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
538. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
539. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
540. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
541. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
542. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
543. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
544. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
545. spacer 6.15|929405|30|NZ_CP020381|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
546. spacer 6.16|929453|24|NZ_CP020381|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
547. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc Protospacer
******************** ******** *.
548. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
gcgcggcggcctcggcgtagagccg Protospacer
***************** ***
549. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
550. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
caccggcggcctcggcgtagcttgc Protospacer
..******************* . *
551. spacer 8.4|1216936|25|NZ_CP020381|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
552. spacer 9.1|1577175|28|NZ_CP020381|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
553. spacer 9.1|1577175|28|NZ_CP020381|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
554. spacer 9.1|1577175|28|NZ_CP020381|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
555. spacer 9.1|1577175|28|NZ_CP020381|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
556. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
557. spacer 9.5|1577397|25|NZ_CP020381|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
558. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
559. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
560. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
561. spacer 9.13|1578039|34|NZ_CP020381|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
562. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
563. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 5, identity: 0.839
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcagcgccaccggcggggccggcggcgactc Protospacer
. .*** *****************.******
564. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 5, identity: 0.8
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ttctcggcaaaggcggcatgggcga Protospacer
.. ********************.
565. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 5, identity: 0.8
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tcgtcggcaaaggcggcatggggcc Protospacer
.** ******************
566. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 5, identity: 0.8
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaagggcggcatggcgtc Protospacer
**********.**********
567. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.8
ccggcggcaaaggcggcatgggcgg CRISPR spacer
tcgtcggcaaaggcggcatggggcc Protospacer
.** ******************
568. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 5, identity: 0.8
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaagggcggcatggcgtc Protospacer
**********.**********
569. spacer 17.14|3971115|25|NZ_CP020381|CRT matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 5, identity: 0.8
ccggcggcaaaggcggcatgggcgg CRISPR spacer
ccggcggcaaaggcggcatccacct Protospacer
******************* .*
570. spacer 3.1|369521|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
571. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
572. spacer 3.7|369917|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
573. spacer 3.9|370067|27|NZ_CP020381|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
574. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
575. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
576. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
577. spacer 3.10|370127|27|NZ_CP020381|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
578. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gcgccgccggtgactacgccgccagcgaca Protospacer
.* **********.*********.****.
579. spacer 4.2|635224|30|NZ_CP020381|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
580. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
581. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
582. spacer 4.2|635224|30|NZ_CP020381|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
583. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tccacgccggtgaccacgccgaccaccttg Protospacer
******************** * ** .*
584. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
aagaggccggcgagcacgccgccaacgaag Protospacer
* * *****.** ************** *
585. spacer 4.2|635224|30|NZ_CP020381|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
586. spacer 4.2|635224|30|NZ_CP020381|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
587. spacer 4.2|635224|30|NZ_CP020381|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
588. spacer 4.2|635224|30|NZ_CP020381|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
589. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
590. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
591. spacer 4.2|635224|30|NZ_CP020381|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
592. spacer 4.2|635224|30|NZ_CP020381|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
593. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
594. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgtaagcggctgggctggcggggatat Protospacer
.** ****** ************* .
595. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgtcagcggcggggctggcgttcatcg Protospacer
.******************* * *
596. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tagaagcggcggggctggtggagaggg Protospacer
.. **************.**.*****
597. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
gcgcaccggcggggctggcggggcggc Protospacer
** ***************** **
598. spacer 6.10|929168|27|NZ_CP020381|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
599. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
600. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
601. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
602. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
603. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
604. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
605. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
606. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
607. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
608. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
609. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
610. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
611. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
612. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
613. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
614. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
615. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
616. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
617. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
618. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
619. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
620. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
621. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
622. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
623. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
624. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
625. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
626. spacer 6.15|929405|30|NZ_CP020381|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
627. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
628. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
629. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
630. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
631. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
632. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
633. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
634. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
635. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
636. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
637. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
638. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
639. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
640. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
641. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
642. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
643. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
644. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
645. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
646. spacer 6.15|929405|30|NZ_CP020381|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
647. spacer 6.17|929495|36|NZ_CP020381|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg Protospacer
* .************************ .*****
648. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc-- Protospacer
************ ******* ***** * .***
649. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc-- Protospacer
.****************** ****** * ***
650. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct- Protospacer
.*********.*************** ..****
651. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac Protospacer
* ******************.**. ****** *
652. spacer 9.1|1577175|28|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
653. spacer 9.1|1577175|28|NZ_CP020381|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
654. spacer 9.1|1577175|28|NZ_CP020381|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
655. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
656. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
657. spacer 9.13|1578039|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
658. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
659. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 6, identity: 0.824
gcggcggggccggcggtagcggcggggccaactt-- CRISPR spacer
gcggcgcggccggcggcagcggc--ggccaacccgg Protospacer
****** *********.****** *******..
660. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.806
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
agcgcggcaccggcgggaccggcggcgtgtc Protospacer
*. **************.******.** **
661. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 6, identity: 0.824
gcggcggggccggcggtagcggcggggccaactt-- CRISPR spacer
gcggcgcggccggcggcagcggc--ggccaacccgg Protospacer
****** *********.****** *******..
662. spacer 3.4|369716|27|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
663. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
taggcgccggtgaccccgccgccgacgatg Protospacer
.*********** *******.****.*
664. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg Protospacer
*..* ******************.*.**
665. spacer 4.2|635224|30|NZ_CP020381|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atagcgccggtcaccgcgccgccaacgata Protospacer
*. .******* ***.************..
666. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
667. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
668. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
669. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
670. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag Protospacer
* .***********.********* * *
671. spacer 4.2|635224|30|NZ_CP020381|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggcccgccgatggccacgccgccaacggca Protospacer
. * *****.**.**************.*.
672. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg Protospacer
..*. * ****************. *****
673. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
674. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
675. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
676. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
677. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
678. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
679. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
680. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
681. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
682. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
683. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
684. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
685. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
686. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
687. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
688. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
689. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010614 (Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
690. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
691. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
692. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
693. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
694. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
695. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
696. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattggcggcggggctggcggggatct Protospacer
.*..*******************
697. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
698. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
699. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
700. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
701. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010744 (Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
702. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
703. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
704. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010655 (Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
705. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
706. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
707. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
708. spacer 6.6|929012|27|NZ_CP020381|CRT matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
709. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
710. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
711. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
712. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
713. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
714. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
715. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
716. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
717. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
718. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
719. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
720. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
721. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
722. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
723. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
724. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
725. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
726. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
727. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
728. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
729. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
730. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
731. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
732. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
733. spacer 6.13|929309|30|NZ_CP020381|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
734. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
735. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
736. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
737. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
738. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
739. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
740. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
741. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
742. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
743. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
744. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
745. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
746. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
747. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
748. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
749. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
750. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
751. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
752. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
753. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
754. spacer 6.13|929309|30|NZ_CP020381|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
755. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
756. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
757. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
758. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
759. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
760. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
761. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
762. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
763. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
764. spacer 6.13|929309|30|NZ_CP020381|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
765. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
766. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
767. spacer 6.13|929309|30|NZ_CP020381|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
768. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
769. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
770. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
771. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
772. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
773. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
774. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
775. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
776. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
777. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
778. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
779. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
780. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
781. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
782. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
783. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
784. spacer 6.13|929309|30|NZ_CP020381|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
785. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
786. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
787. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
788. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
789. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
790. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
791. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
792. spacer 6.13|929309|30|NZ_CP020381|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
793. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
794. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
795. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
796. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
797. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
798. spacer 6.13|929309|30|NZ_CP020381|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
799. spacer 6.13|929309|30|NZ_CP020381|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
800. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
801. spacer 6.13|929309|30|NZ_CP020381|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
802. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
803. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
804. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
805. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
806. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
807. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
808. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
809. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
810. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
811. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
812. spacer 6.15|929405|30|NZ_CP020381|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
813. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
814. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
815. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
816. spacer 6.15|929405|30|NZ_CP020381|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
817. spacer 6.15|929405|30|NZ_CP020381|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
818. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
819. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
820. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
821. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
822. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
823. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
824. spacer 6.17|929495|36|NZ_CP020381|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg Protospacer
**************** *********. * * **
825. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc- Protospacer
****** **** *************** ..** .
826. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc-- Protospacer
*.*********.********* *****. .***
827. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc- Protospacer
** *************** ******* *. **.
828. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta---- CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac Protospacer
****** ************* **** * ***
829. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
830. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
831. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc-- Protospacer
*.********.******** ******* .***
832. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc-- Protospacer
*********** *****.******* * * .**
833. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat Protospacer
.******** ********.***** **.*** *
834. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc- Protospacer
.* ******** ******** ****** * ***.
835. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
836. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
837. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
838. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
839. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
840. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
841. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
842. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
843. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
844. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
845. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct- Protospacer
.* ***.****.*************** * ***
846. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg-tggcta CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt- Protospacer
**.***** ***************.*.. *** *
847. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
848. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt Protospacer
* ***************** .*** ****** .
849. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
850. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc-- Protospacer
**.****************.****. * ****
851. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac Protospacer
* ***************** .*** *****..*
852. spacer 8.9|1217200|37|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac Protospacer
******************..******* . ***.**
853. spacer 9.1|1577175|28|NZ_CP020381|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
854. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
855. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
856. spacer 11.3|2090929|30|NZ_CP020381|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
857. spacer 11.3|2090929|30|NZ_CP020381|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
858. spacer 11.3|2090929|30|NZ_CP020381|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
859. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
860. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
861. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
862. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcggggccggcggtagcggcggcgcaggcgc Protospacer
.************************ ** ..* .
863. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gtggcggggcgggcggtagcggcggcgccgtcac Protospacer
*.******** ************** ***. * .
864. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcggggacggcggcagcggcggcgggctctt Protospacer
********* ******.******** * ***
865. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
866. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
867. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
868. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
869. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
870. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
871. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
872. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
873. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
874. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcg----gggccaactt CRISPR spacer
gcggcggtgccggcggcagcggcgagcagggcga---- Protospacer
******* ********.******* **** *
875. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggccccggcggtgccggcgataccga Protospacer
******** ******* ********.. *
876. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcggcggcgccggcggggccggcggcgggac Protospacer
. ******.***************.**. *
877. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtgacggcaccggcggtgccggcggcgatgc Protospacer
. *.************ *******.***. *
878. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcg-gcaccggcggggccggcgacgactc CRISPR spacer
-tgccgcgcaccgggggggacggcgacgacgg Protospacer
* ** ******* **** **********
879. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tacccggcaccgccgaggccggcgacgagtt Protospacer
* ******** **.************ *.
880. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcggcggcacgggcggggccggcggcagcac Protospacer
. ******** *************.*..* *
881. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
agcgccgcgccggcggggccggcgaccgctt Protospacer
*. ** **.***************** .**.
882. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcgacgacaccggcgaggccggcgacgccgc Protospacer
*.**.********.*********** * *
883. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
agcgccgcaacggcggggccggcgaccgctt Protospacer
*. ** *** **************** .**.
884. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
agcgccgcaacggcggggccggcgaccgctt Protospacer
*. ** *** **************** .**.
885. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
acgtcggcaccggcggcgccggcggcggcaa Protospacer
* * ************ *******.**.*
886. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcggggccggcggtagcggcggcgcaggcgc Protospacer
.************************ ** ..* .
887. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gtggcggggcgggcggtagcggcggcgccgtcac Protospacer
*.******** ************** ***. * .
888. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcggggacggcggcagcggcggcgggctctt Protospacer
********* ******.******** * ***
889. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
890. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
891. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
892. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
893. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
894. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
895. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
896. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
897. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
898. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcg----gggccaactt CRISPR spacer
gcggcggtgccggcggcagcggcgagcagggcga---- Protospacer
******* ********.******* **** *
899. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
900. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
901. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
902. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
903. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
904. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cagacctcggtgaccacgccggcaacgatc Protospacer
** .************** ******.
905. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggttggccggtgaccactccgccagcgatg Protospacer
. . ************ ******.***.*
906. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
907. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
908. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
909. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
910. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
911. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
912. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
913. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
914. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
915. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
916. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
917. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
918. spacer 6.13|929309|30|NZ_CP020381|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
919. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
920. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
921. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
922. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
923. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
924. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
925. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
926. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
927. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
928. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
929. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
930. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
931. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
932. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
933. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
934. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
935. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
936. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
937. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
938. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
939. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
940. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
941. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
942. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
943. spacer 6.17|929495|36|NZ_CP020381|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc Protospacer
..* . ************.******* ********
944. spacer 6.17|929495|36|NZ_CP020381|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
945. spacer 6.17|929495|36|NZ_CP020381|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
946. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt-- Protospacer
. ***************** ****** *.**.
947. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc-- Protospacer
*****************. ****** .** *
948. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc-- Protospacer
**********.** **********.* .***
949. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc Protospacer
*.******.**********.****** .**.*
950. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
951. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc Protospacer
****** ******.************ .**.
952. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
953. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
954. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg Protospacer
******* ** ************** * **.
955. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
956. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
957. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg Protospacer
******** *****.*********** * *.
958. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc- Protospacer
.**********.** *********** .* **.
959. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
960. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
961. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
962. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
963. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
964. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
965. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
966. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
967. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
968. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
969. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
970. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
971. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
972. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
973. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
974. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg----gtggcta CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg---- Protospacer
* ******** *******.******* ***
975. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc Protospacer
*************** .******** * **..
976. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcg-gcaacggcggcgccggcgggtggcta CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc Protospacer
* .*** ** ******** ************.
977. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
978. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
979. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
980. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
981. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
982. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
983. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
984. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
985. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
986. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
987. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
988. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
989. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
990. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
991. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
992. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
993. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
994. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg Protospacer
.***************** *.***** * * *.
995. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
996. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
997. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc-- Protospacer
.*********.********* ***** ..***
998. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
999. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1000. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat- Protospacer
.*******.********* ****** ** * *
1001. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca Protospacer
.****************** **** * ..**.*
1002. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat Protospacer
* ******** *******.***** **.**..*
1003. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca Protospacer
*.********.******** ******..* *.*
1004. spacer 8.9|1217200|37|NZ_CP020381|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc Protospacer
********.* **************** . ***..*
1005. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
1006. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1007. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1008. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1009. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1010. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1011. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1012. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
1013. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1014. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
1015. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
1016. spacer 11.3|2090929|30|NZ_CP020381|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
1017. spacer 11.3|2090929|30|NZ_CP020381|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
1018. spacer 14.24|3135736|29|NZ_CP020381|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
1019. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
1020. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1021. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1022. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1023. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1024. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1025. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1026. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1027. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1028. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1029. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
1030. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1031. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1032. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1033. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
1034. spacer 15.7|3760773|31|NZ_CP020381|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
1035. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ccggcggggccggcgggaccggcggggccggggg Protospacer
*************** * **********..
1036. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 8, identity: 0.765
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcggcgccggcggtaacggcggcgtgggcat Protospacer
******* **********.****** *. ..* *
1037. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gccgcggcaccggcggggccgccgccgatca Protospacer
. ****************** ** ***..
1038. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1039. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1040. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1041. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1042. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1043. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1044. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1045. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
caggcggcgccggcgaggccggcgaggggca Protospacer
*******.******.********* *. .
1046. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1047. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1048. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1049. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1050. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggccggcaccggcgtggccggcgacttcga Protospacer
.* *********** ********** *
1051. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1052. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
1053. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcggcggcgccggtggggccggcgaagcggc Protospacer
******.****.*********** * *
1054. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gggaccgccccggcgggaccggcgacgacga Protospacer
..*.* ** ********.***********
1055. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
acgtcggccccgtcggggccggcgacgcgga Protospacer
* * **** *** **************
1056. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgac---gactc CRISPR spacer
cgcgcggcaccggcgaggccgtcgacctgga--- Protospacer
. ************.***** **** **
1057. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ctgcgggcaccggcgcggccggcgccgaatt Protospacer
* ********** ******** *** *.
1058. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP017564 (Paraburkholderia sprentiae WSM5005 plasmid pl3WSM5005, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcggcggaaccggcgcggccggcgaagccgg Protospacer
. ***** ******* ********* * *
1059. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcgtcgggaccggcggggcgggcgacggcga Protospacer
* *** *********** *******.*
1060. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ttgcgggcaccggcgcggccggcgccgaatt Protospacer
* ********** ******** *** *.
1061. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
acgtcggcaccggcggcgccggcggcgcgaa Protospacer
* * ************ *******.**
1062. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ccggcggggccggcgggaccggcggggccggggg Protospacer
*************** * **********..
1063. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 8, identity: 0.765
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcggcgccggcggtaacggcggcgtgggcat Protospacer
******* **********.****** *. ..* *
1064. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
1065. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1066. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1067. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1068. spacer 4.2|635224|30|NZ_CP020381|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cccacgccggtcaccacgccgctgcccggc Protospacer
********** **********.. * .
1069. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
1070. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
1071. spacer 5.1|694803|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
1072. spacer 6.13|929309|30|NZ_CP020381|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
1073. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
1074. spacer 6.15|929405|30|NZ_CP020381|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
1075. spacer 6.17|929495|36|NZ_CP020381|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc Protospacer
** ******** *************** * .. *
1076. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc-- Protospacer
. ****************. ****** ..***
1077. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc-- Protospacer
. **************** ***** *..***
1078. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc Protospacer
************ ************ .. *
1079. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc-- Protospacer
. ****.****.************* * .***
1080. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc Protospacer
* ****** * *************** * *
1081. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1082. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1083. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1084. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
1085. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
1086. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa Protospacer
*.******* *********.****** ..* *
1087. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc Protospacer
.********* ******** ******* * .
1088. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag Protospacer
********** ************* *. * .
1089. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1090. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat Protospacer
*.********* *********** *** .. *
1091. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1092. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1093. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1094. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1095. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc Protospacer
* *********.******.******* * *
1096. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1097. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1098. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga Protospacer
****************** *.**** * *
1099. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1100. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1101. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1102. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1103. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1104. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1105. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1106. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1107. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1108. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1109. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1110. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1111. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1112. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1113. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1114. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1115. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg Protospacer
*.****************** ***.** * ...
1116. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1117. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1118. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1119. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1120. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1121. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1122. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1123. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac Protospacer
********* ************* .*. **
1124. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1125. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc-- Protospacer
*******.********.****** **..**
1126. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt Protospacer
* .*******.* ************** .**
1127. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1128. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg Protospacer
* **************** ****** * *.
1129. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1130. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga Protospacer
* *******. *************** .* *
1131. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1132. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1133. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc-- Protospacer
.*****************.*** ** ...***
1134. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1135. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1136. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1137. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1138. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1139. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1140. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1141. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc-- Protospacer
. ****************. ***** **..**
1142. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1143. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc Protospacer
*. ****************. ****** * *.
1144. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac Protospacer
* **** *********** ******* **
1145. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1146. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1147. spacer 8.9|1217200|37|NZ_CP020381|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc Protospacer
** **************** ****** *.* * *
1148. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
1149. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
1150. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
1151. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
1152. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
1153. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
1154. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
1155. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
1156. spacer 15.5|3760632|34|NZ_CP020381|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
1157. spacer 15.5|3760632|34|NZ_CP020381|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
1158. spacer 15.9|3760905|37|NZ_CP020381|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.757
cttgccggcggtgccggcgaccgcggtgccgccggcg CRISPR spacer
ggagacggcggtgccggagaccgcggtgtcgctgccc Protospacer
* ************ **********.***.* *
1159. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gtggcggggccggcggcaccggcgggatcttcgg Protospacer
*.**************.* *******..* *
1160. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcgggtccggcggtaacggcggtttcttcac Protospacer
******** *********.****** .* * .
1161. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcggggacggcggcagcggcgtgcagcgctg Protospacer
********* ******.******* * .**
1162. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcggggccggcggcggcggcgggatcgcctc Protospacer
**************..********..*. **.
1163. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to MK494105 (Mycobacterium phage Pinnie, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ccggcggcgccggcggtagtggcggaaccgaagg Protospacer
****** ***********.*****..**.*
1164. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_019411 (Caulobacter phage CcrSwift, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcggggccggcggcggcggcgggatcgcctc Protospacer
**************..********..*. **.
1165. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_011893 (Methylobacterium nodulans ORS 2060 plasmid pMNOD03, complete sequence) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcggggccggcgggggcggcggcggcggcgg Protospacer
.*************** .******* * *..*
1166. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcggcggcaccggcgggaccggcggcagggt Protospacer
. ***************.******.*.. .
1167. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcatccgcagcggcggggccggcgaggaccg Protospacer
. * *** *************** ***.
1168. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgggcggcaacggcggggccggcggtagcgg Protospacer
.******* **************....*
1169. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .
1170. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgcgcggcaccggctggtccggcgacgcgcg Protospacer
. *********** ** ********* .
1171. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaatgacaccggcgcggccggcgacgacga Protospacer
....*.******** *************
1172. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgggcggcagcggcggggccggcggacaagg Protospacer
.******* **************. *
1173. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tgaccggcaccggcagggctggcgacgagca Protospacer
.. **********.****.******** .
1174. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tgaccggcaccggcagggctggcgacgagca Protospacer
.. **********.****.******** .
1175. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gttcccgcacccgcggggcccgcgacgaccg Protospacer
. * ***** ******** ********.
1176. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtccggccccggcggggccggagacgggtt Protospacer
.. **** ************* ****. *.
1177. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ctgcgggcaccggcgcggccggcgccgaact Protospacer
* ********** ******** *** ..
1178. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcgcgtccggccagcgtga Protospacer
*************** * ***** * ..
1179. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcggcggcaccagcggtgccggcgaggcgcg Protospacer
*********.**** ******** * .
1180. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccgcgggcaccggcgcggccggcgccgaact Protospacer
* ********** ******** *** ..
1181. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcggcggcaccagcggtgccggcgaggcgcg Protospacer
*********.**** ******** * .
1182. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccggcggcaccggcggtggcggcgaggcact Protospacer
************** * ****** * ..
1183. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ctgcgggcaccggcgcggccggcgccgaact Protospacer
* ********** ******** *** ..
1184. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1185. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1186. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1187. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1188. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1189. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1190. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1191. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1192. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1193. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1194. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1195. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1196. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1197. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1198. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
1199. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gtggcggggccggcggcaccggcgggatcttcgg Protospacer
*.**************.* *******..* *
1200. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcgggtccggcggtaacggcggtttcttcac Protospacer
******** *********.****** .* * .
1201. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcggggacggcggcagcggcgtgcagcgctg Protospacer
********* ******.******* * .**
1202. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcggggccggcggcggcggcgggatcgcctc Protospacer
**************..********..*. **.
1203. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to MK494105 (Mycobacterium phage Pinnie, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ccggcggcgccggcggtagtggcggaaccgaagg Protospacer
****** ***********.*****..**.*
1204. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_019411 (Caulobacter phage CcrSwift, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcggggccggcggcggcggcgggatcgcctc Protospacer
**************..********..*. **.
1205. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_011893 (Methylobacterium nodulans ORS 2060 plasmid pMNOD03, complete sequence) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcggggccggcgggggcggcggcggcggcgg Protospacer
.*************** .******* * *..*
1206. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1207. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1208. spacer 3.6|369851|33|NZ_CP020381|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1209. spacer 6.2|928805|39|NZ_CP020381|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
1210. spacer 6.5|928958|36|NZ_CP020381|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
1211. spacer 6.5|928958|36|NZ_CP020381|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
1212. spacer 6.5|928958|36|NZ_CP020381|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
1213. spacer 6.5|928958|36|NZ_CP020381|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
1214. spacer 6.5|928958|36|NZ_CP020381|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
1215. spacer 6.17|929495|36|NZ_CP020381|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac Protospacer
... . ************************.**.
1216. spacer 6.17|929495|36|NZ_CP020381|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc Protospacer
* . . ************ ******** **** *
1217. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcg-----ggtggcta CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt----- Protospacer
*******.********** **** ***
1218. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc Protospacer
*. ***************..******* . *
1219. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc Protospacer
. ********* ********* ***** . * .
1220. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg Protospacer
********** ***** ******** * ....
1221. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc Protospacer
********* *** ***********. * .
1222. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact Protospacer
. ********. *************** *. .
1223. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1224. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga Protospacer
.********* *******.******* *
1225. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1226. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1227. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1228. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1229. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta------- CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc Protospacer
*****.****** ********* **.**
1230. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
1231. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1232. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag Protospacer
* **********.*****.*******. * .
1233. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1234. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1235. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
1236. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1237. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1238. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1239. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1240. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1241. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1242. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc Protospacer
.*****..***************** * .*
1243. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1244. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1245. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1246. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1247. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1248. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1249. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1250. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1251. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1252. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1253. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1254. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1255. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1256. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1257. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1258. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1259. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1260. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1261. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1262. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg Protospacer
* ********.*********.***** * ..
1263. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1264. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1265. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1266. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1267. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1268. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1269. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1270. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc Protospacer
********.********* ***** . **
1271. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1272. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1273. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1274. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1275. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1276. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1277. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag Protospacer
* ** ***** *************** * .
1278. spacer 8.9|1217200|37|NZ_CP020381|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1279. spacer 8.9|1217200|37|NZ_CP020381|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1280. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
1281. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
1282. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
1283. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
1284. spacer 9.10|1577790|31|NZ_CP020381|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
1285. spacer 9.13|1578039|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
1286. spacer 13.9|3132985|35|NZ_CP020381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
1287. spacer 14.21|3136537|34|NZ_CP020381|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
1288. spacer 14.35|3136541|34|NZ_CP020381|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
1289. spacer 15.5|3760632|34|NZ_CP020381|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
1290. spacer 15.5|3760632|34|NZ_CP020381|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1291. spacer 15.5|3760632|34|NZ_CP020381|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1292. spacer 15.5|3760632|34|NZ_CP020381|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1293. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcggagccggcggaagcggcggccacgccgg Protospacer
.******.******** ******** *. *
1294. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ctggcggggccggcggtagcggtggcgcgtcacc Protospacer
.********************.** ** ..
1295. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ctggcggggccggcggtagcggtggcgcgtcacc Protospacer
.********************.** ** ..
1296. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
tcggcgcggccggcggtaccggcgggaagtatgg Protospacer
***** *********** *******. *.
1297. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
aaggcggggccggcgctcgcggcgggctgcacga Protospacer
. ************* * ******** . **
1298. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to MK510999 (Pseudomonas phage BR58, partial genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ctagcaaggccggcggtagcggcggttccaaggc Protospacer
..**..****************** **** .
1299. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
aaggcgggtccggcgctagcggcgggctgcacga Protospacer
. ****** ****** ********** . **
1300. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 10, identity: 0.677
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcttcggcaccggcgggccgggcgacgcgct Protospacer
. ************* * ******* ..
1301. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.677
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtacgggcaccggcggggcgggcgccgaaag Protospacer
. . ************** **** ***
1302. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcggagccggcggaagcggcggccacgccgg Protospacer
.******.******** ******** *. *
1303. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ctggcggggccggcggtagcggtggcgcgtcacc Protospacer
.********************.** ** ..
1304. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ctggcggggccggcggtagcggtggcgcgtcacc Protospacer
.********************.** ** ..
1305. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
tcggcgcggccggcggtaccggcgggaagtatgg Protospacer
***** *********** *******. *.
1306. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
aaggcggggccggcgctcgcggcgggctgcacga Protospacer
. ************* * ******** . **
1307. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to MK510999 (Pseudomonas phage BR58, partial genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ctagcaaggccggcggtagcggcggttccaaggc Protospacer
..**..****************** **** .
1308. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
aaggcgggtccggcgctagcggcgggctgcacga Protospacer
. ****** ****** ********** . **
1309. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg Protospacer
. ****************. ****** *...
1310. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg Protospacer
.********.******** ******. *..
1311. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1312. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1313. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg Protospacer
.******** ******* ******** . ..
1314. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag Protospacer
.********* ********** *** . * .
1315. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg Protospacer
. *************** *****.** * ..
1316. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg Protospacer
.. ******.*.*************** * ..
1317. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc Protospacer
*****.****** *********** . *.
1318. spacer 8.5|1216984|40|NZ_CP020381|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725
tgccggcggcgccggcggtgtcggcggacccgccgggttg CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc Protospacer
*..******.***************** *** .*. *
1319. spacer 15.5|3760632|34|NZ_CP020381|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
1320. spacer 15.9|3760905|37|NZ_CP020381|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.703
cttgccggcggtgccggcgaccgcggtgccgccggcg CRISPR spacer
gccgtgcacggcgccggcggccgcggtgccgccgctg Protospacer
..*. .***.*******.************** .*
1321. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 11, identity: 0.676
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ccggcggggccggcggcaacggcggcatcgcacc Protospacer
***************.*.****** ..*. ..
1322. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 11, identity: 0.676
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcgcgcccggcggtagcggcgggcgggccgc Protospacer
**** * ***************** . * .
1323. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 11, identity: 0.676
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcgcgcccggcggtagcggcgggcgggccgc Protospacer
**** * ***************** . * .
1324. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 11, identity: 0.676
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ccggcggggccggcggcaacggcggcatcgcacc Protospacer
***************.*.****** ..*. ..
1325. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 11, identity: 0.676
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcgcgcccggcggtagcggcgggcgggccgc Protospacer
**** * ***************** . * .
1326. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 11, identity: 0.676
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcgcgcccggcggtagcggcgggcgggccgc Protospacer
**** * ***************** . * .
1327. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg Protospacer
..********.****** ******** . ...
1328. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgc-----cggcgggtggcta CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg---- Protospacer
***** ..*. ***** *** **** ****
1329. spacer 17.6|3970446|34|NZ_CP020381|CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 12, identity: 0.647
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcgggcccggcggtaacggcggcagtggtga Protospacer
.******* *********.****** . ....
1330. spacer 17.8|3970590|31|NZ_CP020381|CRT matches to NZ_CP022194 (Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence) position: , mismatch: 12, identity: 0.613
------aaggcggcaccggcggggccggcgacgactc CRISPR spacer
agttcaaggccggcaccgccggggccgcctt------ Protospacer
*.* ******** ******** *
1331. spacer 17.13|3971043|34|NZ_CP020381|CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 12, identity: 0.647
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcgggcccggcggtaacggcggcagtggtga Protospacer
.******* *********.****** . ....
1332. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga----- Protospacer
***** ****. ***** . *** **.*
1333. spacer 8.3|1216879|34|NZ_CP020381|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga----- Protospacer
***** ****. **.** . *** **.*