Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 0 crisprs csa3,cas3,RT 0 0 1 0
NZ_CP020071 Klebsiella pneumoniae strain AR_0115, complete genome 3 crisprs csa3,cas3,DEDDh,WYL,RT,DinG 0 1 13 0
NZ_CP020073 Klebsiella pneumoniae strain AR_0115 plasmid tig00000003, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP020075 Klebsiella pneumoniae strain AR_0115 plasmid tig00000005, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP020074 Klebsiella pneumoniae strain AR_0115 plasmid tig00000004, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP020072
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14525 : 52360 35 Escherichia_phage(33.33%) integrase,transposase,protease attL 11038:11053|attR 64626:64641
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP020071
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020071_1 2119708-2119793 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020071_2 2603679-2603774 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020071_3 2944415-2944492 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020071_2 2.1|2603709|36|NZ_CP020071|CRISPRCasFinder 2603709-2603744 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP020071_2 2.1|2603709|36|NZ_CP020071|CRISPRCasFinder 2603709-2603744 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP020071_2 2.1|2603709|36|NZ_CP020071|CRISPRCasFinder 2603709-2603744 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 2.1|2603709|36|NZ_CP020071|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

2. spacer 2.1|2603709|36|NZ_CP020071|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

3. spacer 2.1|2603709|36|NZ_CP020071|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 360 : 36212 47 Salmonella_phage(83.33%) tail,portal,integrase,coat,terminase,lysis,capsid,head,plate attL 1306:1352|attR 37873:37919
DBSCAN-SWA_2 756569 : 805412 54 uncultured_Caudovirales_phage(66.67%) tail,protease,portal,terminase,tRNA,capsid,head NA
DBSCAN-SWA_3 2371444 : 2383098 13 Enterobacteria_phage(70.0%) integrase attL 2359578:2359592|attR 2382635:2382649
DBSCAN-SWA_4 2592653 : 2637928 63 Escherichia_phage(26.42%) lysis,head,tRNA,integrase attL 2595536:2595582|attR 2644670:2644716
DBSCAN-SWA_5 3037988 : 3075324 46 Salmonella_phage(84.62%) tail,portal,integrase,terminase,capsid,lysis,head,plate attL 3037896:3037914|attR 3075396:3075414
DBSCAN-SWA_6 3109740 : 3119204 8 Dickeya_phage(16.67%) tRNA,protease NA
DBSCAN-SWA_7 3507232 : 3558124 61 Klebsiella_phage(23.4%) tail,holin,integrase,terminase,transposase attL 3499210:3499225|attR 3522049:3522064
DBSCAN-SWA_8 3562389 : 3572869 9 Escherichia_phage(22.22%) transposase NA
DBSCAN-SWA_9 3605802 : 3645574 57 uncultured_Caudovirales_phage(35.42%) transposase,terminase,integrase attL 3603883:3603897|attR 3612823:3612837
DBSCAN-SWA_10 4112218 : 4123105 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_11 4541045 : 4584145 39 Microcystis_virus(25.0%) plate,tRNA,transposase NA
DBSCAN-SWA_12 4851833 : 4859458 7 Escherichia_phage(28.57%) NA NA
DBSCAN-SWA_13 4896025 : 4902932 6 Bacillus_phage(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP020073
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 133 : 7678 8 Escherichia_phage(50.0%) integrase attL 6191:6205|attR 11817:11831
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP020074
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14081 : 24379 8 Escherichia_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage