Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020048 Escherichia coli strain AR_0118, complete genome 7 crisprs cas3,RT,DinG,DEDDh,WYL,csa3,PD-DExK,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,c2c9_V-U4 0 18 12 0
NZ_CP020050 Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence 0 crisprs WYL,csa3 0 0 1 0
NZ_CP020049 Escherichia coli strain AR_0118 plasmid unitig_1, complete sequence 0 crisprs DEDDh 0 0 8 0
NZ_CP020051 Escherichia coli strain AR_0118 plasmid unitig_3, complete sequence 0 crisprs c2c9_V-U4 0 0 1 0

Results visualization

1. NZ_CP020048
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020048_1 34832-34942 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020048_2 685063-685154 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020048_3 949808-949952 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020048_4 1179240-1179336 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020048_5 3680629-3681755 Unclear I-E
18 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020048_6 3707455-3707970 TypeI-E I-E
8 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020048_7 4964460-4964583 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
NZ_CP020048_2 2.1|685089|40|NZ_CP020048|CRISPRCasFinder 685089-685128 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
NZ_CP020048_6 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT 3707910-3707941 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
NZ_CP020048_7 7.1|4964503|38|NZ_CP020048|CRISPRCasFinder 4964503-4964540 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP020048_5 5.15|3681512|32|NZ_CP020048|CRISPRCasFinder,CRT 3681512-3681543 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 632328-632359 5 0.844
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 112048-112078 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 138722-138752 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 134876-134906 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 159432-159462 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 139796-139826 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 255946-255976 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 159432-159462 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 132848-132878 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 132849-132879 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 159441-159471 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 159459-159489 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 159431-159461 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 138736-138766 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 138734-138764 6 0.806
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 138733-138763 6 0.806
NZ_CP020048_5 5.9|3681146|32|NZ_CP020048|CRISPRCasFinder,CRT 3681146-3681177 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 831891-831922 7 0.781
NZ_CP020048_5 5.9|3681146|32|NZ_CP020048|CRISPRCasFinder,CRT 3681146-3681177 32 NZ_CP034813 Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence 109991-110022 7 0.781
NZ_CP020048_5 5.18|3681695|32|NZ_CP020048|CRISPRCasFinder,CRT 3681695-3681726 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP009154 Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence 17332-17362 7 0.774
NZ_CP020048_5 5.1|3680658|32|NZ_CP020048|CRISPRCasFinder,CRT 3680658-3680689 32 NZ_CP016283 Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_1, complete sequence 62256-62287 8 0.75
NZ_CP020048_5 5.3|3680780|32|NZ_CP020048|CRISPRCasFinder,CRT 3680780-3680811 32 MF773750 Mycobacterium phage OKCentral2016, complete genome 32038-32069 8 0.75
NZ_CP020048_5 5.3|3680780|32|NZ_CP020048|CRISPRCasFinder,CRT 3680780-3680811 32 JX307704 Mycobacterium virus Goose, complete genome 32135-32166 8 0.75
NZ_CP020048_5 5.9|3681146|32|NZ_CP020048|CRISPRCasFinder,CRT 3681146-3681177 32 NZ_CP040764 Paracoccus sp. 2251 plasmid unnamed3, complete sequence 159957-159988 8 0.75
NZ_CP020048_5 5.11|3681268|32|NZ_CP020048|CRISPRCasFinder,CRT 3681268-3681299 32 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 5007-5038 8 0.75
NZ_CP020048_5 5.13|3681390|32|NZ_CP020048|CRISPRCasFinder,CRT 3681390-3681421 32 NC_014825 Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence 131301-131332 8 0.75
NZ_CP020048_5 5.15|3681512|32|NZ_CP020048|CRISPRCasFinder,CRT 3681512-3681543 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 460575-460606 8 0.75
NZ_CP020048_5 5.18|3681695|32|NZ_CP020048|CRISPRCasFinder,CRT 3681695-3681726 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
NZ_CP020048_6 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707545-3707576 32 NZ_CP038019 Eikenella exigua strain PXX plasmid unnamed1, complete sequence 39637-39668 8 0.75
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1470278-1470308 8 0.742
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 7608-7638 8 0.742
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 7168-7198 8 0.742
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 94061-94091 8 0.742
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 9778-9808 8 0.742
NZ_CP020048_5 5.7|3681024|32|NZ_CP020048|CRISPRCasFinder,CRT 3681024-3681055 32 CP034667 Proteus vulgaris strain PvSC3 plasmid pPvSC3, complete sequence 11529-11560 9 0.719
NZ_CP020048_5 5.7|3681024|32|NZ_CP020048|CRISPRCasFinder,CRT 3681024-3681055 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1243128-1243159 9 0.719
NZ_CP020048_5 5.10|3681207|32|NZ_CP020048|CRISPRCasFinder,CRT 3681207-3681238 32 MN698241 Pelagibacter phage HTVC027P, complete genome 53788-53819 9 0.719
NZ_CP020048_5 5.12|3681329|32|NZ_CP020048|CRISPRCasFinder,CRT 3681329-3681360 32 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 80627-80658 9 0.719
NZ_CP020048_5 5.13|3681390|32|NZ_CP020048|CRISPRCasFinder,CRT 3681390-3681421 32 NZ_CP005987 Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence 65430-65461 9 0.719
NZ_CP020048_5 5.13|3681390|32|NZ_CP020048|CRISPRCasFinder,CRT 3681390-3681421 32 MN163281 Klebsiella phage KpCHEMY26, complete genome 2153-2184 9 0.719
NZ_CP020048_5 5.15|3681512|32|NZ_CP020048|CRISPRCasFinder,CRT 3681512-3681543 32 NZ_CP006988 Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence 91348-91379 9 0.719
NZ_CP020048_5 5.16|3681573|32|NZ_CP020048|CRISPRCasFinder,CRT 3681573-3681604 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
NZ_CP020048_5 5.18|3681695|32|NZ_CP020048|CRISPRCasFinder,CRT 3681695-3681726 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
NZ_CP020048_6 6.1|3707484|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707484-3707515 32 NZ_CP032328 Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence 29293-29324 9 0.719
NZ_CP020048_6 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707545-3707576 32 NC_024216 Bacillus phage CAM003, complete genome 77679-77710 9 0.719
NZ_CP020048_6 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707545-3707576 32 KJ489400 Bacillus phage Hoody T, complete genome 77517-77548 9 0.719
NZ_CP020048_6 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707545-3707576 32 MF288921 Bacillus phage OTooleKemple52, complete genome 77645-77676 9 0.719
NZ_CP020048_6 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707545-3707576 32 MH638310 Bacillus phage Kamfam, complete genome 77630-77661 9 0.719
NZ_CP020048_6 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707545-3707576 32 MK215646 Bacillus phage vB_BthM-Goe5, complete genome 76671-76702 9 0.719
NZ_CP020048_6 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707545-3707576 32 MF498901 Bacillus phage Anthony, complete genome 78265-78296 9 0.719
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 739494-739524 9 0.71
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 694600-694630 9 0.71
NZ_CP020048_6 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT 3707789-3707819 31 AP014383 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS *** 34869-34899 9 0.71
NZ_CP020048_5 5.1|3680658|32|NZ_CP020048|CRISPRCasFinder,CRT 3680658-3680689 32 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 182843-182874 10 0.688
NZ_CP020048_5 5.6|3680963|32|NZ_CP020048|CRISPRCasFinder,CRT 3680963-3680994 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 65082-65113 10 0.688
NZ_CP020048_5 5.18|3681695|32|NZ_CP020048|CRISPRCasFinder,CRT 3681695-3681726 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688

1. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

2. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

3. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

4. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

5. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

6. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

7. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

8. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

9. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

10. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

11. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

12. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

13. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

14. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

15. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

16. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

17. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

18. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

19. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

20. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

21. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

22. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

23. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

24. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

25. spacer 2.1|685089|40|NZ_CP020048|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

gcgctgcgggtcattcttgaaattccccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
************************ ***************

26. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

27. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

28. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

29. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

30. spacer 6.8|3707910|32|NZ_CP020048|CRISPRCasFinder,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacgttatgaaccgacattcatgt	Protospacer
************ * *****************

31. spacer 7.1|4964503|38|NZ_CP020048|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

32. spacer 5.15|3681512|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 5, identity: 0.844

gcgatctcgcggaatacaccgacg-aggcgggc	CRISPR spacer
acgatctcgcggaatacgtcgacgtaggccgg-	Protospacer
.****************..***** **** ** 

33. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gcggtcaaatccggcgagccgccggcgctct	Protospacer
 **  *******.***********.***** 

34. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

35. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

36. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

37. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

38. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 6, identity: 0.806

-ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ttcgcg-gcatccagcgtgccgccgtcgctca	Protospacer
 .**** . ******** ******* ******

39. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

40. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

41. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

42. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

43. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

44. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

45. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

46. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

47. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

48. spacer 5.9|3681146|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 7, identity: 0.781

tcgggacgctgcgcgatctgcatagcaacgca	CRISPR spacer
tcggtgcgctgcgcgatctgcatgtcttcgaa	Protospacer
**** .*****************. *  ** *

49. spacer 5.9|3681146|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

tcgggacgctgcgcgatctgcatag-caacgca	CRISPR spacer
tgtggacggtgcgctatctgcatagcctgcgc-	Protospacer
*  ***** ***** ********** * .*** 

50. spacer 5.18|3681695|32|NZ_CP020048|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt	Protospacer
******* ******** ******. * . ***

51. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009154 (Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774

ccgcgcaaatccagcgagccgccgacgctca---	CRISPR spacer
gcccgcacattcagcgagccgccgac---caagc	Protospacer
 * **** **.***************   **   

52. spacer 5.1|3680658|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP016283 (Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_1, complete sequence) position: , mismatch: 8, identity: 0.75

ccagggtgagccagcgccgcaggaagacacgc	CRISPR spacer
ccagagtgagccagccccgcaggctgcctctg	Protospacer
****.********** *******  * * *  

53. spacer 5.3|3680780|32|NZ_CP020048|CRISPRCasFinder,CRT matches to MF773750 (Mycobacterium phage OKCentral2016, complete genome) position: , mismatch: 8, identity: 0.75

gagcgtagagattctcgaaaccgatccggacg	CRISPR spacer
cctcgtagagatcctcgaagccgatctcggcg	Protospacer
   *********.******.******. *.**

54. spacer 5.3|3680780|32|NZ_CP020048|CRISPRCasFinder,CRT matches to JX307704 (Mycobacterium virus Goose, complete genome) position: , mismatch: 8, identity: 0.75

gagcgtagagattctcgaaaccgatccggacg	CRISPR spacer
cctcgtagagatcctcgaagccgatctcggcg	Protospacer
   *********.******.******. *.**

55. spacer 5.9|3681146|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

tcgggacgctgcgcgatctgcatagcaacgca	CRISPR spacer
tgtccacgctgcgcgatctgcatcgcagcggc	Protospacer
*    ****************** ***.**  

56. spacer 5.11|3681268|32|NZ_CP020048|CRISPRCasFinder,CRT matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 8, identity: 0.75

tttctatctcccagtgggagagagatgacagt	CRISPR spacer
tcacgatctcccagtgggaaagggatgaaacc	Protospacer
*. * **************.**.***** * .

57. spacer 5.13|3681390|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NC_014825 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence) position: , mismatch: 8, identity: 0.75

-catgaatatggacgatgaaaaaataagagagg	CRISPR spacer
ctacgca-ggggacgttgaaaaactaagagagg	Protospacer
 .*.* * . ***** ******* *********

58. spacer 5.15|3681512|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgatctcgcggaatacaccgacgaggcgggc	CRISPR spacer
gcctgctggcggaatacgccgacgaggcgacg	Protospacer
**   ** *********.***********.  

59. spacer 5.18|3681695|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc	Protospacer
* ************* **** *****.  *..

60. spacer 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038019 (Eikenella exigua strain PXX plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cttattgagttggcacaggaattacatgagga	CRISPR spacer
caccaagagttggcacaggaattggatgaggc	Protospacer
* .   *****************. ****** 

61. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgcgcaaatcgagcgtgccgccggtgaggc	Protospacer
*********** **** *******..*    

62. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

63. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

64. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

65. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

66. spacer 5.7|3681024|32|NZ_CP020048|CRISPRCasFinder,CRT matches to CP034667 (Proteus vulgaris strain PvSC3 plasmid pPvSC3, complete sequence) position: , mismatch: 9, identity: 0.719

agacggcgcgtaaaactcatacggcgacaaat	CRISPR spacer
agacggcgcgtaagactcagacggttttttac	Protospacer
*************.***** ****.  .  *.

67. spacer 5.7|3681024|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

agacggcgcgtaaaactcatacggcgacaaat	CRISPR spacer
agacggcgcgcaaaactcagacgctcgccatc	Protospacer
**********.******** *** . .* * .

68. spacer 5.10|3681207|32|NZ_CP020048|CRISPRCasFinder,CRT matches to MN698241 (Pelagibacter phage HTVC027P, complete genome) position: , mismatch: 9, identity: 0.719

gtatttttgctgacggattctcagagagtttc	CRISPR spacer
gagctattgctgatggattatcagagagtggt	Protospacer
* ..* *******.***** *********  .

69. spacer 5.12|3681329|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.719

gggtatcgcactgcggcagatgttccggggcc---	CRISPR spacer
catgatcgccctgccgcagatgttcc---gcctgg	Protospacer
 .  ***** **** ***********   ***   

70. spacer 5.13|3681390|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP005987 (Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence) position: , mismatch: 9, identity: 0.719

catgaatatggacgatgaaaaaataagagagg	CRISPR spacer
ggtgaataaggacgatgagaaaataatcgcaa	Protospacer
 .****** *********.*******  * ..

71. spacer 5.13|3681390|32|NZ_CP020048|CRISPRCasFinder,CRT matches to MN163281 (Klebsiella phage KpCHEMY26, complete genome) position: , mismatch: 9, identity: 0.719

catgaatatggacgatgaaaaaataagagagg-------	CRISPR spacer
catgaatctggacgatgataaa-------aggtttctcc	Protospacer
******* ********** ***       ***       

72. spacer 5.15|3681512|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 9, identity: 0.719

gcgatctcgcggaatacaccgacgaggcgggc	CRISPR spacer
cgcacgtcgcggattacatcgacgaggcggta	Protospacer
   *. ******* ****.***********  

73. spacer 5.16|3681573|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

taaggccgtcgccggatcagcctggctatgcc	CRISPR spacer
cggggccgtcgccggatcagccggtctgctgc	Protospacer
...******************* * **..  *

74. spacer 5.18|3681695|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg	Protospacer
** ************** ******..  .*  

75. spacer 6.1|3707484|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032328 (Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence) position: , mismatch: 9, identity: 0.719

caacaaaacgctggaagccggaacagatatct	CRISPR spacer
gcccgaaacgctggaagccggagcacatgccc	Protospacer
   *.*****************.** **..*.

76. spacer 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NC_024216 (Bacillus phage CAM003, complete genome) position: , mismatch: 9, identity: 0.719

cttattgagttggcacaggaattacatgagga-----	CRISPR spacer
agtattgagctggcacaggtattac-----gactctt	Protospacer
  *******.********* *****     **     

77. spacer 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to KJ489400 (Bacillus phage Hoody T, complete genome) position: , mismatch: 9, identity: 0.719

cttattgagttggcacaggaattacatgagga-----	CRISPR spacer
agtattgagctggcacaggtattac-----gactatt	Protospacer
  *******.********* *****     **     

78. spacer 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to MF288921 (Bacillus phage OTooleKemple52, complete genome) position: , mismatch: 9, identity: 0.719

cttattgagttggcacaggaattacatgagga-----	CRISPR spacer
agtattgagctggcacaggtattac-----gactatt	Protospacer
  *******.********* *****     **     

79. spacer 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to MH638310 (Bacillus phage Kamfam, complete genome) position: , mismatch: 9, identity: 0.719

cttattgagttggcacaggaattacatgagga-----	CRISPR spacer
agtattgagctggcacaggtattac-----gactatt	Protospacer
  *******.********* *****     **     

80. spacer 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to MK215646 (Bacillus phage vB_BthM-Goe5, complete genome) position: , mismatch: 9, identity: 0.719

cttattgagttggcacaggaattacatgagga-----	CRISPR spacer
agtattgagctggcacaggtattac-----gactatt	Protospacer
  *******.********* *****     **     

81. spacer 6.2|3707545|32|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to MF498901 (Bacillus phage Anthony, complete genome) position: , mismatch: 9, identity: 0.719

cttattgagttggcacaggaattacatgagga-----	CRISPR spacer
agtattgagctggcacaggtattac-----gactatt	Protospacer
  *******.********* *****     **     

82. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.71

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
tcttcggcatccagcgagccgccgtcgccca	Protospacer
.* .  . **************** ***.**

83. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.71

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gtcttcaagtcgagcgagccgccgacgccga	Protospacer
 . . ***.** ****************. *

84. spacer 6.6|3707789|31|NZ_CP020048|PILER-CR,CRISPRCasFinder,CRT matches to AP014383 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
atgatgaaatccaacgagccgccgaggcttt	Protospacer
 .*   *******.*********** ***. 

85. spacer 5.1|3680658|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ccagggtgagccagcgccgcaggaagacacgc	CRISPR spacer
tcagggtgaaccagcggcgcaggatttcggaa	Protospacer
.********.****** *******   *. . 

86. spacer 5.6|3680963|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

tcatcgaaaaccagcggatcgaatgggacgcc	CRISPR spacer
gcgatcgctacgagccgatcgaatgggacgcc	Protospacer
 *. . .  ** *** ****************

87. spacer 5.18|3681695|32|NZ_CP020048|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc	Protospacer
    ******* *********.***** . *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19592 : 68817 57 Enterobacteria_phage(37.04%) terminase,lysis,protease,tail,integrase attL 36723:36737|attR 51645:51659
DBSCAN-SWA_2 256123 : 263819 8 Enterobacteria_phage(50.0%) tail,transposase NA
DBSCAN-SWA_3 270530 : 288829 22 Escherichia_phage(66.67%) integrase,tRNA attL 271867:271880|attR 286252:286265
DBSCAN-SWA_4 365354 : 423837 78 Salmonella_phage(39.29%) protease,plate,head,tail,integrase attL 383113:383129|attR 424024:424040
DBSCAN-SWA_5 1407412 : 1468990 52 Shigella_phage(44.44%) holin,tail,integrase attL 1436292:1436307|attR 1467037:1467052
DBSCAN-SWA_6 1863648 : 1879891 17 Salmonella_phage(28.57%) integrase,transposase attL 1861110:1861169|attR 1884643:1885410
DBSCAN-SWA_7 2386394 : 2437374 63 Salmonella_phage(79.49%) holin,capsid,protease,plate,portal,transposase,head,tail,integrase attL 2419877:2419893|attR 2445575:2445591
DBSCAN-SWA_8 3724325 : 3731465 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_9 4091634 : 4134494 65 Enterobacteria_phage(54.39%) holin,terminase,lysis,coat,portal,transposase,tail,integrase attL 4084324:4084338|attR 4119444:4119458
DBSCAN-SWA_10 4379744 : 4389186 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_11 4619105 : 4652467 38 Escherichia_phage(30.77%) holin,tail,terminase,integrase attL 4607625:4607639|attR 4629007:4629021
DBSCAN-SWA_12 4883760 : 4902570 20 Enterobacteria_phage(69.23%) tail,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP020050
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14143 : 71035 48 Stx2-converting_phage(30.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP020049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 2553 3 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_2 6183 : 12805 10 Sodalis_phage(25.0%) NA NA
DBSCAN-SWA_3 16445 : 17561 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_4 21464 : 25211 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_5 32539 : 85431 44 Bacillus_phage(21.43%) integrase,transposase attL 25781:25801|attR 89627:89647
DBSCAN-SWA_6 94913 : 97601 3 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_7 107197 : 110556 3 Morganella_phage(50.0%) transposase NA
DBSCAN-SWA_8 117653 : 135985 26 Escherichia_phage(20.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP020051
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 91267 98 Escherichia_phage(90.43%) transposase,tail,plate,tRNA,lysis,head,holin,integrase,protease,capsid attL 55611:55629|attR 81596:81614
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage