Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019965 Campylobacter jejuni strain NCTC12662 chromosome, complete genome 1 crisprs DEDDh,WYL,cas2,cas1,cas9,csa3 1 7 1 0

Results visualization

1. NZ_CP019965
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019965_1 1429047-1429479 TypeII NA
6 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP019965_1 1.8|1429422|18|NZ_CP019965|PILER-CR 1429422-1429439 18 NZ_CP019965.1 1412290-1412307 2 0.889

1. spacer 1.8|1429422|18|NZ_CP019965|PILER-CR matches to position: 1412290-1412307, mismatch: 2, identity: 0.889

tttataaatttggatatg	CRISPR spacer
tttatcaatctggatatg	Protospacer
***** ***.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019965_1 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT 1429083-1429112 30 KF751797 Campylobacter phage CJIE4-5, complete genome 13919-13948 0 1.0
NZ_CP019965_1 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT 1429083-1429112 30 KF751793 Campylobacter phage CJIE4-1, complete genome 14946-14975 0 1.0
NZ_CP019965_1 1.2|1429149|30|NZ_CP019965|CRISPRCasFinder,CRT 1429149-1429178 30 NZ_CP038864 Campylobacter jejuni strain SCJK2 plasmid p2, complete sequence 1328-1357 0 1.0
NZ_CP019965_1 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT 1429215-1429244 30 KF751797 Campylobacter phage CJIE4-5, complete genome 13919-13948 0 1.0
NZ_CP019965_1 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT 1429215-1429244 30 KF751793 Campylobacter phage CJIE4-1, complete genome 14946-14975 0 1.0
NZ_CP019965_1 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT 1429083-1429112 30 MN530981 Campylobacter phage DA10, complete genome 33579-33608 1 0.967
NZ_CP019965_1 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT 1429083-1429112 30 KF751794 Campylobacter phage CJIE4-2, complete genome 13669-13698 1 0.967
NZ_CP019965_1 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT 1429083-1429112 30 KF751795 Campylobacter phage CJIE4-3, complete genome 11997-12026 1 0.967
NZ_CP019965_1 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT 1429083-1429112 30 KF751796 Campylobacter phage CJIE4-4, complete genome 12035-12064 1 0.967
NZ_CP019965_1 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT 1429215-1429244 30 MN530981 Campylobacter phage DA10, complete genome 33579-33608 1 0.967
NZ_CP019965_1 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT 1429215-1429244 30 KF751794 Campylobacter phage CJIE4-2, complete genome 13669-13698 1 0.967
NZ_CP019965_1 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT 1429215-1429244 30 KF751795 Campylobacter phage CJIE4-3, complete genome 11997-12026 1 0.967
NZ_CP019965_1 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT 1429215-1429244 30 KF751796 Campylobacter phage CJIE4-4, complete genome 12035-12064 1 0.967
NZ_CP019965_1 1.4|1429281|30|NZ_CP019965|CRISPRCasFinder,CRT 1429281-1429310 30 KF751794 Campylobacter phage CJIE4-2, complete genome 13655-13684 2 0.933
NZ_CP019965_1 1.4|1429281|30|NZ_CP019965|CRISPRCasFinder,CRT 1429281-1429310 30 KF751795 Campylobacter phage CJIE4-3, complete genome 11983-12012 2 0.933
NZ_CP019965_1 1.4|1429281|30|NZ_CP019965|CRISPRCasFinder,CRT 1429281-1429310 30 KF751796 Campylobacter phage CJIE4-4, complete genome 12021-12050 2 0.933
NZ_CP019965_1 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT 1429347-1429376 30 MN530981 Campylobacter phage DA10, complete genome 34843-34872 2 0.933
NZ_CP019965_1 1.6|1429413|30|NZ_CP019965|CRISPRCasFinder,CRT 1429413-1429442 30 MN530981 Campylobacter phage DA10, complete genome 14249-14278 2 0.933
NZ_CP019965_1 1.7|1429348|26|NZ_CP019965|PILER-CR 1429348-1429373 26 MN530981 Campylobacter phage DA10, complete genome 34846-34871 2 0.923
NZ_CP019965_1 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT 1429347-1429376 30 NZ_CP022484 Enterococcus faecalis ARO1/DG plasmid pARO1.1, complete sequence 32051-32080 7 0.767
NZ_CP019965_1 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT 1429347-1429376 30 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 52289-52318 7 0.767
NZ_CP019965_1 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT 1429347-1429376 30 NZ_CP028721 Enterococcus faecalis strain CVM N48037F plasmid pN48037F-1, complete sequence 46107-46136 7 0.767
NZ_CP019965_1 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT 1429347-1429376 30 NZ_CP028286 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence 24317-24346 7 0.767
NZ_CP019965_1 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT 1429347-1429376 30 NZ_CP028286 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence 96873-96902 7 0.767
NZ_CP019965_1 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT 1429347-1429376 30 NZ_CP042217 Enterococcus faecalis strain L8 plasmid pL8, complete sequence 45343-45372 7 0.767
NZ_CP019965_1 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT 1429347-1429376 30 NZ_MK140641 Enterococcus faecalis strain E035 plasmid pE035, complete sequence 56665-56694 7 0.767
NZ_CP019965_1 1.6|1429413|30|NZ_CP019965|CRISPRCasFinder,CRT 1429413-1429442 30 MH572526 Microviridae sp. isolate SD_HF_66, complete genome 3109-3138 8 0.733
NZ_CP019965_1 1.6|1429413|30|NZ_CP019965|CRISPRCasFinder,CRT 1429413-1429442 30 NZ_LN890332 Leuconostoc gelidum subsp. gasicomitatum KG16-1 isolate LEKG1 plasmid II, complete sequence 5684-5713 8 0.733
NZ_CP019965_1 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT 1429083-1429112 30 MN693024 Marine virus AFVG_117M49, complete genome 7901-7930 9 0.7
NZ_CP019965_1 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT 1429215-1429244 30 MN693024 Marine virus AFVG_117M49, complete genome 7901-7930 9 0.7

1. spacer 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751797 (Campylobacter phage CJIE4-5, complete genome) position: , mismatch: 0, identity: 1.0

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccttcaagtcgtgcaattttaatacactgg	Protospacer
******************************

2. spacer 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751793 (Campylobacter phage CJIE4-1, complete genome) position: , mismatch: 0, identity: 1.0

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccttcaagtcgtgcaattttaatacactgg	Protospacer
******************************

3. spacer 1.2|1429149|30|NZ_CP019965|CRISPRCasFinder,CRT matches to NZ_CP038864 (Campylobacter jejuni strain SCJK2 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gtatcagctatagatctatcagaatttaca	CRISPR spacer
gtatcagctatagatctatcagaatttaca	Protospacer
******************************

4. spacer 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751797 (Campylobacter phage CJIE4-5, complete genome) position: , mismatch: 0, identity: 1.0

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccttcaagtcgtgcaattttaatacactgg	Protospacer
******************************

5. spacer 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751793 (Campylobacter phage CJIE4-1, complete genome) position: , mismatch: 0, identity: 1.0

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccttcaagtcgtgcaattttaatacactgg	Protospacer
******************************

6. spacer 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 1, identity: 0.967

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
** ***************************

7. spacer 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751794 (Campylobacter phage CJIE4-2, complete genome) position: , mismatch: 1, identity: 0.967

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
** ***************************

8. spacer 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751795 (Campylobacter phage CJIE4-3, complete genome) position: , mismatch: 1, identity: 0.967

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
** ***************************

9. spacer 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751796 (Campylobacter phage CJIE4-4, complete genome) position: , mismatch: 1, identity: 0.967

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
** ***************************

10. spacer 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 1, identity: 0.967

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
** ***************************

11. spacer 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751794 (Campylobacter phage CJIE4-2, complete genome) position: , mismatch: 1, identity: 0.967

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
** ***************************

12. spacer 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751795 (Campylobacter phage CJIE4-3, complete genome) position: , mismatch: 1, identity: 0.967

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
** ***************************

13. spacer 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751796 (Campylobacter phage CJIE4-4, complete genome) position: , mismatch: 1, identity: 0.967

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
** ***************************

14. spacer 1.4|1429281|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751794 (Campylobacter phage CJIE4-2, complete genome) position: , mismatch: 2, identity: 0.933

aattttaatacactggggaaacgttgataa	CRISPR spacer
aattttaatacactggggaaacactgataa	Protospacer
**********************..******

15. spacer 1.4|1429281|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751795 (Campylobacter phage CJIE4-3, complete genome) position: , mismatch: 2, identity: 0.933

aattttaatacactggggaaacgttgataa	CRISPR spacer
aattttaatacactggggaaacactgataa	Protospacer
**********************..******

16. spacer 1.4|1429281|30|NZ_CP019965|CRISPRCasFinder,CRT matches to KF751796 (Campylobacter phage CJIE4-4, complete genome) position: , mismatch: 2, identity: 0.933

aattttaatacactggggaaacgttgataa	CRISPR spacer
aattttaatacactggggaaacactgataa	Protospacer
**********************..******

17. spacer 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 2, identity: 0.933

cttggtggtattatggcaaattctgttaat	CRISPR spacer
cttggcggaattatggcaaattctgttaat	Protospacer
*****.** *********************

18. spacer 1.6|1429413|30|NZ_CP019965|CRISPRCasFinder,CRT matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 2, identity: 0.933

atttataaatttggatatgaagctttaagt	CRISPR spacer
atttataaatttggttatgaagctttaagc	Protospacer
************** **************.

19. spacer 1.7|1429348|26|NZ_CP019965|PILER-CR matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 2, identity: 0.923

ttggtggtattatggcaaattctgtt	CRISPR spacer
ttggcggaattatggcaaattctgtt	Protospacer
****.** ******************

20. spacer 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT matches to NZ_CP022484 (Enterococcus faecalis ARO1/DG plasmid pARO1.1, complete sequence) position: , mismatch: 7, identity: 0.767

cttggtggtattatggcaaattctgttaat	CRISPR spacer
attttttctattatggaaaattctgttaaa	Protospacer
 **  *  ******** ************ 

21. spacer 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 7, identity: 0.767

cttggtggtattatggcaaattctgttaat	CRISPR spacer
attttttctattatggaaaattctgttaaa	Protospacer
 **  *  ******** ************ 

22. spacer 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT matches to NZ_CP028721 (Enterococcus faecalis strain CVM N48037F plasmid pN48037F-1, complete sequence) position: , mismatch: 7, identity: 0.767

cttggtggtattatggcaaattctgttaat	CRISPR spacer
attttttctattatggaaaattctgttaaa	Protospacer
 **  *  ******** ************ 

23. spacer 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cttggtggtattatggcaaattctgttaat	CRISPR spacer
attttttctattatggaaaattctgttaaa	Protospacer
 **  *  ******** ************ 

24. spacer 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cttggtggtattatggcaaattctgttaat	CRISPR spacer
attttttctattatggaaaattctgttaaa	Protospacer
 **  *  ******** ************ 

25. spacer 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT matches to NZ_CP042217 (Enterococcus faecalis strain L8 plasmid pL8, complete sequence) position: , mismatch: 7, identity: 0.767

cttggtggtattatggcaaattctgttaat	CRISPR spacer
attttttctattatggaaaattctgttaaa	Protospacer
 **  *  ******** ************ 

26. spacer 1.5|1429347|30|NZ_CP019965|CRISPRCasFinder,CRT matches to NZ_MK140641 (Enterococcus faecalis strain E035 plasmid pE035, complete sequence) position: , mismatch: 7, identity: 0.767

cttggtggtattatggcaaattctgttaat	CRISPR spacer
attttttctattatggaaaattctgttaaa	Protospacer
 **  *  ******** ************ 

27. spacer 1.6|1429413|30|NZ_CP019965|CRISPRCasFinder,CRT matches to MH572526 (Microviridae sp. isolate SD_HF_66, complete genome) position: , mismatch: 8, identity: 0.733

atttataaatttggatatgaagctttaagt	CRISPR spacer
attgataaaattggatatgaagcgaaagaa	Protospacer
*** ***** *************   *.. 

28. spacer 1.6|1429413|30|NZ_CP019965|CRISPRCasFinder,CRT matches to NZ_LN890332 (Leuconostoc gelidum subsp. gasicomitatum KG16-1 isolate LEKG1 plasmid II, complete sequence) position: , mismatch: 8, identity: 0.733

atttataaatttggatatgaagctttaagt	CRISPR spacer
aaagataaagttggatatgaagcttcattc	Protospacer
*   ***** ***************.*  .

29. spacer 1.1|1429083|30|NZ_CP019965|CRISPRCasFinder,CRT matches to MN693024 (Marine virus AFVG_117M49, complete genome) position: , mismatch: 9, identity: 0.7

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccttcaagtcgagcaattttaactttgcct	Protospacer
*********** **********. .  .  

30. spacer 1.3|1429215|30|NZ_CP019965|CRISPRCasFinder,CRT matches to MN693024 (Marine virus AFVG_117M49, complete genome) position: , mismatch: 9, identity: 0.7

ccttcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccttcaagtcgagcaattttaactttgcct	Protospacer
*********** **********. .  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1340471 : 1346541 7 Synechococcus_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage