Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014425 Staphylococcus aureus strain USA300-SUR17 plasmid pUSA04-1-SUR17, complete sequence 0 crisprs csa3 0 0 2 0
NZ_CP014423 Staphylococcus aureus strain USA300-SUR17 chromosome, complete genome 9 crisprs cas3,DEDDh,DinG,csa3,WYL 8 4 9 0
NZ_CP014424 Staphylococcus aureus strain USA300-SUR17 plasmid pUSA01-1-SUR17, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP014425
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11744 12 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_2 18043 : 25882 7 Staphylococcus_phage(40.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014423
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014423_1 433391-433491 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014423_2 672550-672642 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014423_3 848360-848445 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014423_4 891689-891770 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014423_5 998086-998368 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014423_6 1131758-1131845 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014423_7 2077067-2077145 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014423_8 2312130-2312280 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014423_9 2436048-2436241 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP014423_4 4.1|891713|34|NZ_CP014423|CRISPRCasFinder 891713-891746 34 NZ_CP014423.1 1424259-1424292 0 1.0
NZ_CP014423_4 4.1|891713|34|NZ_CP014423|CRISPRCasFinder 891713-891746 34 NZ_CP014423.1 1513451-1513484 0 1.0
NZ_CP014423_9 9.2|2436127|36|NZ_CP014423|CRT 2436127-2436162 36 NZ_CP014423.1 1216033-1216068 0 1.0
NZ_CP014423_3 3.1|848390|26|NZ_CP014423|CRISPRCasFinder 848390-848415 26 NZ_CP014423.1 811327-811352 1 0.962
NZ_CP014423_3 3.1|848390|26|NZ_CP014423|CRISPRCasFinder 848390-848415 26 NZ_CP014423.1 2877292-2877317 1 0.962
NZ_CP014423_3 3.1|848390|26|NZ_CP014423|CRISPRCasFinder 848390-848415 26 NZ_CP014423.1 2877348-2877373 1 0.962
NZ_CP014423_5 5.1|998116|26|NZ_CP014423|CRT 998116-998141 26 NZ_CP014423.1 998060-998085 1 0.962
NZ_CP014423_5 5.3|998230|26|NZ_CP014423|CRT 998230-998255 26 NZ_CP014423.1 848446-848471 1 0.962
NZ_CP014423_7 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder 2077090-2077122 33 NZ_CP014423.1 848426-848458 1 0.97
NZ_CP014423_7 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder 2077090-2077122 33 NZ_CP014423.1 1216089-1216121 1 0.97
NZ_CP014423_7 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder 2077090-2077122 33 NZ_CP014423.1 1424214-1424246 1 0.97
NZ_CP014423_7 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder 2077090-2077122 33 NZ_CP014423.1 1742015-1742047 1 0.97
NZ_CP014423_7 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder 2077090-2077122 33 NZ_CP014423.1 2712008-2712040 1 0.97
NZ_CP014423_9 9.2|2436127|36|NZ_CP014423|CRT 2436127-2436162 36 NZ_CP014423.1 1920467-1920502 1 0.972
NZ_CP014423_3 3.1|848390|26|NZ_CP014423|CRISPRCasFinder 848390-848415 26 NZ_CP014423.1 811383-811408 2 0.923
NZ_CP014423_3 3.1|848390|26|NZ_CP014423|CRISPRCasFinder 848390-848415 26 NZ_CP014423.1 998060-998085 2 0.923
NZ_CP014423_5 5.1|998116|26|NZ_CP014423|CRT 998116-998141 26 NZ_CP014423.1 811327-811352 2 0.923
NZ_CP014423_5 5.1|998116|26|NZ_CP014423|CRT 998116-998141 26 NZ_CP014423.1 2877292-2877317 2 0.923
NZ_CP014423_5 5.1|998116|26|NZ_CP014423|CRT 998116-998141 26 NZ_CP014423.1 2877348-2877373 2 0.923
NZ_CP014423_5 5.3|998230|26|NZ_CP014423|CRT 998230-998255 26 NZ_CP014423.1 394724-394749 2 0.923
NZ_CP014423_7 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder 2077090-2077122 33 NZ_CP014423.1 1513497-1513529 2 0.939
NZ_CP014423_9 9.1|2436071|33|NZ_CP014423|CRT 2436071-2436103 33 NZ_CP014423.1 848426-848458 2 0.939
NZ_CP014423_9 9.1|2436071|33|NZ_CP014423|CRT 2436071-2436103 33 NZ_CP014423.1 1216089-1216121 2 0.939
NZ_CP014423_9 9.1|2436071|33|NZ_CP014423|CRT 2436071-2436103 33 NZ_CP014423.1 1424214-1424246 2 0.939
NZ_CP014423_9 9.1|2436071|33|NZ_CP014423|CRT 2436071-2436103 33 NZ_CP014423.1 1513497-1513529 2 0.939
NZ_CP014423_9 9.1|2436071|33|NZ_CP014423|CRT 2436071-2436103 33 NZ_CP014423.1 2712008-2712040 2 0.939
NZ_CP014423_9 9.2|2436127|36|NZ_CP014423|CRT 2436127-2436162 36 NZ_CP014423.1 1741954-1741989 2 0.944
NZ_CP014423_9 9.2|2436127|36|NZ_CP014423|CRT 2436127-2436162 36 NZ_CP014423.1 2087834-2087869 2 0.944
NZ_CP014423_9 9.3|2436186|33|NZ_CP014423|CRT 2436186-2436218 33 NZ_CP014423.1 848426-848458 2 0.939
NZ_CP014423_9 9.3|2436186|33|NZ_CP014423|CRT 2436186-2436218 33 NZ_CP014423.1 1216089-1216121 2 0.939
NZ_CP014423_9 9.3|2436186|33|NZ_CP014423|CRT 2436186-2436218 33 NZ_CP014423.1 1424214-1424246 2 0.939
NZ_CP014423_9 9.3|2436186|33|NZ_CP014423|CRT 2436186-2436218 33 NZ_CP014423.1 2712008-2712040 2 0.939

1. spacer 4.1|891713|34|NZ_CP014423|CRISPRCasFinder matches to position: 1424259-1424292, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 4.1|891713|34|NZ_CP014423|CRISPRCasFinder matches to position: 1513451-1513484, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 9.2|2436127|36|NZ_CP014423|CRT matches to position: 1216033-1216068, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

4. spacer 3.1|848390|26|NZ_CP014423|CRISPRCasFinder matches to position: 811327-811352, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctgtgttggggccccg	Protospacer
***** ********************

5. spacer 3.1|848390|26|NZ_CP014423|CRISPRCasFinder matches to position: 2877292-2877317, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
************.*************

6. spacer 3.1|848390|26|NZ_CP014423|CRISPRCasFinder matches to position: 2877348-2877373, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctttgttggggccccg	Protospacer
************ *************

7. spacer 5.1|998116|26|NZ_CP014423|CRT matches to position: 998060-998085, mismatch: 1, identity: 0.962

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaggctggtgg	Protospacer
***********************.**

8. spacer 5.3|998230|26|NZ_CP014423|CRT matches to position: 848446-848471, mismatch: 1, identity: 0.962

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacacagaagctgacga	Protospacer
**********************.***

9. spacer 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder matches to position: 848426-848458, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

10. spacer 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder matches to position: 1216089-1216121, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

11. spacer 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder matches to position: 1424214-1424246, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

12. spacer 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder matches to position: 1742015-1742047, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattatagtaagctgacttttcgtcagcttctg	Protospacer
****** **************************

13. spacer 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder matches to position: 2712008-2712040, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

14. spacer 9.2|2436127|36|NZ_CP014423|CRT matches to position: 1920467-1920502, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

15. spacer 3.1|848390|26|NZ_CP014423|CRISPRCasFinder matches to position: 811383-811408, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctatgttggggccccg	Protospacer
***** ******.*************

16. spacer 3.1|848390|26|NZ_CP014423|CRISPRCasFinder matches to position: 998060-998085, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccaccagcctctgtgttggggccccg	Protospacer
**.*****.*****************

17. spacer 5.1|998116|26|NZ_CP014423|CRT matches to position: 811327-811352, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaagcaggcgg	Protospacer
*****************.** *****

18. spacer 5.1|998116|26|NZ_CP014423|CRT matches to position: 2877292-2877317, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacatagaagctggcgg	Protospacer
*************.***.********

19. spacer 5.1|998116|26|NZ_CP014423|CRT matches to position: 2877348-2877373, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacaaagaagctggcgg	Protospacer
************* ***.********

20. spacer 5.3|998230|26|NZ_CP014423|CRT matches to position: 394724-394749, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacaaagaagctgacga	Protospacer
************* ********.***

21. spacer 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder matches to position: 1513497-1513529, mismatch: 2, identity: 0.939

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
******.******************* ******

22. spacer 9.1|2436071|33|NZ_CP014423|CRT matches to position: 848426-848458, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

23. spacer 9.1|2436071|33|NZ_CP014423|CRT matches to position: 1216089-1216121, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

24. spacer 9.1|2436071|33|NZ_CP014423|CRT matches to position: 1424214-1424246, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

25. spacer 9.1|2436071|33|NZ_CP014423|CRT matches to position: 1513497-1513529, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

26. spacer 9.1|2436071|33|NZ_CP014423|CRT matches to position: 2712008-2712040, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

27. spacer 9.2|2436127|36|NZ_CP014423|CRT matches to position: 1741954-1741989, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

28. spacer 9.2|2436127|36|NZ_CP014423|CRT matches to position: 2087834-2087869, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

29. spacer 9.3|2436186|33|NZ_CP014423|CRT matches to position: 848426-848458, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

30. spacer 9.3|2436186|33|NZ_CP014423|CRT matches to position: 1216089-1216121, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

31. spacer 9.3|2436186|33|NZ_CP014423|CRT matches to position: 1424214-1424246, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

32. spacer 9.3|2436186|33|NZ_CP014423|CRT matches to position: 2712008-2712040, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014423_5 5.4|998286|53|NZ_CP014423|CRT 998286-998338 53 MG543995 Staphylococcus phage UPMK_1, partial genome 76246-76298 4 0.925
NZ_CP014423_3 3.1|848390|26|NZ_CP014423|CRISPRCasFinder 848390-848415 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
NZ_CP014423_3 3.1|848390|26|NZ_CP014423|CRISPRCasFinder 848390-848415 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
NZ_CP014423_3 3.1|848390|26|NZ_CP014423|CRISPRCasFinder 848390-848415 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808
NZ_CP014423_5 5.3|998230|26|NZ_CP014423|CRT 998230-998255 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
NZ_CP014423_7 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder 2077090-2077122 33 NC_021536 Synechococcus phage S-IOM18 genomic sequence 159745-159777 10 0.697

1. spacer 5.4|998286|53|NZ_CP014423|CRT matches to MG543995 (Staphylococcus phage UPMK_1, partial genome) position: , mismatch: 4, identity: 0.925

ggtgggacgacgaaataaattttgcgaaaatatcatttctgtcccactcccaa	CRISPR spacer
ggtgggacgacgaaataaattttgagaaactatcatttctgtcccactccctt	Protospacer
************************ **** *********************  

2. spacer 3.1|848390|26|NZ_CP014423|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

3. spacer 3.1|848390|26|NZ_CP014423|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtctgggcctac	Protospacer
****************. *****.  

4. spacer 3.1|848390|26|NZ_CP014423|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtttggccctga	Protospacer
***************** ** **. .

5. spacer 5.3|998230|26|NZ_CP014423|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcga	CRISPR spacer
taaggcctcaacacagaagctggcgt	Protospacer
...****.***************** 

6. spacer 7.1|2077090|33|NZ_CP014423|CRISPRCasFinder matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 10, identity: 0.697

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
ttttatcgtaaggtgagttttcgtcaagcacct	Protospacer
. ********** *** *********. . *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 780018 : 787838 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 799810 : 814541 14 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 893251 : 960237 92 Staphylococcus_phage(63.86%) head,capsid,plate,integrase,tail,terminase,holin,portal attL 901054:901073|attR 957016:957035
DBSCAN-SWA_4 1116982 : 1125455 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1567223 : 1652759 106 Staphylococcus_phage(84.21%) head,protease,capsid,plate,tail,integrase,terminase,tRNA,holin,portal attL 1603586:1603606|attR 1652764:1652784
DBSCAN-SWA_6 1713577 : 1721889 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_7 1791026 : 1800069 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_8 1925530 : 2004862 74 Staphylococcus_phage(94.83%) transposase,tRNA,protease NA
DBSCAN-SWA_9 2089930 : 2186365 117 Staphylococcus_phage(91.03%) head,protease,capsid,tail,integrase,terminase,tRNA,holin,portal attL 2151356:2151373|attR 2176287:2176304
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage