Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014393 Staphylococcus aureus strain USA300-SUR9 plasmid pUSA01-1-SUR9, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014394 Staphylococcus aureus strain USA300-SUR9 plasmid pUSA04-2-SUR9, complete sequence 0 crisprs csa3 0 0 3 0
NZ_CP014396 Staphylococcus aureus strain USA300-SUR9 plasmid pUSA06-1-SUR9, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014392 Staphylococcus aureus strain USA300-SUR9 chromosome, complete genome 10 crisprs cas3,DEDDh,DinG,csa3,WYL 8 4 9 0
NZ_CP014395 Staphylococcus aureus strain USA300-SUR9 plasmid pUSA05-1-SUR9, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP014394
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11380 12 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_2 15236 : 15734 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_3 20964 : 25297 5 Marinitoga_camini_virus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014392
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014392_1 433302-433402 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014392_2 672461-672553 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014392_3 848271-848356 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014392_4 855584-855671 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014392_5 891542-891623 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014392_6 997941-998223 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014392_7 1131612-1131699 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014392_8 2075174-2075252 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014392_9 2310237-2310387 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014392_10 2434154-2434347 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP014392_5 5.1|891566|34|NZ_CP014392|CRISPRCasFinder 891566-891599 34 NZ_CP014392.1 1424112-1424145 0 1.0
NZ_CP014392_5 5.1|891566|34|NZ_CP014392|CRISPRCasFinder 891566-891599 34 NZ_CP014392.1 1513304-1513337 0 1.0
NZ_CP014392_10 10.2|2434233|36|NZ_CP014392|CRT 2434233-2434268 36 NZ_CP014392.1 1215887-1215922 0 1.0
NZ_CP014392_3 3.1|848301|26|NZ_CP014392|CRISPRCasFinder 848301-848326 26 NZ_CP014392.1 811238-811263 1 0.962
NZ_CP014392_3 3.1|848301|26|NZ_CP014392|CRISPRCasFinder 848301-848326 26 NZ_CP014392.1 2875476-2875501 1 0.962
NZ_CP014392_3 3.1|848301|26|NZ_CP014392|CRISPRCasFinder 848301-848326 26 NZ_CP014392.1 2875532-2875557 1 0.962
NZ_CP014392_6 6.1|997971|26|NZ_CP014392|CRT 997971-997996 26 NZ_CP014392.1 997915-997940 1 0.962
NZ_CP014392_6 6.3|998085|26|NZ_CP014392|CRT 998085-998110 26 NZ_CP014392.1 848357-848382 1 0.962
NZ_CP014392_8 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder 2075197-2075229 33 NZ_CP014392.1 848337-848369 1 0.97
NZ_CP014392_8 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder 2075197-2075229 33 NZ_CP014392.1 1215943-1215975 1 0.97
NZ_CP014392_8 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder 2075197-2075229 33 NZ_CP014392.1 1424067-1424099 1 0.97
NZ_CP014392_8 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder 2075197-2075229 33 NZ_CP014392.1 1741857-1741889 1 0.97
NZ_CP014392_8 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder 2075197-2075229 33 NZ_CP014392.1 2710114-2710146 1 0.97
NZ_CP014392_10 10.2|2434233|36|NZ_CP014392|CRT 2434233-2434268 36 NZ_CP014392.1 1920308-1920343 1 0.972
NZ_CP014392_3 3.1|848301|26|NZ_CP014392|CRISPRCasFinder 848301-848326 26 NZ_CP014392.1 811294-811319 2 0.923
NZ_CP014392_3 3.1|848301|26|NZ_CP014392|CRISPRCasFinder 848301-848326 26 NZ_CP014392.1 997915-997940 2 0.923
NZ_CP014392_6 6.1|997971|26|NZ_CP014392|CRT 997971-997996 26 NZ_CP014392.1 811238-811263 2 0.923
NZ_CP014392_6 6.1|997971|26|NZ_CP014392|CRT 997971-997996 26 NZ_CP014392.1 2875476-2875501 2 0.923
NZ_CP014392_6 6.1|997971|26|NZ_CP014392|CRT 997971-997996 26 NZ_CP014392.1 2875532-2875557 2 0.923
NZ_CP014392_6 6.3|998085|26|NZ_CP014392|CRT 998085-998110 26 NZ_CP014392.1 394635-394660 2 0.923
NZ_CP014392_8 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder 2075197-2075229 33 NZ_CP014392.1 1513350-1513382 2 0.939
NZ_CP014392_10 10.1|2434177|33|NZ_CP014392|CRT 2434177-2434209 33 NZ_CP014392.1 848337-848369 2 0.939
NZ_CP014392_10 10.1|2434177|33|NZ_CP014392|CRT 2434177-2434209 33 NZ_CP014392.1 1215943-1215975 2 0.939
NZ_CP014392_10 10.1|2434177|33|NZ_CP014392|CRT 2434177-2434209 33 NZ_CP014392.1 1424067-1424099 2 0.939
NZ_CP014392_10 10.1|2434177|33|NZ_CP014392|CRT 2434177-2434209 33 NZ_CP014392.1 1513350-1513382 2 0.939
NZ_CP014392_10 10.1|2434177|33|NZ_CP014392|CRT 2434177-2434209 33 NZ_CP014392.1 2710114-2710146 2 0.939
NZ_CP014392_10 10.2|2434233|36|NZ_CP014392|CRT 2434233-2434268 36 NZ_CP014392.1 1741796-1741831 2 0.944
NZ_CP014392_10 10.2|2434233|36|NZ_CP014392|CRT 2434233-2434268 36 NZ_CP014392.1 2085941-2085976 2 0.944
NZ_CP014392_10 10.3|2434292|33|NZ_CP014392|CRT 2434292-2434324 33 NZ_CP014392.1 848337-848369 2 0.939
NZ_CP014392_10 10.3|2434292|33|NZ_CP014392|CRT 2434292-2434324 33 NZ_CP014392.1 1215943-1215975 2 0.939
NZ_CP014392_10 10.3|2434292|33|NZ_CP014392|CRT 2434292-2434324 33 NZ_CP014392.1 1424067-1424099 2 0.939
NZ_CP014392_10 10.3|2434292|33|NZ_CP014392|CRT 2434292-2434324 33 NZ_CP014392.1 2710114-2710146 2 0.939

1. spacer 5.1|891566|34|NZ_CP014392|CRISPRCasFinder matches to position: 1424112-1424145, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 5.1|891566|34|NZ_CP014392|CRISPRCasFinder matches to position: 1513304-1513337, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 10.2|2434233|36|NZ_CP014392|CRT matches to position: 1215887-1215922, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

4. spacer 3.1|848301|26|NZ_CP014392|CRISPRCasFinder matches to position: 811238-811263, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctgtgttggggccccg	Protospacer
***** ********************

5. spacer 3.1|848301|26|NZ_CP014392|CRISPRCasFinder matches to position: 2875476-2875501, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
************.*************

6. spacer 3.1|848301|26|NZ_CP014392|CRISPRCasFinder matches to position: 2875532-2875557, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctttgttggggccccg	Protospacer
************ *************

7. spacer 6.1|997971|26|NZ_CP014392|CRT matches to position: 997915-997940, mismatch: 1, identity: 0.962

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaggctggtgg	Protospacer
***********************.**

8. spacer 6.3|998085|26|NZ_CP014392|CRT matches to position: 848357-848382, mismatch: 1, identity: 0.962

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacacagaagctgacga	Protospacer
**********************.***

9. spacer 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder matches to position: 848337-848369, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

10. spacer 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder matches to position: 1215943-1215975, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

11. spacer 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder matches to position: 1424067-1424099, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

12. spacer 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder matches to position: 1741857-1741889, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattatagtaagctgacttttcgtcagcttctg	Protospacer
****** **************************

13. spacer 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder matches to position: 2710114-2710146, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

14. spacer 10.2|2434233|36|NZ_CP014392|CRT matches to position: 1920308-1920343, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

15. spacer 3.1|848301|26|NZ_CP014392|CRISPRCasFinder matches to position: 811294-811319, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctatgttggggccccg	Protospacer
***** ******.*************

16. spacer 3.1|848301|26|NZ_CP014392|CRISPRCasFinder matches to position: 997915-997940, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccaccagcctctgtgttggggccccg	Protospacer
**.*****.*****************

17. spacer 6.1|997971|26|NZ_CP014392|CRT matches to position: 811238-811263, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaagcaggcgg	Protospacer
*****************.** *****

18. spacer 6.1|997971|26|NZ_CP014392|CRT matches to position: 2875476-2875501, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacatagaagctggcgg	Protospacer
*************.***.********

19. spacer 6.1|997971|26|NZ_CP014392|CRT matches to position: 2875532-2875557, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacaaagaagctggcgg	Protospacer
************* ***.********

20. spacer 6.3|998085|26|NZ_CP014392|CRT matches to position: 394635-394660, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacaaagaagctgacga	Protospacer
************* ********.***

21. spacer 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder matches to position: 1513350-1513382, mismatch: 2, identity: 0.939

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
******.******************* ******

22. spacer 10.1|2434177|33|NZ_CP014392|CRT matches to position: 848337-848369, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

23. spacer 10.1|2434177|33|NZ_CP014392|CRT matches to position: 1215943-1215975, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

24. spacer 10.1|2434177|33|NZ_CP014392|CRT matches to position: 1424067-1424099, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

25. spacer 10.1|2434177|33|NZ_CP014392|CRT matches to position: 1513350-1513382, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

26. spacer 10.1|2434177|33|NZ_CP014392|CRT matches to position: 2710114-2710146, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

27. spacer 10.2|2434233|36|NZ_CP014392|CRT matches to position: 1741796-1741831, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

28. spacer 10.2|2434233|36|NZ_CP014392|CRT matches to position: 2085941-2085976, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

29. spacer 10.3|2434292|33|NZ_CP014392|CRT matches to position: 848337-848369, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

30. spacer 10.3|2434292|33|NZ_CP014392|CRT matches to position: 1215943-1215975, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

31. spacer 10.3|2434292|33|NZ_CP014392|CRT matches to position: 1424067-1424099, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

32. spacer 10.3|2434292|33|NZ_CP014392|CRT matches to position: 2710114-2710146, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014392_6 6.4|998141|53|NZ_CP014392|CRT 998141-998193 53 MG543995 Staphylococcus phage UPMK_1, partial genome 76246-76298 4 0.925
NZ_CP014392_3 3.1|848301|26|NZ_CP014392|CRISPRCasFinder 848301-848326 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
NZ_CP014392_3 3.1|848301|26|NZ_CP014392|CRISPRCasFinder 848301-848326 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
NZ_CP014392_3 3.1|848301|26|NZ_CP014392|CRISPRCasFinder 848301-848326 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808
NZ_CP014392_6 6.3|998085|26|NZ_CP014392|CRT 998085-998110 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
NZ_CP014392_8 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder 2075197-2075229 33 NC_021536 Synechococcus phage S-IOM18 genomic sequence 159745-159777 10 0.697

1. spacer 6.4|998141|53|NZ_CP014392|CRT matches to MG543995 (Staphylococcus phage UPMK_1, partial genome) position: , mismatch: 4, identity: 0.925

ggtgggacgacgaaataaattttgcgaaaatatcatttctgtcccactcccaa	CRISPR spacer
ggtgggacgacgaaataaattttgagaaactatcatttctgtcccactccctt	Protospacer
************************ **** *********************  

2. spacer 3.1|848301|26|NZ_CP014392|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

3. spacer 3.1|848301|26|NZ_CP014392|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtctgggcctac	Protospacer
****************. *****.  

4. spacer 3.1|848301|26|NZ_CP014392|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtttggccctga	Protospacer
***************** ** **. .

5. spacer 6.3|998085|26|NZ_CP014392|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcga	CRISPR spacer
taaggcctcaacacagaagctggcgt	Protospacer
...****.***************** 

6. spacer 8.1|2075197|33|NZ_CP014392|CRISPRCasFinder matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 10, identity: 0.697

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
ttttatcgtaaggtgagttttcgtcaagcacct	Protospacer
. ********** *** *********. . *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 779929 : 787749 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 799721 : 814452 14 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 893104 : 960092 91 Staphylococcus_phage(64.63%) holin,portal,capsid,head,terminase,plate,tail,integrase attL 900909:900928|attR 956871:956890
DBSCAN-SWA_4 1116836 : 1125309 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1572365 : 1657588 105 Staphylococcus_phage(85.14%) holin,plate,capsid,head,portal,protease,tail,terminase,tRNA,integrase attL 1603439:1603459|attR 1652606:1652626
DBSCAN-SWA_6 1713419 : 1721731 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_7 1790868 : 1799911 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_8 1925371 : 1995463 65 Staphylococcus_phage(96.08%) transposase,tRNA,protease NA
DBSCAN-SWA_9 2088037 : 2188277 120 Staphylococcus_phage(88.75%) holin,portal,capsid,head,terminase,protease,tail,tRNA,integrase attL 2149463:2149480|attR 2174394:2174411
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage