Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019415 Salmonella enterica subsp. enterica serovar Moscow str. S-1843 chromosome, complete genome 2 crisprs WYL,DinG,DEDDh,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 10 8 0

Results visualization

1. NZ_CP019415
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019415_1 2970895-2971350 TypeI-E I-E
7 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019415_2 2987503-2988019 TypeI-E I-E
8 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019415_2 2.3|2987654|32|NZ_CP019415|CRISPRCasFinder 2987654-2987685 32 MN694003 Marine virus AFVG_250M677, complete genome 17629-17660 8 0.75
NZ_CP019415_2 2.11|2987654|34|NZ_CP019415|CRT,PILER-CR 2987654-2987687 34 MN694003 Marine virus AFVG_250M677, complete genome 17627-17660 8 0.765
NZ_CP019415_1 1.1|2970924|32|NZ_CP019415|CRISPRCasFinder,CRT 2970924-2970955 32 NZ_MG266000 Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence 5501-5532 9 0.719
NZ_CP019415_1 1.3|2971046|32|NZ_CP019415|CRISPRCasFinder,CRT 2971046-2971077 32 MK449011 Streptococcus phage Javan92, complete genome 36157-36188 9 0.719
NZ_CP019415_1 1.3|2971046|32|NZ_CP019415|CRISPRCasFinder,CRT 2971046-2971077 32 MK448835 Streptococcus phage Javan93, complete genome 36157-36188 9 0.719
NZ_CP019415_1 1.3|2971046|32|NZ_CP019415|CRISPRCasFinder,CRT 2971046-2971077 32 MK448836 Streptococcus phage Javan95, complete genome 37400-37431 9 0.719
NZ_CP019415_1 1.3|2971046|32|NZ_CP019415|CRISPRCasFinder,CRT 2971046-2971077 32 MK448825 Streptococcus phage Javan639, complete genome 37400-37431 9 0.719
NZ_CP019415_1 1.6|2971229|32|NZ_CP019415|CRISPRCasFinder,CRT 2971229-2971260 32 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 41418-41449 9 0.719
NZ_CP019415_1 1.8|2970926|32|NZ_CP019415|PILER-CR 2970926-2970957 32 NZ_MG266000 Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence 5501-5532 9 0.719
NZ_CP019415_1 1.10|2971048|32|NZ_CP019415|PILER-CR 2971048-2971079 32 MK449011 Streptococcus phage Javan92, complete genome 36157-36188 9 0.719
NZ_CP019415_1 1.10|2971048|32|NZ_CP019415|PILER-CR 2971048-2971079 32 MK448835 Streptococcus phage Javan93, complete genome 36157-36188 9 0.719
NZ_CP019415_1 1.10|2971048|32|NZ_CP019415|PILER-CR 2971048-2971079 32 MK448836 Streptococcus phage Javan95, complete genome 37400-37431 9 0.719
NZ_CP019415_1 1.10|2971048|32|NZ_CP019415|PILER-CR 2971048-2971079 32 MK448825 Streptococcus phage Javan639, complete genome 37400-37431 9 0.719
NZ_CP019415_1 1.13|2971231|32|NZ_CP019415|PILER-CR 2971231-2971262 32 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 41418-41449 9 0.719
NZ_CP019415_2 2.8|2987959|32|NZ_CP019415|CRISPRCasFinder 2987959-2987990 32 CP006879 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence 405613-405644 9 0.719
NZ_CP019415_2 2.6|2987837|32|NZ_CP019415|CRISPRCasFinder 2987837-2987868 32 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 103231-103262 10 0.688
NZ_CP019415_2 2.8|2987959|32|NZ_CP019415|CRISPRCasFinder 2987959-2987990 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 699963-699994 10 0.688

1. spacer 2.3|2987654|32|NZ_CP019415|CRISPRCasFinder matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.75

cgattctacggcaacaggccaggctgcgaccg	CRISPR spacer
ggcgagcacggcaacagcccaggctgcgatcg	Protospacer
 *    .********** ***********.**

2. spacer 2.11|2987654|34|NZ_CP019415|CRT,PILER-CR matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.765

cgattctacggcaacaggccaggctgcgaccgcg	CRISPR spacer
ggcgagcacggcaacagcccaggctgcgatcgcg	Protospacer
 *    .********** ***********.****

3. spacer 1.1|2970924|32|NZ_CP019415|CRISPRCasFinder,CRT matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.719

tatttataagcgtgtcatctatgcaacccaac	CRISPR spacer
aatttataatcatgtcatctatgccataattc	Protospacer
 ******** *.************ *.    *

4. spacer 1.3|2971046|32|NZ_CP019415|CRISPRCasFinder,CRT matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

5. spacer 1.3|2971046|32|NZ_CP019415|CRISPRCasFinder,CRT matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

6. spacer 1.3|2971046|32|NZ_CP019415|CRISPRCasFinder,CRT matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

7. spacer 1.3|2971046|32|NZ_CP019415|CRISPRCasFinder,CRT matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

8. spacer 1.6|2971229|32|NZ_CP019415|CRISPRCasFinder,CRT matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.719

gagaatgctcatgcgcgtgagcgccatatatt	CRISPR spacer
cgaaatgatcatgcgcgtcagcgccattgcgt	Protospacer
 ..**** ********** ********    *

9. spacer 1.8|2970926|32|NZ_CP019415|PILER-CR matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.719

tatttataagcgtgtcatctatgcaacccaac	CRISPR spacer
aatttataatcatgtcatctatgccataattc	Protospacer
 ******** *.************ *.    *

10. spacer 1.10|2971048|32|NZ_CP019415|PILER-CR matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

11. spacer 1.10|2971048|32|NZ_CP019415|PILER-CR matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

12. spacer 1.10|2971048|32|NZ_CP019415|PILER-CR matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

13. spacer 1.10|2971048|32|NZ_CP019415|PILER-CR matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

14. spacer 1.13|2971231|32|NZ_CP019415|PILER-CR matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.719

gagaatgctcatgcgcgtgagcgccatatatt	CRISPR spacer
cgaaatgatcatgcgcgtcagcgccattgcgt	Protospacer
 ..**** ********** ********    *

15. spacer 2.8|2987959|32|NZ_CP019415|CRISPRCasFinder matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 9, identity: 0.719

gaatctggaggccaacagcgcggcgaaatcct	CRISPR spacer
gaatctggagggcgacagcgcggtcgaccctg	Protospacer
*********** *.*********. .* .*. 

16. spacer 2.6|2987837|32|NZ_CP019415|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688

atcaaacatggaaacccctttaatgagagcaa	CRISPR spacer
ctaaaacatggaaaccactgtaatgacgaatc	Protospacer
 * ************* ** ****** ..   

17. spacer 2.8|2987959|32|NZ_CP019415|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

gaatctggaggccaacagcgcggcgaaatcct	CRISPR spacer
gtggtcataggccatcagcgcggcgatatccc	Protospacer
* . ... ****** *********** ****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 934920 : 942233 7 Dickeya_phage(16.67%) integrase,protease attL 923658:923672|attR 942451:942465
DBSCAN-SWA_2 992692 : 1092554 103 Salmonella_phage(39.66%) tail,protease,terminase,portal,capsid,tRNA,holin,head,lysis NA
DBSCAN-SWA_3 1264916 : 1277527 15 Salmonella_phage(33.33%) tail,integrase,holin,lysis attL 1264752:1264781|attR 1284373:1284402
DBSCAN-SWA_4 1505451 : 1519808 17 Escherichia_phage(76.92%) tRNA NA
DBSCAN-SWA_5 1849139 : 1893686 53 Enterobacteria_phage(63.89%) integrase,tail,terminase,portal,capsid,plate,tRNA,holin,head,lysis attL 1848072:1848096|attR 1886375:1886399
DBSCAN-SWA_6 2185027 : 2195534 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_7 2262737 : 2271908 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_8 2508344 : 2514397 6 Salmonella_virus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage