Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017053 Burkholderia pseudomallei strain MSHR3763 chromosome 2, complete sequence 2 crisprs cas3,csa3,DinG 1 0 5 0
NZ_CP017052 Burkholderia pseudomallei strain MSHR3763 chromosome 1, complete sequence 2 crisprs WYL,cas3,DEDDh,csa3,DinG 0 0 273 0

Results visualization

1. NZ_CP017052
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017052_1 209038-209179 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017052_2 1494219-1494298 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 25552 23 Ralstonia_phage(100.0%) coat NA
DBSCAN-SWA_2 36378 : 39186 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_3 50587 : 56182 3 uncultured_phage(50.0%) NA NA
DBSCAN-SWA_4 91080 : 99854 12 Ralstonia_virus(42.86%) integrase attL 83022:83037|attR 94666:94681
DBSCAN-SWA_5 114059 : 125478 10 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_6 132224 : 133370 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_7 137655 : 144951 7 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_8 163602 : 164004 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_9 175669 : 177586 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_10 183253 : 184654 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_11 193979 : 195008 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_12 211941 : 218447 2 Virus_Rctr197k(50.0%) NA NA
DBSCAN-SWA_13 229745 : 230525 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_14 265123 : 266398 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_15 296301 : 296892 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_16 322728 : 336617 16 Micromonas_sp._RCC1109_virus(40.0%) NA NA
DBSCAN-SWA_17 340556 : 344487 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_18 351207 : 357138 4 Hokovirus(50.0%) NA NA
DBSCAN-SWA_19 371257 : 383374 19 Pseudomonas_phage(28.57%) portal,terminase,integrase,capsid attL 365049:365067|attR 378658:378676
DBSCAN-SWA_20 387489 : 388878 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_21 401033 : 401798 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_22 408440 : 418214 5 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_23 422255 : 427859 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_24 443217 : 444171 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_25 449335 : 451234 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_26 457555 : 462587 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_27 469618 : 476130 3 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_28 491489 : 500813 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_29 511739 : 512342 1 Ochrobactrum_phage(100.0%) NA NA
DBSCAN-SWA_30 515811 : 517152 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_31 521096 : 521822 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_32 526468 : 535572 9 Bacillus_virus(25.0%) NA NA
DBSCAN-SWA_33 547151 : 548615 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_34 562103 : 562673 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_35 566046 : 568224 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_36 579942 : 580566 1 Vibrio_virus(100.0%) NA NA
DBSCAN-SWA_37 590207 : 594172 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_38 603258 : 611517 7 Mycoplasma_phage(33.33%) transposase NA
DBSCAN-SWA_39 628307 : 632606 5 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_40 647094 : 654106 6 Prochlorococcus_phage(25.0%) tRNA NA
DBSCAN-SWA_41 657433 : 668390 10 Agrobacterium_phage(16.67%) protease NA
DBSCAN-SWA_42 671822 : 672668 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_43 687215 : 689373 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_44 698160 : 699090 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_45 702517 : 715875 13 Catovirus(16.67%) tRNA NA
DBSCAN-SWA_46 739982 : 741854 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_47 750309 : 754079 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_48 757330 : 764105 4 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_49 768553 : 771819 3 uncultured_Mediterranean_phage(50.0%) protease NA
DBSCAN-SWA_50 777036 : 780794 4 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_51 798767 : 799481 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_52 803788 : 807386 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_53 825102 : 826911 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_54 856373 : 857738 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_55 864068 : 870617 5 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_56 879030 : 880488 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_57 884232 : 885012 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_58 889388 : 890105 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_59 894209 : 895742 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_60 898832 : 899555 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_61 904928 : 905993 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_62 927350 : 929222 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_63 941064 : 946626 5 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_64 956199 : 957024 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_65 967449 : 968913 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_66 990519 : 992112 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_67 1001685 : 1005765 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_68 1032863 : 1034022 1 Burkholderia_virus(100.0%) transposase NA
DBSCAN-SWA_69 1037851 : 1053276 14 Burkholderia_virus(14.29%) NA NA
DBSCAN-SWA_70 1057386 : 1058280 1 Thermobifida_phage(100.0%) NA NA
DBSCAN-SWA_71 1064909 : 1069522 6 uncultured_Mediterranean_phage(66.67%) tRNA NA
DBSCAN-SWA_72 1084050 : 1087219 4 uncultured_Caudovirales_phage(33.33%) transposase NA
DBSCAN-SWA_73 1092257 : 1099936 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_74 1104998 : 1106765 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_75 1112931 : 1114500 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_76 1120440 : 1124486 4 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_77 1128115 : 1141079 10 Streptomyces_phage(25.0%) transposase NA
DBSCAN-SWA_78 1148266 : 1149874 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_79 1155038 : 1157605 4 Red_sea_bream_iridovirus(50.0%) NA NA
DBSCAN-SWA_80 1161851 : 1163624 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_81 1198944 : 1200156 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_82 1204940 : 1205783 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_83 1212897 : 1213383 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_84 1222198 : 1223278 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_85 1234902 : 1236549 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_86 1242061 : 1242739 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_87 1246641 : 1247826 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_88 1285678 : 1286614 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_89 1296827 : 1299898 2 Burkholderia_virus(50.0%) transposase NA
DBSCAN-SWA_90 1307104 : 1311917 3 Escherichia_phage(33.33%) tRNA NA
DBSCAN-SWA_91 1322364 : 1332557 8 uncultured_virus(33.33%) transposase NA
DBSCAN-SWA_92 1348859 : 1350167 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_93 1366721 : 1371707 4 Sinorhizobium_phage(50.0%) NA NA
DBSCAN-SWA_94 1379733 : 1381739 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_95 1385931 : 1387224 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_96 1409705 : 1411349 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_97 1423494 : 1491749 62 Streptococcus_phage(11.11%) portal,protease,transposase,tRNA NA
DBSCAN-SWA_98 1496062 : 1501334 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_99 1510188 : 1514071 6 Aeromonas_phage(50.0%) integrase attL 1504366:1504382|attR 1523873:1523889
DBSCAN-SWA_100 1518239 : 1525177 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_101 1545652 : 1548205 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_102 1554425 : 1556252 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_103 1559371 : 1564475 2 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_104 1569395 : 1570193 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_105 1598598 : 1601124 4 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_106 1619540 : 1622505 2 Catovirus(50.0%) holin NA
DBSCAN-SWA_107 1631014 : 1638133 6 Cedratvirus(25.0%) tRNA NA
DBSCAN-SWA_108 1647351 : 1650760 2 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_109 1662445 : 1663993 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_110 1671594 : 1674096 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_111 1693275 : 1696203 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_112 1703273 : 1718423 13 Burkholderia_virus(20.0%) integrase attL 1700686:1700703|attR 1717272:1717289
DBSCAN-SWA_113 1732206 : 1733355 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_114 1752473 : 1754489 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_115 1757589 : 1757985 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_116 1769094 : 1770516 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_117 1782595 : 1785129 4 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_118 1790234 : 1794601 6 Leptospira_phage(50.0%) integrase,transposase NA
DBSCAN-SWA_119 1799364 : 1802124 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_120 1806122 : 1808440 2 Gordonia_phage(50.0%) integrase attL 1794117:1794130|attR 1813105:1813118
DBSCAN-SWA_121 1823275 : 1824496 1 Burkholderia_phage(100.0%) transposase NA
DBSCAN-SWA_122 1827582 : 1828269 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_123 1853141 : 1854332 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_124 1858321 : 1874742 8 Cafeteria_roenbergensis_virus(16.67%) transposase NA
DBSCAN-SWA_125 1915862 : 1917750 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_126 1934484 : 1935303 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_127 1938982 : 1939909 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_128 1944536 : 1945607 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_129 1951879 : 1954201 2 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_130 1958741 : 1985309 30 Burkholderia_phage(44.44%) integrase,tail,protease,plate attL 1959320:1959366|attR 1974797:1974843
DBSCAN-SWA_131 1988324 : 1990994 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_132 2002132 : 2004394 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_133 2007917 : 2010074 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_134 2021581 : 2021785 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_135 2027211 : 2035658 8 Pseudomonas_phage(33.33%) tRNA NA
DBSCAN-SWA_136 2042064 : 2043528 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_137 2051443 : 2056920 6 Acinetobacter_phage(60.0%) NA NA
DBSCAN-SWA_138 2073808 : 2077697 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_139 2097986 : 2098493 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_140 2113774 : 2114872 1 Burkholderia_phage(100.0%) integrase attL 2108312:2108327|attR 2115326:2115341
DBSCAN-SWA_141 2130868 : 2135192 5 Indivirus(50.0%) NA NA
DBSCAN-SWA_142 2139468 : 2140020 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_143 2143863 : 2148430 3 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_144 2169542 : 2173077 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_145 2177367 : 2177868 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_146 2184537 : 2184954 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_147 2192361 : 2193297 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_148 2201749 : 2207479 4 Staphylococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_149 2214473 : 2215862 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_150 2223102 : 2227671 5 uncultured_virus(50.0%) transposase NA
DBSCAN-SWA_151 2236381 : 2236750 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_152 2245673 : 2250041 4 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_153 2276971 : 2281967 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_154 2286292 : 2287252 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_155 2290394 : 2290883 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_156 2299192 : 2303071 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_157 2311179 : 2320394 8 Pandoravirus(25.0%) protease,transposase NA
DBSCAN-SWA_158 2335053 : 2350853 13 Hokovirus(12.5%) tRNA NA
DBSCAN-SWA_159 2354071 : 2355499 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_160 2362823 : 2363480 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_161 2370074 : 2374265 5 Synechococcus_phage(60.0%) NA NA
DBSCAN-SWA_162 2405479 : 2409050 4 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_163 2417586 : 2418834 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_164 2440966 : 2441971 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_165 2449050 : 2458329 7 Acinetobacter_phage(75.0%) NA NA
DBSCAN-SWA_166 2470857 : 2472300 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_167 2484998 : 2486006 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_168 2490374 : 2492356 2 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_169 2497213 : 2498245 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_170 2501841 : 2514387 11 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_171 2520708 : 2521731 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_172 2525257 : 2526676 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_173 2536187 : 2537748 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_174 2551427 : 2554640 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_175 2565432 : 2567170 2 Orpheovirus(50.0%) NA NA
DBSCAN-SWA_176 2570586 : 2578974 9 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_177 2583782 : 2585252 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_178 2589000 : 2599544 9 Bacillus_virus(40.0%) tRNA NA
DBSCAN-SWA_179 2611005 : 2611215 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_180 2615614 : 2618998 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_181 2622646 : 2624141 2 Lake_Baikal_phage(50.0%) NA NA
DBSCAN-SWA_182 2633327 : 2634344 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_183 2647062 : 2648085 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_184 2653057 : 2656622 2 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_185 2669954 : 2674508 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_186 2680698 : 2693038 13 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_187 2712363 : 2712969 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_188 2716111 : 2718206 2 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_189 2724055 : 2725027 1 Yersinia_phage(100.0%) NA NA
DBSCAN-SWA_190 2738038 : 2742605 3 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_191 2761379 : 2846095 90 Burkholderia_virus(27.78%) head,protease,tail,integrase,holin,terminase,portal attL 2773403:2773420|attR 2796193:2796210
DBSCAN-SWA_192 2858980 : 2859775 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_193 2879259 : 2880501 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_194 2886206 : 2888129 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_195 2897432 : 2899184 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_196 2907352 : 2908846 1 Bandra_megavirus(100.0%) NA NA
DBSCAN-SWA_197 2914968 : 2916492 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_198 2938565 : 2943787 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_199 2957834 : 2959388 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_200 2968210 : 2971897 3 Indivirus(50.0%) NA NA
DBSCAN-SWA_201 2980408 : 2982178 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_202 2991144 : 3089103 112 uncultured_Caudovirales_phage(21.28%) plate,head,capsid,protease,tail,integrase,tRNA,terminase,portal attL 3005494:3005512|attR 3063675:3063693
DBSCAN-SWA_203 3096446 : 3099593 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_204 3103819 : 3105658 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_205 3108731 : 3117755 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_206 3122256 : 3127427 5 Yellowstone_lake_phycodnavirus(33.33%) NA NA
DBSCAN-SWA_207 3130675 : 3131740 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_208 3148444 : 3152020 4 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_209 3164845 : 3169886 5 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) tRNA NA
DBSCAN-SWA_210 3176756 : 3179322 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_211 3192425 : 3195031 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_212 3204404 : 3205187 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_213 3215295 : 3215940 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_214 3222065 : 3226678 4 Hokovirus(50.0%) NA NA
DBSCAN-SWA_215 3232265 : 3236133 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_216 3240832 : 3241357 1 Pandoravirus(100.0%) tRNA NA
DBSCAN-SWA_217 3276514 : 3277240 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_218 3282255 : 3290361 11 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_219 3299381 : 3304080 3 Agrobacterium_phage(33.33%) protease NA
DBSCAN-SWA_220 3311553 : 3312270 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_221 3317545 : 3326055 7 Burkholderia_phage(66.67%) NA NA
DBSCAN-SWA_222 3330188 : 3330827 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_223 3335635 : 3341130 6 Acanthamoeba_polyphaga_lentillevirus(33.33%) NA NA
DBSCAN-SWA_224 3346284 : 3347463 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_225 3355769 : 3357545 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_226 3363935 : 3370586 5 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_227 3374375 : 3375383 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_228 3388361 : 3390959 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_229 3402253 : 3416636 16 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_230 3430801 : 3434931 4 Powai_lake_megavirus(50.0%) NA NA
DBSCAN-SWA_231 3438763 : 3441022 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_232 3459415 : 3460111 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_233 3463188 : 3464781 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_234 3473054 : 3475117 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_235 3487103 : 3490274 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_236 3500371 : 3501349 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_237 3524862 : 3525777 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_238 3530946 : 3534470 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_239 3562064 : 3565313 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_240 3570258 : 3575307 5 Burkholderia_virus(66.67%) transposase NA
DBSCAN-SWA_241 3582180 : 3583272 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_242 3602908 : 3605209 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_243 3612788 : 3613640 1 Freshwater_phage(100.0%) NA NA
DBSCAN-SWA_244 3621666 : 3623236 2 Leptospira_phage(50.0%) transposase NA
DBSCAN-SWA_245 3632966 : 3653591 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_246 3666752 : 3667763 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_247 3676439 : 3678182 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_248 3683213 : 3687436 5 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_249 3714070 : 3715444 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_250 3735118 : 3752575 4 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_251 3757955 : 3758846 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_252 3766676 : 3768197 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_253 3773630 : 3775391 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_254 3783807 : 3790741 4 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_255 3806316 : 3827086 14 Bacillus_virus(28.57%) NA NA
DBSCAN-SWA_256 3830496 : 3834348 5 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_257 3844210 : 3848504 6 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_258 3852924 : 3853263 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_259 3862984 : 3870019 5 Rhizobium_phage(33.33%) NA NA
DBSCAN-SWA_260 3880345 : 3882118 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_261 3906417 : 3907848 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_262 3912577 : 3915632 2 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_263 3924547 : 3927475 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_264 3931532 : 3934211 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_265 3942675 : 3943860 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_266 3947063 : 3954486 7 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_267 3973786 : 3974896 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_268 3982432 : 3983404 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_269 3990306 : 4001142 6 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_270 4013258 : 4014059 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_271 4019905 : 4022991 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_272 4028149 : 4029697 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_273 4033347 : 4041128 5 Klosneuvirus(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP017053
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017053_1 1615888-1616050 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017053_2 1809835-1809920 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP017053_1 1.2|1616003|21|NZ_CP017053|CRISPRCasFinder 1616003-1616023 21 NZ_CP017053.1 1616035-1616055 0 1.0
NZ_CP017053_1 1.2|1616003|21|NZ_CP017053|CRISPRCasFinder 1616003-1616023 21 NZ_CP017053.1 1616043-1616063 0 1.0

1. spacer 1.2|1616003|21|NZ_CP017053|CRISPRCasFinder matches to position: 1616035-1616055, mismatch: 0, identity: 1.0

gacagcacgacagcacgacag	CRISPR spacer
gacagcacgacagcacgacag	Protospacer
*********************

2. spacer 1.2|1616003|21|NZ_CP017053|CRISPRCasFinder matches to position: 1616043-1616063, mismatch: 0, identity: 1.0

gacagcacgacagcacgacag	CRISPR spacer
gacagcacgacagcacgacag	Protospacer
*********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 66498 : 73286 8 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_2 1017732 : 1108501 53 Leptospira_phage(25.0%) transposase NA
DBSCAN-SWA_3 1509861 : 1581168 46 Planktothrix_phage(18.18%) integrase,transposase,plate attL 1504489:1504508|attR 1584767:1584786
DBSCAN-SWA_4 2479077 : 2488403 13 Burkholderia_virus(66.67%) integrase,transposase attL 2474007:2474023|attR 2500210:2500226
DBSCAN-SWA_5 2641087 : 2712602 55 Vibrio_phage(25.0%) holin,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage