Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019298 Vibrio campbellii strain LMB29 plasmid pLMB96, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP019293 Vibrio campbellii strain LMB29 chromosome 1, complete sequence 0 crisprs DEDDh,DinG,cas3,csx1,csa3 0 0 3 0
NZ_CP019297 Vibrio campbellii strain LMB29 plasmid pLMB99, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP019294 Vibrio campbellii strain LMB29 chromosome 2, complete sequence 1 crisprs cas3,csa3,DEDDh,RT,WYL 0 6 1 0
NZ_CP019296 Vibrio campbellii strain LMB29 plasmid pLMB143, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP019295 Vibrio campbellii strain LMB29 plasmid pLMB157, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP019293
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 520570 : 538047 15 uncultured_Mediterranean_phage(18.18%) tRNA NA
DBSCAN-SWA_2 2818726 : 2825417 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_3 2900098 : 2907165 9 Megavirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP019294
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019294_1 671074-671939 Orphan NA
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019294_1 1.13|671792|29|NZ_CP019294|PILER-CR 671792-671820 29 KY499642 Vibrio phage pVa-21, complete genome 85570-85598 7 0.759
NZ_CP019294_1 1.5|671415|34|NZ_CP019294|CRT 671415-671448 34 NZ_CP028352 Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence 88501-88534 9 0.735
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 AP019525 Tenacibaculum phage PTm5 DNA, complete genome 145123-145156 9 0.735
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 AP019524 Tenacibaculum phage PTm1 DNA, complete genome 145012-145045 9 0.735
NZ_CP019294_1 1.4|671340|34|NZ_CP019294|CRT 671340-671373 34 NZ_CP007650 Lactobacillus salivarius strain JCM1046 plasmid pCTN1046, complete sequence 22538-22571 10 0.706
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 NZ_CP009683 Francisella tularensis subsp. novicida strain AZ06-7470 plasmid pFNE_1, complete sequence 4764-4797 10 0.706
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 MK250021 Prevotella phage Lak-B2, complete genome 419424-419457 10 0.706
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 MK250024 Prevotella phage Lak-B5, complete genome 411747-411780 10 0.706
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 MK250028 Prevotella phage Lak-B9, complete genome 416167-416200 10 0.706
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 MK250023 Prevotella phage Lak-B4, complete genome 418635-418668 10 0.706
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 MK250025 Prevotella phage Lak-B6, complete genome 414829-414862 10 0.706
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 MK250022 Prevotella phage Lak-B3, complete genome 414920-414953 10 0.706
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 MK250027 Prevotella phage Lak-B8, complete genome 418894-418927 10 0.706
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 MK250026 Prevotella phage Lak-B7, complete genome 417930-417963 10 0.706
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 MK250020 Prevotella phage Lak-B1, complete genome 416150-416183 10 0.706
NZ_CP019294_1 1.8|671640|34|NZ_CP019294|CRT 671640-671673 34 MN693326 Marine virus AFVG_25M108, complete genome 2693-2726 10 0.706
NZ_CP019294_1 1.2|671190|34|NZ_CP019294|CRT 671190-671223 34 KT962247 Cellulophaga phage phi17:2_18, complete genome 46187-46220 11 0.676
NZ_CP019294_1 1.2|671190|34|NZ_CP019294|CRT 671190-671223 34 KT962246 Cellulophaga phage phi4:1_18, complete genome 45788-45821 11 0.676
NZ_CP019294_1 1.2|671190|34|NZ_CP019294|CRT 671190-671223 34 KT962245 Cellulophaga phage phi4:1_13, complete genome 45788-45821 11 0.676
NZ_CP019294_1 1.2|671190|34|NZ_CP019294|CRT 671190-671223 34 KC821632 Cellulophaga phage phi4:1, complete genome 45788-45821 11 0.676
NZ_CP019294_1 1.2|671190|34|NZ_CP019294|CRT 671190-671223 34 NC_021798 Cellulophaga phage phi17:2, complete genome 46187-46220 11 0.676
NZ_CP019294_1 1.10|671790|34|NZ_CP019294|CRT 671790-671823 34 KY499642 Vibrio phage pVa-21, complete genome 85568-85601 11 0.676

1. spacer 1.13|671792|29|NZ_CP019294|PILER-CR matches to KY499642 (Vibrio phage pVa-21, complete genome) position: , mismatch: 7, identity: 0.759

agatgaattctatgttttatcacgcaggt	CRISPR spacer
agataaattctatgtattatcacatggag	Protospacer
****.********** *******...*. 

2. spacer 1.5|671415|34|NZ_CP019294|CRT matches to NZ_CP028352 (Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence) position: , mismatch: 9, identity: 0.735

ggatatggagggaatgtttgcgggaaccgaagcc	CRISPR spacer
gccgattgagggcatgtttgcgggaaccggggtt	Protospacer
*   ** ***** ****************..*..

3. spacer 1.8|671640|34|NZ_CP019294|CRT matches to AP019525 (Tenacibaculum phage PTm5 DNA, complete genome) position: , mismatch: 9, identity: 0.735

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
ctccttggaaaatatgtttgttaatgcagaacca	Protospacer
     *************** *******.** * 

4. spacer 1.8|671640|34|NZ_CP019294|CRT matches to AP019524 (Tenacibaculum phage PTm1 DNA, complete genome) position: , mismatch: 9, identity: 0.735

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
ctccttggaaaatatgtttgttaatgcagaacca	Protospacer
     *************** *******.** * 

5. spacer 1.4|671340|34|NZ_CP019294|CRT matches to NZ_CP007650 (Lactobacillus salivarius strain JCM1046 plasmid pCTN1046, complete sequence) position: , mismatch: 10, identity: 0.706

gtcaatgtataaaatgttttctgg----cgcaaaagcc	CRISPR spacer
atcaatgtatacaatgatttctggctttcgtagg----	Protospacer
.********** **** *******    **.*..    

6. spacer 1.8|671640|34|NZ_CP019294|CRT matches to NZ_CP009683 (Francisella tularensis subsp. novicida strain AZ06-7470 plasmid pFNE_1, complete sequence) position: , mismatch: 10, identity: 0.706

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
acttcctgaaaatatgtttgatagtgcaaaagtt	Protospacer
.    . ****************.********..

7. spacer 1.8|671640|34|NZ_CP019294|CRT matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 10, identity: 0.706

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
taatgaagaaaatatgtttgttaaagcaaaagaa	Protospacer
 *. . .************* *** *******  

8. spacer 1.8|671640|34|NZ_CP019294|CRT matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 10, identity: 0.706

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
taatgaagaaaatatgtttgttaaagcaaaagaa	Protospacer
 *. . .************* *** *******  

9. spacer 1.8|671640|34|NZ_CP019294|CRT matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 10, identity: 0.706

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
taatgaagaaaatatgtttgttaaagcaaaagaa	Protospacer
 *. . .************* *** *******  

10. spacer 1.8|671640|34|NZ_CP019294|CRT matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 10, identity: 0.706

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
taatgaagaaaatatgtttgttaaagcaaaagaa	Protospacer
 *. . .************* *** *******  

11. spacer 1.8|671640|34|NZ_CP019294|CRT matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 10, identity: 0.706

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
taatgaagaaaatatgtttgttaaagcaaaagaa	Protospacer
 *. . .************* *** *******  

12. spacer 1.8|671640|34|NZ_CP019294|CRT matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 10, identity: 0.706

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
taatgaagaaaatatgtttgttaaagcaaaagaa	Protospacer
 *. . .************* *** *******  

13. spacer 1.8|671640|34|NZ_CP019294|CRT matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 10, identity: 0.706

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
taatgaagaaaatatgtttgttaaagcaaaagaa	Protospacer
 *. . .************* *** *******  

14. spacer 1.8|671640|34|NZ_CP019294|CRT matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 10, identity: 0.706

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
taatgaagaaaatatgtttgttaaagcaaaagaa	Protospacer
 *. . .************* *** *******  

15. spacer 1.8|671640|34|NZ_CP019294|CRT matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 10, identity: 0.706

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
taatgaagaaaatatgtttgttaaagcaaaagaa	Protospacer
 *. . .************* *** *******  

16. spacer 1.8|671640|34|NZ_CP019294|CRT matches to MN693326 (Marine virus AFVG_25M108, complete genome) position: , mismatch: 10, identity: 0.706

gagaatggaaaatatgtttgataatgcaaaagcc	CRISPR spacer
tattaacgaaaataaatttgataatgcaaaaagg	Protospacer
 *  *  ******* .***************.  

17. spacer 1.2|671190|34|NZ_CP019294|CRT matches to KT962247 (Cellulophaga phage phi17:2_18, complete genome) position: , mismatch: 11, identity: 0.676

gttaatgtctgacatgtttgaatatgctcaagct	CRISPR spacer
tctaatgtatgacatgtatgaatatgaagagaag	Protospacer
 .****** ******** ********   *..  

18. spacer 1.2|671190|34|NZ_CP019294|CRT matches to KT962246 (Cellulophaga phage phi4:1_18, complete genome) position: , mismatch: 11, identity: 0.676

gttaatgtctgacatgtttgaatatgctcaagct	CRISPR spacer
tctaatgtatgacatgtatgaatatgaagagaag	Protospacer
 .****** ******** ********   *..  

19. spacer 1.2|671190|34|NZ_CP019294|CRT matches to KT962245 (Cellulophaga phage phi4:1_13, complete genome) position: , mismatch: 11, identity: 0.676

gttaatgtctgacatgtttgaatatgctcaagct	CRISPR spacer
tctaatgtatgacatgtatgaatatgaagagaag	Protospacer
 .****** ******** ********   *..  

20. spacer 1.2|671190|34|NZ_CP019294|CRT matches to KC821632 (Cellulophaga phage phi4:1, complete genome) position: , mismatch: 11, identity: 0.676

gttaatgtctgacatgtttgaatatgctcaagct	CRISPR spacer
tctaatgtatgacatgtatgaatatgaagagaag	Protospacer
 .****** ******** ********   *..  

21. spacer 1.2|671190|34|NZ_CP019294|CRT matches to NC_021798 (Cellulophaga phage phi17:2, complete genome) position: , mismatch: 11, identity: 0.676

gttaatgtctgacatgtttgaatatgctcaagct	CRISPR spacer
tctaatgtatgacatgtatgaatatgaagagaag	Protospacer
 .****** ******** ********   *..  

22. spacer 1.10|671790|34|NZ_CP019294|CRT matches to KY499642 (Vibrio phage pVa-21, complete genome) position: , mismatch: 11, identity: 0.676

gaagatgaattctatgttttatcacgcaggtgcc	CRISPR spacer
aaagataaattctatgtattatcacatggagata	Protospacer
.*****.********** *******...*. .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1086800 : 1099747 16 Vibrio_phage(100.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage