Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018935 Bacillus cereus strain JEM-2 chromosome, complete genome 6 crisprs DinG,cas14k,cas14j,c2c9_V-U4,WYL,csa3,cas3,DEDDh 19 6 6 0
NZ_CP018936 Bacillus cereus strain JEM-2 plasmid unnamed1, complete sequence 0 crisprs csa3,RT 0 0 1 0

Results visualization

1. NZ_CP018935
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018935_1 505015-505270 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018935_2 2432060-2432824 TypeV-U4,TypeI-A? NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018935_3 2478029-2478136 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018935_4 3405760-3406163 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018935_5 4138363-4138560 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018935_6 4862768-4862997 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP018935.1 2431601-2431636 0 1.0
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP018935.1 2432933-2432968 0 1.0
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP018935.1 2433203-2433238 0 1.0
NZ_CP018935_2 2.2|2432132|18|NZ_CP018935|CRT 2432132-2432149 18 NZ_CP018935.1 2430287-2430304 0 1.0
NZ_CP018935_2 2.2|2432132|18|NZ_CP018935|CRT 2432132-2432149 18 NZ_CP018935.1 2430566-2430583 0 1.0
NZ_CP018935_2 2.2|2432132|18|NZ_CP018935|CRT 2432132-2432149 18 NZ_CP018935.1 2430881-2430898 0 1.0
NZ_CP018935_2 2.2|2432132|18|NZ_CP018935|CRT 2432132-2432149 18 NZ_CP018935.1 2431061-2431078 0 1.0
NZ_CP018935_2 2.2|2432132|18|NZ_CP018935|CRT 2432132-2432149 18 NZ_CP018935.1 2431214-2431231 0 1.0
NZ_CP018935_2 2.2|2432132|18|NZ_CP018935|CRT 2432132-2432149 18 NZ_CP018935.1 2431304-2431321 0 1.0
NZ_CP018935_2 2.2|2432132|18|NZ_CP018935|CRT 2432132-2432149 18 NZ_CP018935.1 2431466-2431483 0 1.0
NZ_CP018935_2 2.2|2432132|18|NZ_CP018935|CRT 2432132-2432149 18 NZ_CP018935.1 2431673-2431690 0 1.0
NZ_CP018935_2 2.2|2432132|18|NZ_CP018935|CRT 2432132-2432149 18 NZ_CP018935.1 2433005-2433022 0 1.0
NZ_CP018935_2 2.2|2432132|18|NZ_CP018935|CRT 2432132-2432149 18 NZ_CP018935.1 2433293-2433310 0 1.0
NZ_CP018935_2 2.2|2432132|18|NZ_CP018935|CRT 2432132-2432149 18 NZ_CP018935.1 2433599-2433616 0 1.0
NZ_CP018935_2 2.6|2432357|45|NZ_CP018935|CRT 2432357-2432401 45 NZ_CP018935.1 2431835-2431879 0 1.0
NZ_CP018935_2 2.8|2432474|18|NZ_CP018935|CRT 2432474-2432491 18 NZ_CP018935.1 2430269-2430286 0 1.0
NZ_CP018935_2 2.8|2432474|18|NZ_CP018935|CRT 2432474-2432491 18 NZ_CP018935.1 2430629-2430646 0 1.0
NZ_CP018935_2 2.8|2432474|18|NZ_CP018935|CRT 2432474-2432491 18 NZ_CP018935.1 2431862-2431879 0 1.0
NZ_CP018935_2 2.8|2432474|18|NZ_CP018935|CRT 2432474-2432491 18 NZ_CP018935.1 2433275-2433292 0 1.0
NZ_CP018935_2 2.8|2432474|18|NZ_CP018935|CRT 2432474-2432491 18 NZ_CP018935.1 2433617-2433634 0 1.0
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP018935.1 2432015-2432041 0 1.0
NZ_CP018935_2 2.11|2432591|18|NZ_CP018935|CRT 2432591-2432608 18 NZ_CP018935.1 2430530-2430547 0 1.0
NZ_CP018935_2 2.11|2432591|18|NZ_CP018935|CRT 2432591-2432608 18 NZ_CP018935.1 2433437-2433454 0 1.0
NZ_CP018935_4 4.1|3405786|19|NZ_CP018935|CRT 3405786-3405804 19 NZ_CP018935.1 3404598-3404616 0 1.0
NZ_CP018935_4 4.1|3405786|19|NZ_CP018935|CRT 3405786-3405804 19 NZ_CP018935.1 3405435-3405453 0 1.0
NZ_CP018935_4 4.1|3405786|19|NZ_CP018935|CRT 3405786-3405804 19 NZ_CP018935.1 3405570-3405588 0 1.0
NZ_CP018935_4 4.1|3405786|19|NZ_CP018935|CRT 3405786-3405804 19 NZ_CP018935.1 3406164-3406182 0 1.0
NZ_CP018935_4 4.2|3405831|19|NZ_CP018935|CRT 3405831-3405849 19 NZ_CP018935.1 3406290-3406308 0 1.0
NZ_CP018935_4 4.2|3405831|19|NZ_CP018935|CRT 3405831-3405849 19 NZ_CP018935.1 3406326-3406344 0 1.0
NZ_CP018935_4 4.4|3405930|19|NZ_CP018935|CRT 3405930-3405948 19 NZ_CP018935.1 3404598-3404616 0 1.0
NZ_CP018935_4 4.4|3405930|19|NZ_CP018935|CRT 3405930-3405948 19 NZ_CP018935.1 3405435-3405453 0 1.0
NZ_CP018935_4 4.4|3405930|19|NZ_CP018935|CRT 3405930-3405948 19 NZ_CP018935.1 3405570-3405588 0 1.0
NZ_CP018935_4 4.4|3405930|19|NZ_CP018935|CRT 3405930-3405948 19 NZ_CP018935.1 3406164-3406182 0 1.0
NZ_CP018935_4 4.6|3406029|19|NZ_CP018935|CRT 3406029-3406047 19 NZ_CP018935.1 3404598-3404616 0 1.0
NZ_CP018935_4 4.6|3406029|19|NZ_CP018935|CRT 3406029-3406047 19 NZ_CP018935.1 3405435-3405453 0 1.0
NZ_CP018935_4 4.6|3406029|19|NZ_CP018935|CRT 3406029-3406047 19 NZ_CP018935.1 3405570-3405588 0 1.0
NZ_CP018935_4 4.6|3406029|19|NZ_CP018935|CRT 3406029-3406047 19 NZ_CP018935.1 3406164-3406182 0 1.0
NZ_CP018935_4 4.7|3406074|19|NZ_CP018935|CRT 3406074-3406092 19 NZ_CP018935.1 3404733-3404751 0 1.0
NZ_CP018935_4 4.7|3406074|19|NZ_CP018935|CRT 3406074-3406092 19 NZ_CP018935.1 3405390-3405408 0 1.0
NZ_CP018935_4 4.7|3406074|19|NZ_CP018935|CRT 3406074-3406092 19 NZ_CP018935.1 3405615-3405633 0 1.0
NZ_CP018935_4 4.7|3406074|19|NZ_CP018935|CRT 3406074-3406092 19 NZ_CP018935.1 3406245-3406263 0 1.0
NZ_CP018935_4 4.7|3406074|19|NZ_CP018935|CRT 3406074-3406092 19 NZ_CP018935.1 3406362-3406380 0 1.0
NZ_CP018935_4 4.7|3406074|19|NZ_CP018935|CRT 3406074-3406092 19 NZ_CP018935.1 3406407-3406425 0 1.0
NZ_CP018935_4 4.7|3406074|19|NZ_CP018935|CRT 3406074-3406092 19 NZ_CP018935.1 3406452-3406470 0 1.0
NZ_CP018935_4 4.8|3406119|19|NZ_CP018935|CRT 3406119-3406137 19 NZ_CP018935.1 3404598-3404616 0 1.0
NZ_CP018935_4 4.8|3406119|19|NZ_CP018935|CRT 3406119-3406137 19 NZ_CP018935.1 3405435-3405453 0 1.0
NZ_CP018935_4 4.8|3406119|19|NZ_CP018935|CRT 3406119-3406137 19 NZ_CP018935.1 3405570-3405588 0 1.0
NZ_CP018935_4 4.8|3406119|19|NZ_CP018935|CRT 3406119-3406137 19 NZ_CP018935.1 3406164-3406182 0 1.0
NZ_CP018935_2 2.8|2432474|18|NZ_CP018935|CRT 2432474-2432491 18 NZ_CP018935.1 2430863-2430880 1 0.944
NZ_CP018935_2 2.8|2432474|18|NZ_CP018935|CRT 2432474-2432491 18 NZ_CP018935.1 2431655-2431672 1 0.944
NZ_CP018935_2 2.8|2432474|18|NZ_CP018935|CRT 2432474-2432491 18 NZ_CP018935.1 2432024-2432041 1 0.944
NZ_CP018935_2 2.8|2432474|18|NZ_CP018935|CRT 2432474-2432491 18 NZ_CP018935.1 2432879-2432896 1 0.944
NZ_CP018935_2 2.8|2432474|18|NZ_CP018935|CRT 2432474-2432491 18 NZ_CP018935.1 2432987-2433004 1 0.944
NZ_CP018935_2 2.8|2432474|18|NZ_CP018935|CRT 2432474-2432491 18 NZ_CP018935.1 2433581-2433598 1 0.944
NZ_CP018935_2 2.12|2432627|36|NZ_CP018935|CRT 2432627-2432662 36 NZ_CP018935.1 2431502-2431537 1 0.972
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2430287-2430304 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2430566-2430583 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2430665-2430682 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2430881-2430898 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2431061-2431078 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2431214-2431231 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2431304-2431321 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2431466-2431483 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2431673-2431690 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2431835-2431852 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2431952-2431969 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2433005-2433022 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2433293-2433310 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2433383-2433400 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2433599-2433616 1 0.944
NZ_CP018935_2 2.13|2432681|18|NZ_CP018935|CRT 2432681-2432698 18 NZ_CP018935.1 2433761-2433778 1 0.944
NZ_CP018935_2 2.14|2432717|18|NZ_CP018935|CRT 2432717-2432734 18 NZ_CP018935.1 2431835-2431852 1 0.944
NZ_CP018935_2 2.15|2432753|18|NZ_CP018935|CRT 2432753-2432770 18 NZ_CP018935.1 2430593-2430610 1 0.944
NZ_CP018935_2 2.15|2432753|18|NZ_CP018935|CRT 2432753-2432770 18 NZ_CP018935.1 2430827-2430844 1 0.944
NZ_CP018935_2 2.15|2432753|18|NZ_CP018935|CRT 2432753-2432770 18 NZ_CP018935.1 2431340-2431357 1 0.944
NZ_CP018935_2 2.15|2432753|18|NZ_CP018935|CRT 2432753-2432770 18 NZ_CP018935.1 2431745-2431762 1 0.944
NZ_CP018935_2 2.15|2432753|18|NZ_CP018935|CRT 2432753-2432770 18 NZ_CP018935.1 2431799-2431816 1 0.944
NZ_CP018935_2 2.15|2432753|18|NZ_CP018935|CRT 2432753-2432770 18 NZ_CP018935.1 2431916-2431933 1 0.944
NZ_CP018935_2 2.15|2432753|18|NZ_CP018935|CRT 2432753-2432770 18 NZ_CP018935.1 2433077-2433094 1 0.944
NZ_CP018935_4 4.2|3405831|19|NZ_CP018935|CRT 3405831-3405849 19 NZ_CP018935.1 285621-285639 1 0.947
NZ_CP018935_4 4.2|3405831|19|NZ_CP018935|CRT 3405831-3405849 19 NZ_CP018935.1 285666-285684 1 0.947
NZ_CP018935_4 4.2|3405831|19|NZ_CP018935|CRT 3405831-3405849 19 NZ_CP018935.1 285936-285954 1 0.947
NZ_CP018935_4 4.2|3405831|19|NZ_CP018935|CRT 3405831-3405849 19 NZ_CP018935.1 285981-285999 1 0.947
NZ_CP018935_4 4.2|3405831|19|NZ_CP018935|CRT 3405831-3405849 19 NZ_CP018935.1 3404382-3404400 1 0.947
NZ_CP018935_4 4.2|3405831|19|NZ_CP018935|CRT 3405831-3405849 19 NZ_CP018935.1 3404913-3404931 1 0.947
NZ_CP018935_4 4.2|3405831|19|NZ_CP018935|CRT 3405831-3405849 19 NZ_CP018935.1 3405480-3405498 1 0.947
NZ_CP018935_4 4.2|3405831|19|NZ_CP018935|CRT 3405831-3405849 19 NZ_CP018935.1 3405705-3405723 1 0.947
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP018935.1 3405228-3405255 1 0.964
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP018935.1 3405228-3405255 1 0.964
NZ_CP018935_4 4.7|3406074|19|NZ_CP018935|CRT 3406074-3406092 19 NZ_CP018935.1 3405660-3405678 1 0.947
NZ_CP018935_4 4.7|3406074|19|NZ_CP018935|CRT 3406074-3406092 19 NZ_CP018935.1 3406497-3406515 1 0.947
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP018935.1 2430458-2430493 2 0.944
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP018935.1 2431709-2431744 2 0.944
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP018935.1 2433041-2433076 2 0.944
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP018935.1 2433149-2433184 2 0.944
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP018935.1 2433491-2433526 2 0.944
NZ_CP018935_2 2.7|2432420|36|NZ_CP018935|CRT 2432420-2432455 36 NZ_CP018935.1 2431898-2431933 2 0.944
NZ_CP018935_2 2.12|2432627|36|NZ_CP018935|CRT 2432627-2432662 36 NZ_CP018935.1 2430476-2430511 2 0.944
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP018935.1 3406200-3406227 2 0.929
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP018935.1 3406200-3406227 2 0.929
NZ_CP018935_4 4.7|3406074|19|NZ_CP018935|CRT 3406074-3406092 19 NZ_CP018935.1 3404823-3404841 2 0.895

1. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to position: 2431601-2431636, mismatch: 0, identity: 1.0

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagaaacgggaggaacaggaagcactgggg	Protospacer
************************************

2. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to position: 2432933-2432968, mismatch: 0, identity: 1.0

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagaaacgggaggaacaggaagcactgggg	Protospacer
************************************

3. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to position: 2433203-2433238, mismatch: 0, identity: 1.0

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagaaacgggaggaacaggaagcactgggg	Protospacer
************************************

4. spacer 2.2|2432132|18|NZ_CP018935|CRT matches to position: 2430287-2430304, mismatch: 0, identity: 1.0

caacgggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
******************

5. spacer 2.2|2432132|18|NZ_CP018935|CRT matches to position: 2430566-2430583, mismatch: 0, identity: 1.0

caacgggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
******************

6. spacer 2.2|2432132|18|NZ_CP018935|CRT matches to position: 2430881-2430898, mismatch: 0, identity: 1.0

caacgggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
******************

7. spacer 2.2|2432132|18|NZ_CP018935|CRT matches to position: 2431061-2431078, mismatch: 0, identity: 1.0

caacgggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
******************

8. spacer 2.2|2432132|18|NZ_CP018935|CRT matches to position: 2431214-2431231, mismatch: 0, identity: 1.0

caacgggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
******************

9. spacer 2.2|2432132|18|NZ_CP018935|CRT matches to position: 2431304-2431321, mismatch: 0, identity: 1.0

caacgggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
******************

10. spacer 2.2|2432132|18|NZ_CP018935|CRT matches to position: 2431466-2431483, mismatch: 0, identity: 1.0

caacgggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
******************

11. spacer 2.2|2432132|18|NZ_CP018935|CRT matches to position: 2431673-2431690, mismatch: 0, identity: 1.0

caacgggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
******************

12. spacer 2.2|2432132|18|NZ_CP018935|CRT matches to position: 2433005-2433022, mismatch: 0, identity: 1.0

caacgggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
******************

13. spacer 2.2|2432132|18|NZ_CP018935|CRT matches to position: 2433293-2433310, mismatch: 0, identity: 1.0

caacgggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
******************

14. spacer 2.2|2432132|18|NZ_CP018935|CRT matches to position: 2433599-2433616, mismatch: 0, identity: 1.0

caacgggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
******************

15. spacer 2.6|2432357|45|NZ_CP018935|CRT matches to position: 2431835-2431879, mismatch: 0, identity: 1.0

caacaggaagcacgggagtaacaggagcaaccggagaaacaggtc	CRISPR spacer
caacaggaagcacgggagtaacaggagcaaccggagaaacaggtc	Protospacer
*********************************************

16. spacer 2.8|2432474|18|NZ_CP018935|CRT matches to position: 2430269-2430286, mismatch: 0, identity: 1.0

caaccggagaaacaggtc	CRISPR spacer
caaccggagaaacaggtc	Protospacer
******************

17. spacer 2.8|2432474|18|NZ_CP018935|CRT matches to position: 2430629-2430646, mismatch: 0, identity: 1.0

caaccggagaaacaggtc	CRISPR spacer
caaccggagaaacaggtc	Protospacer
******************

18. spacer 2.8|2432474|18|NZ_CP018935|CRT matches to position: 2431862-2431879, mismatch: 0, identity: 1.0

caaccggagaaacaggtc	CRISPR spacer
caaccggagaaacaggtc	Protospacer
******************

19. spacer 2.8|2432474|18|NZ_CP018935|CRT matches to position: 2433275-2433292, mismatch: 0, identity: 1.0

caaccggagaaacaggtc	CRISPR spacer
caaccggagaaacaggtc	Protospacer
******************

20. spacer 2.8|2432474|18|NZ_CP018935|CRT matches to position: 2433617-2433634, mismatch: 0, identity: 1.0

caaccggagaaacaggtc	CRISPR spacer
caaccggagaaacaggtc	Protospacer
******************

21. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to position: 2432015-2432041, mismatch: 0, identity: 1.0

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagaaacaggtc	Protospacer
***************************

22. spacer 2.11|2432591|18|NZ_CP018935|CRT matches to position: 2430530-2430547, mismatch: 0, identity: 1.0

tgacaggaagtacgggtc	CRISPR spacer
tgacaggaagtacgggtc	Protospacer
******************

23. spacer 2.11|2432591|18|NZ_CP018935|CRT matches to position: 2433437-2433454, mismatch: 0, identity: 1.0

tgacaggaagtacgggtc	CRISPR spacer
tgacaggaagtacgggtc	Protospacer
******************

24. spacer 4.1|3405786|19|NZ_CP018935|CRT matches to position: 3404598-3404616, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

25. spacer 4.1|3405786|19|NZ_CP018935|CRT matches to position: 3405435-3405453, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

26. spacer 4.1|3405786|19|NZ_CP018935|CRT matches to position: 3405570-3405588, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

27. spacer 4.1|3405786|19|NZ_CP018935|CRT matches to position: 3406164-3406182, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

28. spacer 4.2|3405831|19|NZ_CP018935|CRT matches to position: 3406290-3406308, mismatch: 0, identity: 1.0

accctgaggtccagtagcg	CRISPR spacer
accctgaggtccagtagcg	Protospacer
*******************

29. spacer 4.2|3405831|19|NZ_CP018935|CRT matches to position: 3406326-3406344, mismatch: 0, identity: 1.0

accctgaggtccagtagcg	CRISPR spacer
accctgaggtccagtagcg	Protospacer
*******************

30. spacer 4.4|3405930|19|NZ_CP018935|CRT matches to position: 3404598-3404616, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

31. spacer 4.4|3405930|19|NZ_CP018935|CRT matches to position: 3405435-3405453, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

32. spacer 4.4|3405930|19|NZ_CP018935|CRT matches to position: 3405570-3405588, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

33. spacer 4.4|3405930|19|NZ_CP018935|CRT matches to position: 3406164-3406182, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

34. spacer 4.6|3406029|19|NZ_CP018935|CRT matches to position: 3404598-3404616, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

35. spacer 4.6|3406029|19|NZ_CP018935|CRT matches to position: 3405435-3405453, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

36. spacer 4.6|3406029|19|NZ_CP018935|CRT matches to position: 3405570-3405588, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

37. spacer 4.6|3406029|19|NZ_CP018935|CRT matches to position: 3406164-3406182, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

38. spacer 4.7|3406074|19|NZ_CP018935|CRT matches to position: 3404733-3404751, mismatch: 0, identity: 1.0

gccttgaggtccagtggca	CRISPR spacer
gccttgaggtccagtggca	Protospacer
*******************

39. spacer 4.7|3406074|19|NZ_CP018935|CRT matches to position: 3405390-3405408, mismatch: 0, identity: 1.0

gccttgaggtccagtggca	CRISPR spacer
gccttgaggtccagtggca	Protospacer
*******************

40. spacer 4.7|3406074|19|NZ_CP018935|CRT matches to position: 3405615-3405633, mismatch: 0, identity: 1.0

gccttgaggtccagtggca	CRISPR spacer
gccttgaggtccagtggca	Protospacer
*******************

41. spacer 4.7|3406074|19|NZ_CP018935|CRT matches to position: 3406245-3406263, mismatch: 0, identity: 1.0

gccttgaggtccagtggca	CRISPR spacer
gccttgaggtccagtggca	Protospacer
*******************

42. spacer 4.7|3406074|19|NZ_CP018935|CRT matches to position: 3406362-3406380, mismatch: 0, identity: 1.0

gccttgaggtccagtggca	CRISPR spacer
gccttgaggtccagtggca	Protospacer
*******************

43. spacer 4.7|3406074|19|NZ_CP018935|CRT matches to position: 3406407-3406425, mismatch: 0, identity: 1.0

gccttgaggtccagtggca	CRISPR spacer
gccttgaggtccagtggca	Protospacer
*******************

44. spacer 4.7|3406074|19|NZ_CP018935|CRT matches to position: 3406452-3406470, mismatch: 0, identity: 1.0

gccttgaggtccagtggca	CRISPR spacer
gccttgaggtccagtggca	Protospacer
*******************

45. spacer 4.8|3406119|19|NZ_CP018935|CRT matches to position: 3404598-3404616, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

46. spacer 4.8|3406119|19|NZ_CP018935|CRT matches to position: 3405435-3405453, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

47. spacer 4.8|3406119|19|NZ_CP018935|CRT matches to position: 3405570-3405588, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

48. spacer 4.8|3406119|19|NZ_CP018935|CRT matches to position: 3406164-3406182, mismatch: 0, identity: 1.0

gccttgaggtccagtagcg	CRISPR spacer
gccttgaggtccagtagcg	Protospacer
*******************

49. spacer 2.8|2432474|18|NZ_CP018935|CRT matches to position: 2430863-2430880, mismatch: 1, identity: 0.944

caaccggagaaacaggtc	CRISPR spacer
caacgggagaaacaggtc	Protospacer
**** *************

50. spacer 2.8|2432474|18|NZ_CP018935|CRT matches to position: 2431655-2431672, mismatch: 1, identity: 0.944

caaccggagaaacaggtc	CRISPR spacer
caacaggagaaacaggtc	Protospacer
**** *************

51. spacer 2.8|2432474|18|NZ_CP018935|CRT matches to position: 2432024-2432041, mismatch: 1, identity: 0.944

caaccggagaaacaggtc	CRISPR spacer
caacaggagaaacaggtc	Protospacer
**** *************

52. spacer 2.8|2432474|18|NZ_CP018935|CRT matches to position: 2432879-2432896, mismatch: 1, identity: 0.944

caaccggagaaacaggtc	CRISPR spacer
caacaggagaaacaggtc	Protospacer
**** *************

53. spacer 2.8|2432474|18|NZ_CP018935|CRT matches to position: 2432987-2433004, mismatch: 1, identity: 0.944

caaccggagaaacaggtc	CRISPR spacer
caacaggagaaacaggtc	Protospacer
**** *************

54. spacer 2.8|2432474|18|NZ_CP018935|CRT matches to position: 2433581-2433598, mismatch: 1, identity: 0.944

caaccggagaaacaggtc	CRISPR spacer
caacaggagaaacaggtc	Protospacer
**** *************

55. spacer 2.12|2432627|36|NZ_CP018935|CRT matches to position: 2431502-2431537, mismatch: 1, identity: 0.972

taacaggaagtactggggtaacaggaagtacgggtc	CRISPR spacer
taacaggaaatactggggtaacaggaagtacgggtc	Protospacer
*********.**************************

56. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2430287-2430304, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
****.*************

57. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2430566-2430583, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
****.*************

58. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2430665-2430682, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacaggaaatacgggag	Protospacer
*********.********

59. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2430881-2430898, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
****.*************

60. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2431061-2431078, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
****.*************

61. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2431214-2431231, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
****.*************

62. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2431304-2431321, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
****.*************

63. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2431466-2431483, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
****.*************

64. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2431673-2431690, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
****.*************

65. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2431835-2431852, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacaggaagcacgggag	Protospacer
**********.*******

66. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2431952-2431969, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacaggaaatacgggag	Protospacer
*********.********

67. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2433005-2433022, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
****.*************

68. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2433293-2433310, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
****.*************

69. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2433383-2433400, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacaggaaatacgggag	Protospacer
*********.********

70. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2433599-2433616, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacgggaagtacgggag	Protospacer
****.*************

71. spacer 2.13|2432681|18|NZ_CP018935|CRT matches to position: 2433761-2433778, mismatch: 1, identity: 0.944

caacaggaagtacgggag	CRISPR spacer
caacaggaaatacgggag	Protospacer
*********.********

72. spacer 2.14|2432717|18|NZ_CP018935|CRT matches to position: 2431835-2431852, mismatch: 1, identity: 0.944

caacaggaagcatgggag	CRISPR spacer
caacaggaagcacgggag	Protospacer
************.*****

73. spacer 2.15|2432753|18|NZ_CP018935|CRT matches to position: 2430593-2430610, mismatch: 1, identity: 0.944

caaccggaagcaccgggg	CRISPR spacer
caacaggaagcaccgggg	Protospacer
**** *************

74. spacer 2.15|2432753|18|NZ_CP018935|CRT matches to position: 2430827-2430844, mismatch: 1, identity: 0.944

caaccggaagcaccgggg	CRISPR spacer
caacgggaagcaccgggg	Protospacer
**** *************

75. spacer 2.15|2432753|18|NZ_CP018935|CRT matches to position: 2431340-2431357, mismatch: 1, identity: 0.944

caaccggaagcaccgggg	CRISPR spacer
caacaggaagcaccgggg	Protospacer
**** *************

76. spacer 2.15|2432753|18|NZ_CP018935|CRT matches to position: 2431745-2431762, mismatch: 1, identity: 0.944

caaccggaagcaccgggg	CRISPR spacer
caacaggaagcaccgggg	Protospacer
**** *************

77. spacer 2.15|2432753|18|NZ_CP018935|CRT matches to position: 2431799-2431816, mismatch: 1, identity: 0.944

caaccggaagcaccgggg	CRISPR spacer
caacaggaagcaccgggg	Protospacer
**** *************

78. spacer 2.15|2432753|18|NZ_CP018935|CRT matches to position: 2431916-2431933, mismatch: 1, identity: 0.944

caaccggaagcaccgggg	CRISPR spacer
caacaggaagcaccgggg	Protospacer
**** *************

79. spacer 2.15|2432753|18|NZ_CP018935|CRT matches to position: 2433077-2433094, mismatch: 1, identity: 0.944

caaccggaagcaccgggg	CRISPR spacer
caacaggaagcaccgggg	Protospacer
**** *************

80. spacer 4.2|3405831|19|NZ_CP018935|CRT matches to position: 285621-285639, mismatch: 1, identity: 0.947

accctgaggtccagtagcg	CRISPR spacer
accttgaggtccagtagcg	Protospacer
***.***************

81. spacer 4.2|3405831|19|NZ_CP018935|CRT matches to position: 285666-285684, mismatch: 1, identity: 0.947

accctgaggtccagtagcg	CRISPR spacer
accttgaggtccagtagcg	Protospacer
***.***************

82. spacer 4.2|3405831|19|NZ_CP018935|CRT matches to position: 285936-285954, mismatch: 1, identity: 0.947

accctgaggtccagtagcg	CRISPR spacer
accttgaggtccagtagcg	Protospacer
***.***************

83. spacer 4.2|3405831|19|NZ_CP018935|CRT matches to position: 285981-285999, mismatch: 1, identity: 0.947

accctgaggtccagtagcg	CRISPR spacer
accttgaggtccagtagcg	Protospacer
***.***************

84. spacer 4.2|3405831|19|NZ_CP018935|CRT matches to position: 3404382-3404400, mismatch: 1, identity: 0.947

accctgaggtccagtagcg	CRISPR spacer
accttgaggtccagtagcg	Protospacer
***.***************

85. spacer 4.2|3405831|19|NZ_CP018935|CRT matches to position: 3404913-3404931, mismatch: 1, identity: 0.947

accctgaggtccagtagcg	CRISPR spacer
accttgaggtccagtagcg	Protospacer
***.***************

86. spacer 4.2|3405831|19|NZ_CP018935|CRT matches to position: 3405480-3405498, mismatch: 1, identity: 0.947

accctgaggtccagtagcg	CRISPR spacer
accttgaggtccagtagcg	Protospacer
***.***************

87. spacer 4.2|3405831|19|NZ_CP018935|CRT matches to position: 3405705-3405723, mismatch: 1, identity: 0.947

accctgaggtccagtagcg	CRISPR spacer
accttgaggtccagtagcg	Protospacer
***.***************

88. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to position: 3405228-3405255, mismatch: 1, identity: 0.964

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggtccagtagcaccagtagca	Protospacer
********************* ******

89. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to position: 3405228-3405255, mismatch: 1, identity: 0.964

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggtccagtagcaccagtagca	Protospacer
********************* ******

90. spacer 4.7|3406074|19|NZ_CP018935|CRT matches to position: 3405660-3405678, mismatch: 1, identity: 0.947

gccttgaggtccagtggca	CRISPR spacer
gccttgaggtccagtagca	Protospacer
***************.***

91. spacer 4.7|3406074|19|NZ_CP018935|CRT matches to position: 3406497-3406515, mismatch: 1, identity: 0.947

gccttgaggtccagtggca	CRISPR spacer
gccttgaggtccagtgaca	Protospacer
****************.**

92. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to position: 2430458-2430493, mismatch: 2, identity: 0.944

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagaaacgggagtaacaggaagtactgggg	Protospacer
****************** *********.*******

93. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to position: 2431709-2431744, mismatch: 2, identity: 0.944

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagaaacgggaggaacaggaagtacagggg	Protospacer
****************************.** ****

94. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to position: 2433041-2433076, mismatch: 2, identity: 0.944

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagaaacgggagtaacaggaagtactgggg	Protospacer
****************** *********.*******

95. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to position: 2433149-2433184, mismatch: 2, identity: 0.944

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caataggagaaacgggaggaacaggaagtactgggg	Protospacer
***.************************.*******

96. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to position: 2433491-2433526, mismatch: 2, identity: 0.944

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagaaacgggagcaacaggaagtactgggg	Protospacer
****************** *********.*******

97. spacer 2.7|2432420|36|NZ_CP018935|CRT matches to position: 2431898-2431933, mismatch: 2, identity: 0.944

caaccggagaaacgggtccaaccggaagcaccgggg	CRISPR spacer
caacaggagaaacgggtccaacaggaagcaccgggg	Protospacer
**** ***************** *************

98. spacer 2.12|2432627|36|NZ_CP018935|CRT matches to position: 2430476-2430511, mismatch: 2, identity: 0.944

taacaggaagtactggggtaacaggaagtacgggtc	CRISPR spacer
taacaggaagtactggggtaacaggaaacacgggtc	Protospacer
***************************..*******

99. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to position: 3406200-3406227, mismatch: 2, identity: 0.929

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggtccagtggcaccagtagca	Protospacer
***************.***** ******

100. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to position: 3406200-3406227, mismatch: 2, identity: 0.929

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggtccagtggcaccagtagca	Protospacer
***************.***** ******

101. spacer 4.7|3406074|19|NZ_CP018935|CRT matches to position: 3404823-3404841, mismatch: 2, identity: 0.895

gccttgaggtccagtggca	CRISPR spacer
gccttgaggtccggtagca	Protospacer
************.**.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 131075-131101 2 0.926
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68871-68897 2 0.926
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68934-68960 2 0.926
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 131084-131110 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321784-321810 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321820-321846 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 327-353 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 363-389 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68781-68807 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68790-68816 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68799-68825 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68808-68834 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68817-68843 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68826-68852 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68835-68861 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68844-68870 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68853-68879 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68862-68888 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 73983-74009 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 90221-90247 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 90230-90256 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 90239-90265 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 90248-90274 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 90257-90283 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 90266-90292 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 90275-90301 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130583-130609 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130592-130618 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130601-130627 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130610-130636 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130637-130663 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130664-130690 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130673-130699 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130682-130708 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130691-130717 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130700-130726 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130709-130735 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130718-130744 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130727-130753 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68970-68996 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 MN693798 Marine virus AFVG_250M119, complete genome 11468-11494 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 472792-472818 3 0.889
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 132554-132580 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321739-321765 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321748-321774 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321847-321873 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321883-321909 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321892-321918 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321919-321945 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 102-128 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 129-155 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 138-164 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 174-200 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 201-227 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 228-254 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 237-263 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 273-299 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 300-326 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 399-425 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 408-434 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68916-68942 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68925-68951 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 73974-74000 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130574-130600 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130736-130762 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130745-130771 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130754-130780 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130763-130789 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130772-130798 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_006869 Bacillus mycoides pSin9.7 plasmid 8650-8676 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 KF437907 Phormidium phage MIS-PhV1A, complete genome 8754-8780 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP053689 Arthrobacter citreus strain NEB 577 plasmid unnamed1, complete sequence 173150-173176 4 0.852
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 MT820023 Cryophage ML09, complete genome 21058-21084 4 0.852
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 MN163280 Klebsiella phage KpGranit, complete genome 83363-83390 4 0.857
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 MN163280 Klebsiella phage KpGranit, complete genome 84566-84593 4 0.857
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83705-83732 4 0.857
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88210-88237 4 0.857
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2039-2066 4 0.857
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 MN163280 Klebsiella phage KpGranit, complete genome 83363-83390 4 0.857
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 MN163280 Klebsiella phage KpGranit, complete genome 84566-84593 4 0.857
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83705-83732 4 0.857
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88210-88237 4 0.857
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2039-2066 4 0.857
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321793-321819 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321829-321855 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321856-321882 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321901-321927 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321928-321954 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 120-146 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 165-191 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 192-218 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 219-245 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 264-290 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 291-317 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 318-344 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 354-380 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 93-119 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 71346-71372 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 73911-73937 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130628-130654 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130655-130681 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68772-68798 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68907-68933 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 MN693798 Marine virus AFVG_250M119, complete genome 11477-11503 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP038597 Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.2, complete sequence 12820-12846 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP038592 Salmonella enterica subsp. enterica serovar Senftenberg strain SA20061017 plasmid pSA20061017, complete sequence 11906-11932 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP038594 Salmonella enterica subsp. enterica serovar Senftenberg strain SA20130280 plasmid pSA20130280.1, complete sequence 11906-11932 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP038602 Salmonella enterica subsp. enterica serovar Senftenberg strain 11-5006 plasmid p11-5006.1, complete sequence 10982-11008 5 0.815
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 MN694697 Marine virus AFVG_250M792, complete genome 19466-19492 5 0.815
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 AP013669 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS *** 3978-4005 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 AP013411 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43 29500-29527 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 MT380195 Klebsiella phage KP_LZD_B01, complete genome 76457-76484 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 80962-80989 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 GU323708 Lactobacillus phage phiPYB5, complete genome 19360-19387 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 MN693189 Marine virus AFVG_25M326, complete genome 18912-18939 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1994-2021 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 MN694491 Marine virus AFVG_250M564, complete genome 18777-18804 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KR296684 UNVERIFIED: Salmonella phage 19, complete genome 10709-10736 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NC_029072 Salmonella phage 19, complete genome 10709-10736 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KR296695 UNVERIFIED: Salmonella phage 41, complete genome 10717-10744 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 JX181824 Salmonella phage SSE-121, complete genome 15287-15314 5 0.821
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 GU070616 Salmonella phage PVP-SE1, complete genome 52021-52048 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 AP013669 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS *** 3978-4005 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 AP013411 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43 29500-29527 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 MT380195 Klebsiella phage KP_LZD_B01, complete genome 76457-76484 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 80962-80989 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 GU323708 Lactobacillus phage phiPYB5, complete genome 19360-19387 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 MN693189 Marine virus AFVG_25M326, complete genome 18912-18939 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1994-2021 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 MN694491 Marine virus AFVG_250M564, complete genome 18777-18804 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KR296684 UNVERIFIED: Salmonella phage 19, complete genome 10709-10736 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NC_029072 Salmonella phage 19, complete genome 10709-10736 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KR296695 UNVERIFIED: Salmonella phage 41, complete genome 10717-10744 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 JX181824 Salmonella phage SSE-121, complete genome 15287-15314 5 0.821
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 GU070616 Salmonella phage PVP-SE1, complete genome 52021-52048 5 0.821
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 71511-71537 6 0.778
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 71556-71582 6 0.778
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 90212-90238 6 0.778
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 NZ_CP039272 Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.2, complete sequence 4265-4291 6 0.778
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 MG945688 UNVERIFIED: Microviridae sp. isolate 1348-1711, complete genome 5353-5379 6 0.778
NZ_CP018935_2 2.10|2432546|27|NZ_CP018935|CRT 2432546-2432572 27 AP014420 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S43-C167, *** SEQUENCING IN PROGRESS ***, 5 ordered pieces 10318-10344 6 0.778
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 172880-172907 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 8862-8889 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 9627-9654 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 9915-9942 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 9978-10005 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 10185-10212 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 10770-10797 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 10941-10968 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 21041-21068 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 21806-21833 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 22094-22121 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 22157-22184 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 22364-22391 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 22949-22976 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 23120-23147 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NC_011771 Bacillus cereus AH820 plasmid pAH820_10, complete sequence 10617-10644 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NC_011771 Bacillus cereus AH820 plasmid pAH820_10, complete sequence 10761-10788 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KT997873 Uncultured Mediterranean phage uvDeep-CGR2-KM21-C368, complete genome 19917-19944 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 MN693099 Marine virus AFVG_25M184, complete genome 13869-13896 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 MN694808 Marine virus AFVG_250M14, complete genome 26246-26273 6 0.786
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 MN693618 Marine virus AFVG_250M106, complete genome 26276-26303 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 172880-172907 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 8862-8889 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 9627-9654 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 9915-9942 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 9978-10005 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 10185-10212 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 10770-10797 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 10941-10968 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 21041-21068 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 21806-21833 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 22094-22121 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 22157-22184 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 22364-22391 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 22949-22976 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 23120-23147 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NC_011771 Bacillus cereus AH820 plasmid pAH820_10, complete sequence 10617-10644 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NC_011771 Bacillus cereus AH820 plasmid pAH820_10, complete sequence 10761-10788 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KT997873 Uncultured Mediterranean phage uvDeep-CGR2-KM21-C368, complete genome 19917-19944 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 MN693099 Marine virus AFVG_25M184, complete genome 13869-13896 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 MN694808 Marine virus AFVG_250M14, complete genome 26246-26273 6 0.786
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 MN693618 Marine virus AFVG_250M106, complete genome 26276-26303 6 0.786
NZ_CP018935_6 6.1|4862788|34|NZ_CP018935|CRT 4862788-4862821 34 NC_049442 Arthrobacter phage KBurrousTX, complete genome 41124-41157 6 0.824
NZ_CP018935_6 6.2|4862842|28|NZ_CP018935|CRT 4862842-4862869 28 NZ_CP014361 Methylomonas sp. DH-1 plasmid, complete sequence 191451-191478 6 0.786
NZ_CP018935_6 6.2|4862842|28|NZ_CP018935|CRT 4862842-4862869 28 NC_018680 Alteromonas macleodii str. 'Balearic Sea AD45' plasmid pAMBAS45, complete sequence 28734-28761 6 0.786
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321829-321864 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321856-321891 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321874-321909 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321901-321936 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 111-146 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 138-173 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 156-191 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 183-218 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 210-245 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 237-272 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 255-290 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 282-317 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 309-344 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68916-68951 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 73974-74009 7 0.806
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130745-130780 7 0.806
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019095 Synechococcus phage ACG-2014f isolate Syn7803US34, complete genome 212626-212653 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019086 Synechococcus phage ACG-2014f isolate Syn7803US17, complete genome 217266-217293 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019106 Synechococcus phage ACG-2014f isolate Syn7803US50, complete genome 213838-213865 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019107 Synechococcus phage ACG-2014f isolate Syn7803US52, complete genome 208692-208719 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019143 Synechococcus phage ACG-2014f isolate Syn7803C12, complete genome 214343-214370 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019103 Synechococcus phage ACG-2014f isolate Syn7803US44, complete genome 208940-208967 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019102 Synechococcus phage ACG-2014f isolate Syn7803US43, complete genome 215794-215821 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019066 Synechococcus phage ACG-2014f isolate Syn7803C9, complete genome 206786-206813 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019142 Synechococcus phage ACG-2014f isolate Syn7803C11, complete genome 213638-213665 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019149 Synechococcus phage ACG-2014f isolate Syn7803C21, complete genome 213342-213369 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019105 Synechococcus phage ACG-2014f isolate Syn7803US4, complete genome 205948-205975 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019098 Synechococcus phage ACG-2014f isolate Syn7803US39, complete genome 213786-213813 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019159 Synechococcus phage ACG-2014f isolate Syn7803C34, complete genome 215952-215979 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019123 Synechococcus phage ACG-2014f isolate Syn7803US7, complete genome 210939-210966 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019111 Synechococcus phage ACG-2014f isolate Syn7803US57, complete genome 212941-212968 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019148 Synechococcus phage ACG-2014f isolate Syn7803C19, complete genome 205546-205573 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NC_047712 Synechococcus phage ACG-2014f isolate Syn7803C7, complete genome 206545-206572 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019090 Synechococcus phage ACG-2014f isolate Syn7803US24, complete genome 215951-215978 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019146 Synechococcus phage ACG-2014f isolate Syn7803C16, complete genome 216437-216464 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019152 Synechococcus phage ACG-2014f isolate Syn7803C25, complete genome 211816-211843 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019093 Synechococcus phage ACG-2014f isolate Syn7803US30, complete genome 212525-212552 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019151 Synechococcus phage ACG-2014f isolate Syn7803C24, complete genome 215332-215359 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019150 Synechococcus phage ACG-2014f isolate Syn7803C22, complete genome 217555-217582 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 NC_026927 Synechococcus phage ACG-2014f isolate Syn7803C90, complete genome 218057-218084 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019097 Synechococcus phage ACG-2014f isolate Syn7803US37, complete genome 211660-211687 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019045 Synechococcus phage ACG-2014f isolate Syn7803C6, complete genome 216575-216602 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019037 Synechococcus phage ACG-2014f isolate Syn7803C58, complete genome 216078-216105 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019099 Synechococcus phage ACG-2014f isolate Syn7803US3, complete genome 209171-209198 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019155 Synechococcus phage ACG-2014f isolate Syn7803C29, complete genome 212986-213013 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019141 Synechococcus phage ACG-2014f isolate Syn7803C10, complete genome 212463-212490 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019053 Synechococcus phage ACG-2014f isolate Syn7803C80, complete genome 216410-216437 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019147 Synechococcus phage ACG-2014f isolate Syn7803C17, complete genome 212771-212798 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019100 Synechococcus phage ACG-2014f isolate Syn7803US40, complete genome 206722-206749 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019101 Synechococcus phage ACG-2014f isolate Syn7803US42, complete genome 207510-207537 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019085 Synechococcus phage ACG-2014f isolate Syn7803US13, complete genome 212743-212770 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019096 Synechococcus phage ACG-2014f isolate Syn7803US36, complete genome 210778-210805 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019144 Synechococcus phage ACG-2014f isolate Syn7803C14, complete genome 205770-205797 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019145 Synechococcus phage ACG-2014f isolate Syn7803C15, complete genome 216194-216221 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019058 Synechococcus phage ACG-2014f isolate Syn7803C8, complete genome 213644-213671 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 KJ019092 Synechococcus phage ACG-2014f isolate Syn7803US2, complete genome 215381-215408 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 MK448998 Streptococcus phage Javan636, complete genome 35463-35490 7 0.75
NZ_CP018935_4 4.3|3405876|28|NZ_CP018935|CRT 3405876-3405903 28 MK448821 Streptococcus phage Javan623, complete genome 30477-30504 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019095 Synechococcus phage ACG-2014f isolate Syn7803US34, complete genome 212626-212653 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019086 Synechococcus phage ACG-2014f isolate Syn7803US17, complete genome 217266-217293 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019106 Synechococcus phage ACG-2014f isolate Syn7803US50, complete genome 213838-213865 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019107 Synechococcus phage ACG-2014f isolate Syn7803US52, complete genome 208692-208719 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019143 Synechococcus phage ACG-2014f isolate Syn7803C12, complete genome 214343-214370 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019103 Synechococcus phage ACG-2014f isolate Syn7803US44, complete genome 208940-208967 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019102 Synechococcus phage ACG-2014f isolate Syn7803US43, complete genome 215794-215821 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019066 Synechococcus phage ACG-2014f isolate Syn7803C9, complete genome 206786-206813 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019142 Synechococcus phage ACG-2014f isolate Syn7803C11, complete genome 213638-213665 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019149 Synechococcus phage ACG-2014f isolate Syn7803C21, complete genome 213342-213369 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019105 Synechococcus phage ACG-2014f isolate Syn7803US4, complete genome 205948-205975 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019098 Synechococcus phage ACG-2014f isolate Syn7803US39, complete genome 213786-213813 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019159 Synechococcus phage ACG-2014f isolate Syn7803C34, complete genome 215952-215979 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019123 Synechococcus phage ACG-2014f isolate Syn7803US7, complete genome 210939-210966 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019111 Synechococcus phage ACG-2014f isolate Syn7803US57, complete genome 212941-212968 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019148 Synechococcus phage ACG-2014f isolate Syn7803C19, complete genome 205546-205573 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NC_047712 Synechococcus phage ACG-2014f isolate Syn7803C7, complete genome 206545-206572 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019090 Synechococcus phage ACG-2014f isolate Syn7803US24, complete genome 215951-215978 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019146 Synechococcus phage ACG-2014f isolate Syn7803C16, complete genome 216437-216464 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019152 Synechococcus phage ACG-2014f isolate Syn7803C25, complete genome 211816-211843 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019093 Synechococcus phage ACG-2014f isolate Syn7803US30, complete genome 212525-212552 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019151 Synechococcus phage ACG-2014f isolate Syn7803C24, complete genome 215332-215359 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019150 Synechococcus phage ACG-2014f isolate Syn7803C22, complete genome 217555-217582 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 NC_026927 Synechococcus phage ACG-2014f isolate Syn7803C90, complete genome 218057-218084 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019097 Synechococcus phage ACG-2014f isolate Syn7803US37, complete genome 211660-211687 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019045 Synechococcus phage ACG-2014f isolate Syn7803C6, complete genome 216575-216602 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019037 Synechococcus phage ACG-2014f isolate Syn7803C58, complete genome 216078-216105 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019099 Synechococcus phage ACG-2014f isolate Syn7803US3, complete genome 209171-209198 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019155 Synechococcus phage ACG-2014f isolate Syn7803C29, complete genome 212986-213013 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019141 Synechococcus phage ACG-2014f isolate Syn7803C10, complete genome 212463-212490 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019053 Synechococcus phage ACG-2014f isolate Syn7803C80, complete genome 216410-216437 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019147 Synechococcus phage ACG-2014f isolate Syn7803C17, complete genome 212771-212798 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019100 Synechococcus phage ACG-2014f isolate Syn7803US40, complete genome 206722-206749 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019101 Synechococcus phage ACG-2014f isolate Syn7803US42, complete genome 207510-207537 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019085 Synechococcus phage ACG-2014f isolate Syn7803US13, complete genome 212743-212770 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019096 Synechococcus phage ACG-2014f isolate Syn7803US36, complete genome 210778-210805 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019144 Synechococcus phage ACG-2014f isolate Syn7803C14, complete genome 205770-205797 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019145 Synechococcus phage ACG-2014f isolate Syn7803C15, complete genome 216194-216221 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019058 Synechococcus phage ACG-2014f isolate Syn7803C8, complete genome 213644-213671 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 KJ019092 Synechococcus phage ACG-2014f isolate Syn7803US2, complete genome 215381-215408 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 MK448998 Streptococcus phage Javan636, complete genome 35463-35490 7 0.75
NZ_CP018935_4 4.5|3405975|28|NZ_CP018935|CRT 3405975-3406002 28 MK448821 Streptococcus phage Javan623, complete genome 30477-30504 7 0.75
NZ_CP018935_2 2.1|2432078|36|NZ_CP018935|CRT 2432078-2432113 36 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130772-130807 8 0.778
NZ_CP018935_6 6.1|4862788|34|NZ_CP018935|CRT 4862788-4862821 34 MG592556 Vibrio phage 1.188.C._10N.286.51.A6, partial genome 51954-51987 8 0.765
NZ_CP018935_6 6.1|4862788|34|NZ_CP018935|CRT 4862788-4862821 34 MG592555 Vibrio phage 1.188.B._10N.286.51.A6, partial genome 51954-51987 8 0.765
NZ_CP018935_6 6.1|4862788|34|NZ_CP018935|CRT 4862788-4862821 34 MG592554 Vibrio phage 1.188.A._10N.286.51.A6, partial genome 51952-51985 8 0.765
NZ_CP018935_6 6.1|4862788|34|NZ_CP018935|CRT 4862788-4862821 34 NC_048124 Vibrio phage 1.224.A._10N.261.48.B1, partial genome 51775-51808 9 0.735
NZ_CP018935_6 6.1|4862788|34|NZ_CP018935|CRT 4862788-4862821 34 NC_042047 Serratia phage vB_Sru_IME250, complete genome 389-422 10 0.706

1. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 2, identity: 0.926

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggac	Protospacer
****************** ****** *

2. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.926

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacagggc	Protospacer
****************** ****** *

3. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.926

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacagggc	Protospacer
****************** ****** *

4. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

5. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

6. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagtaacaggag	Protospacer
****************** ******  

7. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagtaacaggag	Protospacer
****************** ******  

8. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

9. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

10. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

11. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

12. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

13. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

14. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

15. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

16. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

17. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

18. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

19. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacgggagcaacaggagaaacaggag	Protospacer
****.********************  

20. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

21. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

22. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

23. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

24. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

25. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

26. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

27. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

28. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

29. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

30. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagaagcaggag	Protospacer
********************.****  

31. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagaagcaggag	Protospacer
********************.****  

32. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

33. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

34. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

35. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

36. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

37. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

38. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

39. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

40. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
cgacaggagcaacaggagcatcaggtc	Protospacer
*.**************** * ******

41. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to MN693798 (Marine virus AFVG_250M119, complete genome) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacaggag	Protospacer
****************** ******  

42. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.889

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacaggagcaacgggagtaacaggtc	Protospacer
.************.**** ********

43. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
gaacaggggcaacaggagcaacaggac	Protospacer
 ******.********** ****** *

44. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacgggagcaacaggag	Protospacer
*************.**** ******  

45. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacgggag	Protospacer
****************** ***.**  

46. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagtaacgggag	Protospacer
****************** ***.**  

47. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacgggagcaacaggag	Protospacer
*************.**** ******  

48. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacgggag	Protospacer
****************** ***.**  

49. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagtaacgggag	Protospacer
****************** ***.**  

50. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagtaacgggag	Protospacer
****************** ***.**  

51. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacgggag	Protospacer
****************** ***.**  

52. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacgggagcaacaggag	Protospacer
*************.**** ******  

53. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagtaacgggag	Protospacer
****************** ***.**  

54. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagtaacgggag	Protospacer
****************** ***.**  

55. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacgggag	Protospacer
****************** ***.**  

56. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacgggagcaacaggag	Protospacer
*************.**** ******  

57. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagtaacgggag	Protospacer
****************** ***.**  

58. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagtaacgggag	Protospacer
****************** ***.**  

59. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacgggag	Protospacer
****************** ***.**  

60. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacgggagcaacaggag	Protospacer
*************.**** ******  

61. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacgggagcaacaggag	Protospacer
*************.**** ******  

62. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacgggagcaacaggagcaacaggag	Protospacer
****.************* ******  

63. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacgggagcaacaggag	Protospacer
*************.**** ******  

64. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacgggagcaacaggagcaacaggag	Protospacer
****.************* ******  

65. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacgggag	Protospacer
****************** ***.**  

66. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacgggagcaacaggag	Protospacer
*************.**** ******  

67. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacgggagcaacaggagcaacaggag	Protospacer
****.************* ******  

68. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggagcaacgggag	Protospacer
****************** ***.**  

69. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacgggagtaacaggag	Protospacer
*************.**** ******  

70. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_006869 (Bacillus mycoides pSin9.7 plasmid) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggtccaacaggagaaacaggaa	Protospacer
*******  ****************  

71. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caaaaggagcaacaggagcaacaggag	Protospacer
*** ************** ******  

72. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP053689 (Arthrobacter citreus strain NEB 577 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
cgacgggagcaacaggagcaacaggcc	Protospacer
*.**.************* ******.*

73. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to MT820023 (Cryophage ML09, complete genome) position: , mismatch: 4, identity: 0.852

caacaggagcaacaggagaaacaggtc	CRISPR spacer
ctaaaggagcaacaggaaacacaggtc	Protospacer
* * *************.* *******

74. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to MN163280 (Klebsiella phage KpGranit, complete genome) position: , mismatch: 4, identity: 0.857

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggaccagtagcacctgtgtta	Protospacer
********* **************. .*

75. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to MN163280 (Klebsiella phage KpGranit, complete genome) position: , mismatch: 4, identity: 0.857

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggaccagtagcacctgtgtta	Protospacer
********* **************. .*

76. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.857

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccctgcggtccagtagcaccagtagcg	Protospacer
 ***** ************** *****.

77. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.857

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccctgcggtccagtagcaccagtagcg	Protospacer
 ***** ************** *****.

78. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.857

accctgaggtccagtagcacctgtagca	CRISPR spacer
accggtaggtccagtagcaccggtagca	Protospacer
***   *************** ******

79. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to MN163280 (Klebsiella phage KpGranit, complete genome) position: , mismatch: 4, identity: 0.857

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggaccagtagcacctgtgtta	Protospacer
********* **************. .*

80. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to MN163280 (Klebsiella phage KpGranit, complete genome) position: , mismatch: 4, identity: 0.857

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggaccagtagcacctgtgtta	Protospacer
********* **************. .*

81. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.857

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccctgcggtccagtagcaccagtagcg	Protospacer
 ***** ************** *****.

82. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.857

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccctgcggtccagtagcaccagtagcg	Protospacer
 ***** ************** *****.

83. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.857

accctgaggtccagtagcacctgtagca	CRISPR spacer
accggtaggtccagtagcaccggtagca	Protospacer
***   *************** ******

84. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

85. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

86. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

87. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

88. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
cgacgggagcaacaggagcaacaggag	Protospacer
*.**.************* ******  

89. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

90. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

91. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

92. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

93. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

94. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

95. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

96. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacgggagcaacaggagcaacaggag	Protospacer
.***.************* ******  

97. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
cgacgggagcaacaggagcaacaggag	Protospacer
*.**.************* ******  

98. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taacaggagtaacaggagcaacagggg	Protospacer
.********.******** ******  

99. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taaccggagcaacgggagaaacaggag	Protospacer
.*** ********.***********  

100. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
aagcaggagcaacaggagcaacaggag	Protospacer
 *.*************** ******  

101. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
aagcaggagcaacaggagcaacaggag	Protospacer
 *.*************** ******  

102. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caggaggagcaacaggagcaacaggag	Protospacer
**. ************** ******  

103. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
cgacaggagcaacaggagcaacgggag	Protospacer
*.**************** ***.**  

104. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to MN693798 (Marine virus AFVG_250M119, complete genome) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
caacaggagcaacaggaggcacagtag	Protospacer
******************. ****   

105. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP038597 (Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.2, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
gaacaggagcaacagcataaacaggaa	Protospacer
 ************** * *******  

106. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP038592 (Salmonella enterica subsp. enterica serovar Senftenberg strain SA20061017 plasmid pSA20061017, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
gaacaggagcaacagcataaacaggaa	Protospacer
 ************** * *******  

107. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP038594 (Salmonella enterica subsp. enterica serovar Senftenberg strain SA20130280 plasmid pSA20130280.1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
gaacaggagcaacagcataaacaggaa	Protospacer
 ************** * *******  

108. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP038602 (Salmonella enterica subsp. enterica serovar Senftenberg strain 11-5006 plasmid p11-5006.1, complete sequence) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
gaacaggagcaacagcataaacaggaa	Protospacer
 ************** * *******  

109. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to MN694697 (Marine virus AFVG_250M792, complete genome) position: , mismatch: 5, identity: 0.815

caacaggagcaacaggagaaacaggtc	CRISPR spacer
acacaggagcaacaggagctacaggtg	Protospacer
  ****************  ****** 

110. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to AP013669 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccttgaggtccagtagcaccagttgga	Protospacer
 **.***************** ** * *

111. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to AP013411 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccttgaggtccagtagcaccagttgga	Protospacer
 **.***************** ** * *

112. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggaccagtagcaccagtgtta	Protospacer
********* *********** **. .*

113. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggaccagtagcaccagtgtta	Protospacer
********* *********** **. .*

114. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to GU323708 (Lactobacillus phage phiPYB5, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
cccctgtggtccagtagcaccagtaggc	Protospacer
 ***** ************** ****  

115. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to MN693189 (Marine virus AFVG_25M326, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accttgaggtccagtagcaccttgaggt	Protospacer
***.******************  **  

116. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accggtaggtccagtagcaccggtagcg	Protospacer
***   *************** *****.

117. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to MN694491 (Marine virus AFVG_250M564, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgagcgccagtagcacctgtgtct	Protospacer
********  **************. * 

118. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KR296684 (UNVERIFIED: Salmonella phage 19, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgcggtcctgtagcacctgccgga	Protospacer
****** ***** **********. * *

119. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NC_029072 (Salmonella phage 19, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgcggtcctgtagcacctgccgga	Protospacer
****** ***** **********. * *

120. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KR296695 (UNVERIFIED: Salmonella phage 41, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgcggtcctgtagcacctgccgga	Protospacer
****** ***** **********. * *

121. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to JX181824 (Salmonella phage SSE-121, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgtggtcctgtagcacctgcggga	Protospacer
****** ***** **********..* *

122. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to GU070616 (Salmonella phage PVP-SE1, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgtggtcctgtagcacctgcggga	Protospacer
****** ***** **********..* *

123. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to AP013669 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccttgaggtccagtagcaccagttgga	Protospacer
 **.***************** ** * *

124. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to AP013411 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccttgaggtccagtagcaccagttgga	Protospacer
 **.***************** ** * *

125. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggaccagtagcaccagtgtta	Protospacer
********* *********** **. .*

126. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgaggaccagtagcaccagtgtta	Protospacer
********* *********** **. .*

127. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to GU323708 (Lactobacillus phage phiPYB5, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
cccctgtggtccagtagcaccagtaggc	Protospacer
 ***** ************** ****  

128. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to MN693189 (Marine virus AFVG_25M326, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accttgaggtccagtagcaccttgaggt	Protospacer
***.******************  **  

129. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accggtaggtccagtagcaccggtagcg	Protospacer
***   *************** *****.

130. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to MN694491 (Marine virus AFVG_250M564, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgagcgccagtagcacctgtgtct	Protospacer
********  **************. * 

131. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KR296684 (UNVERIFIED: Salmonella phage 19, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgcggtcctgtagcacctgccgga	Protospacer
****** ***** **********. * *

132. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NC_029072 (Salmonella phage 19, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgcggtcctgtagcacctgccgga	Protospacer
****** ***** **********. * *

133. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KR296695 (UNVERIFIED: Salmonella phage 41, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgcggtcctgtagcacctgccgga	Protospacer
****** ***** **********. * *

134. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to JX181824 (Salmonella phage SSE-121, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgtggtcctgtagcacctgcggga	Protospacer
****** ***** **********..* *

135. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to GU070616 (Salmonella phage PVP-SE1, complete genome) position: , mismatch: 5, identity: 0.821

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgtggtcctgtagcacctgcggga	Protospacer
****** ***** **********..* *

136. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778

caacaggagcaacaggagaaacaggtc	CRISPR spacer
tgacaggagcaactggtgaaacaggag	Protospacer
..*********** ** ********  

137. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778

caacaggagcaacaggagaaacaggtc	CRISPR spacer
tgacaggagcaactggagcaacaggag	Protospacer
..*********** **** ******  

138. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778

caacaggagcaacaggagaaacaggtc	CRISPR spacer
ctggaggagcaacaggagcaacaggag	Protospacer
* . ************** ******  

139. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to NZ_CP039272 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.2, complete sequence) position: , mismatch: 6, identity: 0.778

caacaggagcaacaggagaaacaggtc	CRISPR spacer
gaacaggagcaacagcataaacagaaa	Protospacer
 ************** * ******.  

140. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to MG945688 (UNVERIFIED: Microviridae sp. isolate 1348-1711, complete genome) position: , mismatch: 6, identity: 0.778

caacaggagcaacaggagaaacaggtc	CRISPR spacer
taagaggagcaacaggagaagcagaag	Protospacer
.** ****************.***.  

141. spacer 2.10|2432546|27|NZ_CP018935|CRT matches to AP014420 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S43-C167, *** SEQUENCING IN PROGRESS ***, 5 ordered pieces) position: , mismatch: 6, identity: 0.778

caacaggagcaacaggagaaacaggtc	CRISPR spacer
atatgggagcaacaggagcaacaggtg	Protospacer
  *..************* ******* 

142. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagcacctgtagat	Protospacer
 **.  ********************  

143. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

144. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccagtaggtccagtagctcctgtagct	Protospacer
 **   ************ ******** 

145. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

146. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

147. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

148. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

149. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

150. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

151. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccagtaggtccagtagctcctgtagct	Protospacer
 **   ************ ******** 

152. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

153. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

154. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

155. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

156. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

157. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NC_011771 (Bacillus cereus AH820 plasmid pAH820_10, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

158. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NC_011771 (Bacillus cereus AH820 plasmid pAH820_10, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

159. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KT997873 (Uncultured Mediterranean phage uvDeep-CGR2-KM21-C368, complete genome) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccagttggtccagtagcacctgttgca	Protospacer
 **    ***************** ***

160. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to MN693099 (Marine virus AFVG_25M184, complete genome) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccttgaggtccagtagcaccagttgat	Protospacer
 **.***************** ** *  

161. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to MN694808 (Marine virus AFVG_250M14, complete genome) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgagttccagtagcaccatctaca	Protospacer
******** ************  . .**

162. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to MN693618 (Marine virus AFVG_250M106, complete genome) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgagttccagtagcaccatctaca	Protospacer
******** ************  . .**

163. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagcacctgtagat	Protospacer
 **.  ********************  

164. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

165. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccagtaggtccagtagctcctgtagct	Protospacer
 **   ************ ******** 

166. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

167. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

168. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

169. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

170. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

171. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

172. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccagtaggtccagtagctcctgtagct	Protospacer
 **   ************ ******** 

173. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

174. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

175. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

176. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

177. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

178. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NC_011771 (Bacillus cereus AH820 plasmid pAH820_10, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

179. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NC_011771 (Bacillus cereus AH820 plasmid pAH820_10, complete sequence) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tcctgtaggtccagtagctcctgtagct	Protospacer
 **.  ************ ******** 

180. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KT997873 (Uncultured Mediterranean phage uvDeep-CGR2-KM21-C368, complete genome) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccagttggtccagtagcacctgttgca	Protospacer
 **    ***************** ***

181. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to MN693099 (Marine virus AFVG_25M184, complete genome) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccttgaggtccagtagcaccagttgat	Protospacer
 **.***************** ** *  

182. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to MN694808 (Marine virus AFVG_250M14, complete genome) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgagttccagtagcaccatctaca	Protospacer
******** ************  . .**

183. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to MN693618 (Marine virus AFVG_250M106, complete genome) position: , mismatch: 6, identity: 0.786

accctgaggtccagtagcacctgtagca	CRISPR spacer
accctgagttccagtagcaccatctaca	Protospacer
******** ************  . .**

184. spacer 6.1|4862788|34|NZ_CP018935|CRT matches to NC_049442 (Arthrobacter phage KBurrousTX, complete genome) position: , mismatch: 6, identity: 0.824

ctttggttctggatctggctttggttctggatct	CRISPR spacer
ttctggttctggttctggttttggttctggttat	Protospacer
.*.********* *****.*********** * *

185. spacer 6.2|4862842|28|NZ_CP018935|CRT matches to NZ_CP014361 (Methylomonas sp. DH-1 plasmid, complete sequence) position: , mismatch: 6, identity: 0.786

ctttggttctggatccggatttggtttg	CRISPR spacer
agctggttgtggatccggatttggagtg	Protospacer
  .***** ***************  **

186. spacer 6.2|4862842|28|NZ_CP018935|CRT matches to NC_018680 (Alteromonas macleodii str. 'Balearic Sea AD45' plasmid pAMBAS45, complete sequence) position: , mismatch: 6, identity: 0.786

ctttggttctggatccggatttggtttg	CRISPR spacer
acttggctctggatgcggatttggtaag	Protospacer
 .****.******* **********  *

187. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagtaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

188. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagtaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

189. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagcaacgggagcaacaggagtaacgggag	Protospacer
********* ******** *******.  ** **.*

190. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagtaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

191. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagtaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

192. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagcaacgggagcaacaggagtaacgggag	Protospacer
********* ******** *******.  ** **.*

193. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagtaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

194. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagtaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

195. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagtaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

196. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagcaacgggagcaacaggagtaacgggag	Protospacer
********* ******** *******.  ** **.*

197. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagtaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

198. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagtaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

199. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagtaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

200. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagcaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

201. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagcaacgggagcaacaggagaaacaggag	Protospacer
********* ******** *******.. ** **.*

202. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.806

caacaggagaaacgggaggaacaggaagcactgggg	CRISPR spacer
caacaggagcaacgggagcaacaggagcaacaggag	Protospacer
********* ******** *******.  ** **.*

203. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019095 (Synechococcus phage ACG-2014f isolate Syn7803US34, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

204. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019086 (Synechococcus phage ACG-2014f isolate Syn7803US17, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

205. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019106 (Synechococcus phage ACG-2014f isolate Syn7803US50, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

206. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019107 (Synechococcus phage ACG-2014f isolate Syn7803US52, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

207. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019143 (Synechococcus phage ACG-2014f isolate Syn7803C12, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

208. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019103 (Synechococcus phage ACG-2014f isolate Syn7803US44, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

209. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019102 (Synechococcus phage ACG-2014f isolate Syn7803US43, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

210. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019066 (Synechococcus phage ACG-2014f isolate Syn7803C9, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

211. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019142 (Synechococcus phage ACG-2014f isolate Syn7803C11, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

212. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019149 (Synechococcus phage ACG-2014f isolate Syn7803C21, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

213. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019105 (Synechococcus phage ACG-2014f isolate Syn7803US4, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

214. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019098 (Synechococcus phage ACG-2014f isolate Syn7803US39, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

215. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019159 (Synechococcus phage ACG-2014f isolate Syn7803C34, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

216. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019123 (Synechococcus phage ACG-2014f isolate Syn7803US7, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

217. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019111 (Synechococcus phage ACG-2014f isolate Syn7803US57, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

218. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019148 (Synechococcus phage ACG-2014f isolate Syn7803C19, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

219. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NC_047712 (Synechococcus phage ACG-2014f isolate Syn7803C7, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

220. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019090 (Synechococcus phage ACG-2014f isolate Syn7803US24, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

221. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019146 (Synechococcus phage ACG-2014f isolate Syn7803C16, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

222. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019152 (Synechococcus phage ACG-2014f isolate Syn7803C25, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

223. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019093 (Synechococcus phage ACG-2014f isolate Syn7803US30, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

224. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019151 (Synechococcus phage ACG-2014f isolate Syn7803C24, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

225. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019150 (Synechococcus phage ACG-2014f isolate Syn7803C22, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

226. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to NC_026927 (Synechococcus phage ACG-2014f isolate Syn7803C90, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

227. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019097 (Synechococcus phage ACG-2014f isolate Syn7803US37, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

228. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019045 (Synechococcus phage ACG-2014f isolate Syn7803C6, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

229. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019037 (Synechococcus phage ACG-2014f isolate Syn7803C58, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

230. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019099 (Synechococcus phage ACG-2014f isolate Syn7803US3, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

231. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019155 (Synechococcus phage ACG-2014f isolate Syn7803C29, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

232. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019141 (Synechococcus phage ACG-2014f isolate Syn7803C10, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

233. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019053 (Synechococcus phage ACG-2014f isolate Syn7803C80, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

234. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019147 (Synechococcus phage ACG-2014f isolate Syn7803C17, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

235. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019100 (Synechococcus phage ACG-2014f isolate Syn7803US40, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

236. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019101 (Synechococcus phage ACG-2014f isolate Syn7803US42, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

237. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019085 (Synechococcus phage ACG-2014f isolate Syn7803US13, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

238. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019096 (Synechococcus phage ACG-2014f isolate Syn7803US36, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

239. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019144 (Synechococcus phage ACG-2014f isolate Syn7803C14, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

240. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019145 (Synechococcus phage ACG-2014f isolate Syn7803C15, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

241. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019058 (Synechococcus phage ACG-2014f isolate Syn7803C8, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

242. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to KJ019092 (Synechococcus phage ACG-2014f isolate Syn7803US2, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

243. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to MK448998 (Streptococcus phage Javan636, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccttgaggtccagtagcaccttgttta	Protospacer
 **.******************    .*

244. spacer 4.3|3405876|28|NZ_CP018935|CRT matches to MK448821 (Streptococcus phage Javan623, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccttgaggtccagtagcaccttgttta	Protospacer
 **.******************    .*

245. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019095 (Synechococcus phage ACG-2014f isolate Syn7803US34, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

246. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019086 (Synechococcus phage ACG-2014f isolate Syn7803US17, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

247. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019106 (Synechococcus phage ACG-2014f isolate Syn7803US50, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

248. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019107 (Synechococcus phage ACG-2014f isolate Syn7803US52, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

249. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019143 (Synechococcus phage ACG-2014f isolate Syn7803C12, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

250. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019103 (Synechococcus phage ACG-2014f isolate Syn7803US44, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

251. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019102 (Synechococcus phage ACG-2014f isolate Syn7803US43, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

252. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019066 (Synechococcus phage ACG-2014f isolate Syn7803C9, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

253. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019142 (Synechococcus phage ACG-2014f isolate Syn7803C11, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

254. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019149 (Synechococcus phage ACG-2014f isolate Syn7803C21, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

255. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019105 (Synechococcus phage ACG-2014f isolate Syn7803US4, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

256. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019098 (Synechococcus phage ACG-2014f isolate Syn7803US39, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

257. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019159 (Synechococcus phage ACG-2014f isolate Syn7803C34, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

258. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019123 (Synechococcus phage ACG-2014f isolate Syn7803US7, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

259. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019111 (Synechococcus phage ACG-2014f isolate Syn7803US57, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

260. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019148 (Synechococcus phage ACG-2014f isolate Syn7803C19, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

261. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NC_047712 (Synechococcus phage ACG-2014f isolate Syn7803C7, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

262. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019090 (Synechococcus phage ACG-2014f isolate Syn7803US24, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

263. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019146 (Synechococcus phage ACG-2014f isolate Syn7803C16, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

264. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019152 (Synechococcus phage ACG-2014f isolate Syn7803C25, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

265. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019093 (Synechococcus phage ACG-2014f isolate Syn7803US30, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

266. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019151 (Synechococcus phage ACG-2014f isolate Syn7803C24, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

267. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019150 (Synechococcus phage ACG-2014f isolate Syn7803C22, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

268. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to NC_026927 (Synechococcus phage ACG-2014f isolate Syn7803C90, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

269. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019097 (Synechococcus phage ACG-2014f isolate Syn7803US37, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

270. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019045 (Synechococcus phage ACG-2014f isolate Syn7803C6, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

271. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019037 (Synechococcus phage ACG-2014f isolate Syn7803C58, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

272. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019099 (Synechococcus phage ACG-2014f isolate Syn7803US3, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

273. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019155 (Synechococcus phage ACG-2014f isolate Syn7803C29, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

274. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019141 (Synechococcus phage ACG-2014f isolate Syn7803C10, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

275. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019053 (Synechococcus phage ACG-2014f isolate Syn7803C80, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

276. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019147 (Synechococcus phage ACG-2014f isolate Syn7803C17, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

277. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019100 (Synechococcus phage ACG-2014f isolate Syn7803US40, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

278. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019101 (Synechococcus phage ACG-2014f isolate Syn7803US42, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

279. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019085 (Synechococcus phage ACG-2014f isolate Syn7803US13, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

280. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019096 (Synechococcus phage ACG-2014f isolate Syn7803US36, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

281. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019144 (Synechococcus phage ACG-2014f isolate Syn7803C14, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

282. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019145 (Synechococcus phage ACG-2014f isolate Syn7803C15, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

283. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019058 (Synechococcus phage ACG-2014f isolate Syn7803C8, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

284. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to KJ019092 (Synechococcus phage ACG-2014f isolate Syn7803US2, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
aatggtaggtccagtagcacctgtagat	Protospacer
* .   ********************  

285. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to MK448998 (Streptococcus phage Javan636, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccttgaggtccagtagcaccttgttta	Protospacer
 **.******************    .*

286. spacer 4.5|3405975|28|NZ_CP018935|CRT matches to MK448821 (Streptococcus phage Javan623, complete genome) position: , mismatch: 7, identity: 0.75

accctgaggtccagtagcacctgtagca	CRISPR spacer
tccttgaggtccagtagcaccttgttta	Protospacer
 **.******************    .*

287. spacer 2.1|2432078|36|NZ_CP018935|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.778

caacaggagaaacgggaggaacagga--agcactgggg	CRISPR spacer
caacaggagcaacgggagtaacaggagcaacattat--	Protospacer
********* ******** *******  *.**.*.   

288. spacer 6.1|4862788|34|NZ_CP018935|CRT matches to MG592556 (Vibrio phage 1.188.C._10N.286.51.A6, partial genome) position: , mismatch: 8, identity: 0.765

ctttggttctggatctggctttggttctggatct	CRISPR spacer
ttctggttctggatcaggcttaggttcagctttt	Protospacer
.*.************ ***** ***** *  *.*

289. spacer 6.1|4862788|34|NZ_CP018935|CRT matches to MG592555 (Vibrio phage 1.188.B._10N.286.51.A6, partial genome) position: , mismatch: 8, identity: 0.765

ctttggttctggatctggctttggttctggatct	CRISPR spacer
ttctggttctggatcaggcttaggttcagctttt	Protospacer
.*.************ ***** ***** *  *.*

290. spacer 6.1|4862788|34|NZ_CP018935|CRT matches to MG592554 (Vibrio phage 1.188.A._10N.286.51.A6, partial genome) position: , mismatch: 8, identity: 0.765

ctttggttctggatctggctttggttctggatct	CRISPR spacer
ttctggttctggatcaggcttaggttcagctttt	Protospacer
.*.************ ***** ***** *  *.*

291. spacer 6.1|4862788|34|NZ_CP018935|CRT matches to NC_048124 (Vibrio phage 1.224.A._10N.261.48.B1, partial genome) position: , mismatch: 9, identity: 0.735

ctttggttctggatctggctttggttctggatct	CRISPR spacer
ttctggttctggatcaggcttaggttcaactttt	Protospacer
.*.************ ***** ***** .  *.*

292. spacer 6.1|4862788|34|NZ_CP018935|CRT matches to NC_042047 (Serratia phage vB_Sru_IME250, complete genome) position: , mismatch: 10, identity: 0.706

ctttggttctggatctggctttggttctggatct	CRISPR spacer
gggtggttctggatctggttgtggttcgtcttca	Protospacer
   ***************.* ******    ** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 883291 : 893836 9 Bacillus_phage(62.5%) holin NA
DBSCAN-SWA_2 1392076 : 1400449 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 1445510 : 1453460 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_4 4423017 : 4465318 52 Bacillus_phage(83.78%) integrase,holin,capsid,tail,bacteriocin,protease,head,terminase,portal attL 4449420:4449434|attR 4470510:4470524
DBSCAN-SWA_5 4747142 : 4753359 10 Bacillus_phage(71.43%) NA NA
DBSCAN-SWA_6 5062810 : 5071545 9 Bacillus_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP018936
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15050 : 22011 9 Bacillus_phage(33.33%) integrase attL 7045:7070|attR 25817:25842
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage