Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 0 crisprs cas14j,csa3 0 0 3 0
NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 1 crisprs NA 0 1 1 0
NZ_CP017631 Escherichia coli strain SLK172 chromosome, complete genome 6 crisprs csa3,PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,c2c9_V-U4,DinG 0 19 13 0

Results visualization

1. NZ_CP017633
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017633_1 23842-23961 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 63874-63907 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 64169-64202 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 38215-38248 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 37006-37039 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP010164 Escherichia coli strain H2 plasmid A, complete sequence 20751-20784 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 239581-239614 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP022964 Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence 30266-30299 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP024467 Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence 17630-17663 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 16611-16644 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 53074-53107 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 32601-32634 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP047093 Salmonella sp. S13 plasmid pS13-4, complete sequence 1762-1795 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP051432 Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence 23725-23758 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP046002 Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence 35337-35370 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 26770-26803 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 41390-41423 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 60962-60995 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP032386 Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence 39391-39424 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP032389 Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence 9889-9922 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_LT904873 Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2 5696-5729 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_KT754163 Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence 12265-12298 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP033383 Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence 7366-7399 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP020836 Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence 20407-20440 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 93494-93527 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP043216 Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence 32193-32226 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 25537-25570 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP031361 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence 27033-27066 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP044153 Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence 25749-25782 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP040929 Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence 2187-2220 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP033386 Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence 34721-34754 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 4942-4975 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 47580-47613 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 14631-14664 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP047339 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence 28949-28982 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_010860 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence 32623-32656 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP022453 Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence 5893-5926 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 53536-53569 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP030208 Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence 39815-39848 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP005994 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence 30028-30061 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP032450 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence 29110-29143 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP010155 Escherichia coli strain D9 plasmid C, complete genome 14497-14530 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 58667-58700 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP029061 Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence 10786-10819 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP042589 Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence 29459-29492 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 79278-79311 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 54169-54202 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MN816373 Escherichia coli strain A127 plasmid pA127-X1, complete sequence 29459-29492 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 61147-61180 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 99797-99830 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 88012-88045 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP050724 Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence 41949-41982 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP047573 Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence 53619-53652 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_019106 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence 32551-32584 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP010127 Escherichia coli strain C8 plasmid B, complete genome 33248-33281 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 85971-86004 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP022072 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence 18650-18683 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 20398-20431 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 147056-147089 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP045998 Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence 35339-35372 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP032394 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence 32800-32833 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_019256 Shigella sp. LN126 plasmid pLN126_33, complete sequence 2112-2145 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 16816-16849 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 68260-68293 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MH229869 Escherichia coli plasmid pKANJ7, complete sequence 90-123 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP050713 Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence 33434-33467 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 96892-96925 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 63333-63366 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 238663-238696 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 37880-37913 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MK731977 Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence 22155-22188 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MK673546 Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence 28203-28236 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP032447 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence 18380-18413 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 118004-118037 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 151970-152003 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 243053-243086 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 241163-241196 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP025558 Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence 11939-11972 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 90443-90476 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 43726-43759 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 48918-48951 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MG197491 Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence 33352-33385 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 58347-58380 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 61256-61289 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 61256-61289 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 27964-27997 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 61256-61289 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 43736-43769 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 80789-80822 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MT219822 Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence 38970-39003 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 73817-73850 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_023323 Escherichia coli ACN001 plasmid pACN001-A, complete sequence 18865-18898 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 14942-14975 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP016575 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence 296-329 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 30572-30605 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP032994 Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence 10049-10082 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MN783746 Escherichia coli plasmid pIncX1_p1, complete sequence 5290-5323 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_KX815983 Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence 40397-40430 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_KU254580 Escherichia coli strain YD786 plasmid pYD786-3, complete sequence 25507-25540 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP042633 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence 38916-38949 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP032392 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence 67739-67772 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 35028-35061 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 69102-69135 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP037995 Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281 7255-7288 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP053740 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence 9971-10004 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP016580 Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence 23703-23736 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 49989-50022 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP021103 Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence 56470-56503 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP029182 Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence 2302-2335 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MN086778 Escherichia coli plasmid p16EC-IncN, complete sequence 90173-90206 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP053047 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence 9874-9907 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP014974 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence 295-328 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 220331-220364 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP035774 Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence 12757-12790 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP044182 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence 25543-25576 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP042608 Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence 7171-7204 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 45261-45294 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_019046 Escherichia coli plasmid pNMEC31_31, complete sequence 31361-31394 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 89191-89224 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 30748-30781 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP035315 Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence 28493-28526 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP050748 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence 5878-5911 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_024961 Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence 905-938 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_021842 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence 4017-4050 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_LT985261 Escherichia coli strain 657 plasmid RCS50_p, complete sequence 42585-42618 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_AP019678 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence 49115-49148 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP009074 Escherichia coli ATCC 25922 plasmid unnamed, complete sequence 21137-21170 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP010168 Escherichia coli strain H3 plasmid A, complete genome 25682-25715 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_010378 Escherichia coli plasmid pOLA52, complete sequence 34562-34595 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 CP016512 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence 23704-23737 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP016529 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence 23704-23737 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP016518 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence 23705-23738 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 50710-50743 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 23885-23918 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP012922 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence 23704-23737 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP033093 Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence 19532-19565 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP012926 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence 37369-37402 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP023360 Escherichia coli strain 1943 plasmid p54, complete sequence 52726-52759 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 37807-37840 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP039600 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence 32872-32905 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 49947-49980 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_011204 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence 70648-70681 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_017624 Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence 23689-23722 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP050710 Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence 15569-15602 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP024290 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence 33653-33686 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP048777 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence 1446-1479 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP041631 Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence 4799-4832 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP050773 Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence 30707-30740 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 38005-38038 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP019180 Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence 24566-24599 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP050765 Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence 6593-6626 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_010422 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence 59434-59467 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP050759 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence 5734-5767 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_AP022652 Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence 295-328 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP024136 Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence 79478-79511 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_LT985315 Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence 47119-47152 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MN436006 Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence 27492-27525 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MN436007 Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence 27131-27164 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MK360096 Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence 44664-44697 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 48284-48317 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP032381 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence 12454-12487 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 43402-43435 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MT197111 Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence 12897-12930 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 59284-59317 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 118931-118964 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 MT219821 Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence 3734-3767 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 29004-29037 0 1.0
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP030195 Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence 159-192 1 0.971
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP033353 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence 78450-78483 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP050780 Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence 203947-203980 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP022061 Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence 1711-1744 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 CP048927 Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence 45611-45644 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP029841 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence 98434-98467 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP028313 Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence 41569-41602 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP018662 Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence 41992-42025 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 CP049987 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence 41386-41419 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 CP049982 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence 42740-42773 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NC_010421 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence 27662-27695 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_MK625201 Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence 41824-41857 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP023476 Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence 33473-33506 2 0.941
NZ_CP017633_1 1.1|23885|34|NZ_CP017633|CRISPRCasFinder 23885-23918 34 NZ_CP044292 Escherichia coli strain P43A plasmid pP43A-1, complete sequence 44259-44292 4 0.882

1. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

2. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

3. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

4. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

5. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP010164 (Escherichia coli strain H2 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

6. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

7. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP022964 (Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

8. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP024467 (Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

9. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

10. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

11. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

12. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP047093 (Salmonella sp. S13 plasmid pS13-4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

13. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP051432 (Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

14. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP046002 (Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

15. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

16. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

17. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

18. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP032386 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

19. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP032389 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

20. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_LT904873 (Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

21. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_KT754163 (Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

22. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP033383 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

23. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP020836 (Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

24. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

25. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP043216 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

26. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

27. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP031361 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

28. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP044153 (Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

29. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP040929 (Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

30. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP033386 (Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

31. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

32. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

33. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

34. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP047339 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

35. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_010860 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

36. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP022453 (Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

37. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

38. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP030208 (Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

39. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP005994 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

40. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP032450 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

41. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP010155 (Escherichia coli strain D9 plasmid C, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

42. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

43. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP029061 (Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

44. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP042589 (Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

45. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

46. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

47. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MN816373 (Escherichia coli strain A127 plasmid pA127-X1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

48. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

49. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

50. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

51. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP050724 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

52. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

53. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_019106 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

54. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP010127 (Escherichia coli strain C8 plasmid B, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

55. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

56. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP022072 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

57. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

58. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

59. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP045998 (Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

60. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP032394 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

61. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_019256 (Shigella sp. LN126 plasmid pLN126_33, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

62. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

63. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

64. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MH229869 (Escherichia coli plasmid pKANJ7, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

65. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP050713 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

66. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

67. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

68. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

69. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

70. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MK731977 (Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

71. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MK673546 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

72. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP032447 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

73. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

74. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

75. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

76. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

77. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP025558 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

78. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

79. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

80. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

81. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MG197491 (Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

82. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

83. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

84. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

85. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

86. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

87. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

88. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

89. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MT219822 (Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

90. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

91. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_023323 (Escherichia coli ACN001 plasmid pACN001-A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

92. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

93. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP016575 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

94. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP020060 (Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

95. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP032994 (Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

96. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MN783746 (Escherichia coli plasmid pIncX1_p1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

97. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

98. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_KU254580 (Escherichia coli strain YD786 plasmid pYD786-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

99. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP042633 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

100. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP032392 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

101. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

102. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

103. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP037995 (Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

104. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP053740 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

105. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP016580 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

106. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

107. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

108. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP029182 (Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

109. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MN086778 (Escherichia coli plasmid p16EC-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

110. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP053047 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

111. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP014974 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

112. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

113. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP035774 (Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

114. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP044182 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

115. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP042608 (Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

116. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

117. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_019046 (Escherichia coli plasmid pNMEC31_31, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

118. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

119. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

120. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP035315 (Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

121. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP050748 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

122. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_024961 (Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

123. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_021842 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

124. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_LT985261 (Escherichia coli strain 657 plasmid RCS50_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

125. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_AP019678 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

126. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP009074 (Escherichia coli ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

127. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP010168 (Escherichia coli strain H3 plasmid A, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

128. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_010378 (Escherichia coli plasmid pOLA52, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

129. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to CP016512 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

130. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP016529 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

131. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP016518 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

132. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

133. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

134. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP012922 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

135. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP033093 (Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

136. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP012926 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

137. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP023360 (Escherichia coli strain 1943 plasmid p54, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

138. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

139. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP039600 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

140. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

141. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_011204 (Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

142. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_017624 (Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

143. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP050710 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

144. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP024290 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

145. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP048777 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

146. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP041631 (Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

147. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP050773 (Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

148. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

149. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP019180 (Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

150. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP050765 (Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

151. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_010422 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

152. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP050759 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

153. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_AP022652 (Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

154. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP024136 (Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

155. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_LT985315 (Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

156. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MN436006 (Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

157. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MN436007 (Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

158. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MK360096 (Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

159. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

160. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP032381 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

161. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

162. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MT197111 (Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

163. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

164. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

165. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to MT219821 (Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

166. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

167. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP030195 (Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtgattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

168. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP033353 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
******************************* .*

169. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP050780 (Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
******************************* .*

170. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP022061 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

171. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to CP048927 (Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

172. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

173. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP028313 (Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

174. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP018662 (Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

175. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to CP049987 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

176. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to CP049982 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

177. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NC_010421 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

178. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_MK625201 (Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

179. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP023476 (Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

180. spacer 1.1|23885|34|NZ_CP017633|CRISPRCasFinder matches to NZ_CP044292 (Escherichia coli strain P43A plasmid pP43A-1, complete sequence) position: , mismatch: 4, identity: 0.882

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgttcga	Protospacer
*****************************. *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 61946 60 Escherichia_phage(42.11%) transposase,integrase,protease attL 3525:3584|attR 41987:42807
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP017632
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14734 : 185404 173 Escherichia_phage(53.33%) integrase,head,plate,transposase,portal,lysis,tail,holin,terminase attL 33869:33928|attR 142496:145889
DBSCAN-SWA_2 188742 : 235109 47 Escherichia_phage(31.25%) integrase,transposase,protease attL 196362:196375|attR 233128:233141
DBSCAN-SWA_3 290657 : 346297 57 Salmonella_phage(27.78%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP017631
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017631_1 1073737-1074253 Unclear I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017631_2 1099802-1100623 TypeI-E I-E
13 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017631_3 1643826-1643943 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017631_4 3238662-3238753 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017631_5 3638150-3638294 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017631_6 3877308-3877404 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017631_2 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100258-1100289 32 NZ_CP042584 Escherichia coli strain LD91-1 plasmid pLD91-1-76kb, complete sequence 74762-74793 0 1.0
NZ_CP017631_4 4.1|3238688|40|NZ_CP017631|CRISPRCasFinder 3238688-3238727 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP017631_2 2.13|1100563|32|NZ_CP017631|CRISPRCasFinder,CRT 1100563-1100594 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 1 0.969
NZ_CP017631_1 1.12|1073949|32|NZ_CP017631|CRT 1073949-1073980 32 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3605 3 0.906
NZ_CP017631_1 1.12|1073949|32|NZ_CP017631|CRT 1073949-1073980 32 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3598 3 0.906
NZ_CP017631_1 1.12|1073949|32|NZ_CP017631|CRT 1073949-1073980 32 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21074 3 0.906
NZ_CP017631_1 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073948-1073980 33 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3606 4 0.879
NZ_CP017631_1 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073948-1073980 33 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3599 4 0.879
NZ_CP017631_1 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073948-1073980 33 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21075 4 0.879
NZ_CP017631_1 1.12|1073949|32|NZ_CP017631|CRT 1073949-1073980 32 KY653119 Morganella phage IME1369_02, complete genome 18217-18248 5 0.844
NZ_CP017631_2 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100258-1100289 32 NC_014108 Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_B, complete sequence 6021-6052 5 0.844
NZ_CP017631_2 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100258-1100289 32 NZ_CP030922 Escherichia coli strain KL53 plasmid pKL53-S, complete sequence 5379-5410 5 0.844
NZ_CP017631_2 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100258-1100289 32 NZ_CP038659 Citrobacter freundii strain 680 plasmid p680_1, complete sequence 372822-372853 5 0.844
NZ_CP017631_2 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100258-1100289 32 MN699848 Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence 37054-37085 5 0.844
NZ_CP017631_1 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073948-1073980 33 KY653119 Morganella phage IME1369_02, complete genome 18216-18248 6 0.818
NZ_CP017631_2 2.4|1100014|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100014-1100045 32 NZ_AP018520 Sphingobium sp. YG1 plasmid pYGP1, complete sequence 43472-43503 6 0.812
NZ_CP017631_1 1.13|1074010|32|NZ_CP017631|CRT 1074010-1074041 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755173-755204 7 0.781
NZ_CP017631_2 2.13|1100563|32|NZ_CP017631|CRISPRCasFinder,CRT 1100563-1100594 32 MK455769 Aeromonas phage MJG, complete genome 10369-10400 7 0.781
NZ_CP017631_1 1.5|1074009|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1074009-1074041 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
NZ_CP017631_1 1.13|1074010|32|NZ_CP017631|CRT 1074010-1074041 32 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 191920-191951 8 0.75
NZ_CP017631_1 1.16|1074193|32|NZ_CP017631|CRT 1074193-1074224 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
NZ_CP017631_2 2.3|1099953|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1099953-1099984 32 NC_018454 Cronobacter phage phiES15, complete genome 8781-8812 8 0.75
NZ_CP017631_2 2.3|1099953|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1099953-1099984 32 JQ780327 Cronobacter phage phiES15, complete sequence 8781-8812 8 0.75
NZ_CP017631_2 2.11|1100441|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100441-1100472 32 NZ_CP013415 Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence 218852-218883 8 0.75
NZ_CP017631_1 1.11|1073888|32|NZ_CP017631|CRT 1073888-1073919 32 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 246573-246604 9 0.719
NZ_CP017631_2 2.5|1100075|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100075-1100106 32 NZ_CP009595 Bacillus cereus strain 3a plasmid pBFC_3, complete sequence 298003-298034 9 0.719
NZ_CP017631_2 2.5|1100075|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100075-1100106 32 NZ_CP009606 Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence 164238-164269 9 0.719
NZ_CP017631_2 2.5|1100075|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100075-1100106 32 NZ_CP053994 Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence 238009-238040 9 0.719
NZ_CP017631_2 2.5|1100075|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100075-1100106 32 NZ_CP053992 Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence 221025-221056 9 0.719
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 57083-57114 9 0.719
NZ_CP017631_2 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100258-1100289 32 NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 238917-238948 9 0.719
NZ_CP017631_2 2.9|1100319|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100319-1100350 32 AP014022 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C112A-MedDCM-OCT-S32-C75, *** SEQUENCING IN PROGRESS *** 22698-22729 9 0.719
NZ_CP017631_2 2.9|1100319|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100319-1100350 32 AP014023 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C112A-MedDCM-OCT-S35-C64, *** SEQUENCING IN PROGRESS *** 23700-23731 9 0.719
NZ_CP017631_2 2.11|1100441|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100441-1100472 32 NZ_CP014797 Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence 208455-208486 9 0.719
NZ_CP017631_2 2.13|1100563|32|NZ_CP017631|CRISPRCasFinder,CRT 1100563-1100594 32 NC_047954 Pseudomonas phage Njord, complete genome 11435-11466 9 0.719
NZ_CP017631_1 1.9|1073766|32|NZ_CP017631|CRT 1073766-1073797 32 MN694016 Marine virus AFVG_250M811, complete genome 5413-5444 10 0.688
NZ_CP017631_1 1.9|1073766|32|NZ_CP017631|CRT 1073766-1073797 32 MN694190 Marine virus AFVG_250M608, complete genome 5350-5381 10 0.688
NZ_CP017631_1 1.9|1073766|32|NZ_CP017631|CRT 1073766-1073797 32 MN693920 Marine virus AFVG_250M810, complete genome 5422-5453 10 0.688
NZ_CP017631_1 1.9|1073766|32|NZ_CP017631|CRT 1073766-1073797 32 MN693800 Marine virus AFVG_250M813, complete genome 5404-5435 10 0.688
NZ_CP017631_1 1.9|1073766|32|NZ_CP017631|CRT 1073766-1073797 32 MN694355 Marine virus AFVG_250M627, complete genome 26040-26071 10 0.688
NZ_CP017631_1 1.9|1073766|32|NZ_CP017631|CRT 1073766-1073797 32 MN694554 Marine virus AFVG_250M812, complete genome 5416-5447 10 0.688
NZ_CP017631_1 1.9|1073766|32|NZ_CP017631|CRT 1073766-1073797 32 MN694404 Marine virus AFVG_250M623, complete genome 5369-5400 10 0.688
NZ_CP017631_1 1.12|1073949|32|NZ_CP017631|CRT 1073949-1073980 32 MF158039 Shigella phage Sf12, complete genome 4975-5006 10 0.688
NZ_CP017631_1 1.12|1073949|32|NZ_CP017631|CRT 1073949-1073980 32 MF158042 Shigella phage Sd1, complete genome 938-969 10 0.688
NZ_CP017631_2 2.2|1099892|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1099892-1099923 32 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 55281-55312 10 0.688
NZ_CP017631_2 2.4|1100014|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100014-1100045 32 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 50199-50230 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 19612-19643 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 115804-115835 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 116173-116204 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 182725-182756 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 110105-110136 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 109122-109153 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 221496-221527 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 207469-207500 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 199664-199695 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 13581-13612 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 73431-73462 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 187798-187829 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 106322-106353 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 148086-148117 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 93116-93147 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 185318-185349 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 219648-219679 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 158306-158337 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 93116-93147 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 167798-167829 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NC_002305 Salmonella typhi plasmid R27, complete sequence 128806-128837 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 91681-91712 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 183046-183077 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 182844-182875 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 37794-37825 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 36345-36376 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 124973-125004 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 184389-184420 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 94449-94480 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 26677-26708 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 182833-182864 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 183156-183187 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 183101-183132 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 197454-197485 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 205427-205458 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 191663-191694 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 49708-49739 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 182844-182875 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 126184-126215 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 93117-93148 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 181554-181585 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 182609-182640 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 182936-182967 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 182844-182875 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 182670-182701 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 183046-183077 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 182572-182603 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 180358-180389 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 176026-176057 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 130052-130083 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 182677-182708 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 182461-182492 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 41577-41608 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 203153-203184 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 109234-109265 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 20553-20584 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 58755-58786 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 179219-179250 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 194749-194780 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 146284-146315 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 176467-176498 10 0.688
NZ_CP017631_2 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100136-1100167 32 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 45801-45832 10 0.688
NZ_CP017631_2 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100258-1100289 32 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 259269-259300 10 0.688
NZ_CP017631_2 2.11|1100441|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100441-1100472 32 NZ_CP041349 Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence 27173-27204 10 0.688
NZ_CP017631_2 2.11|1100441|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100441-1100472 32 NZ_CP041350 Komagataeibacter xylinus strain CGMCC 17276 plasmid pB, complete sequence 149091-149122 10 0.688
NZ_CP017631_2 2.11|1100441|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100441-1100472 32 NZ_CP004365 Komagataeibacter xylinus E25 plasmid pGX5, complete sequence 172655-172686 10 0.688
NZ_CP017631_2 2.13|1100563|32|NZ_CP017631|CRISPRCasFinder,CRT 1100563-1100594 32 NC_047894 Pseudomonas phage uligo, complete genome 11353-11384 10 0.688
NZ_CP017631_1 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073765-1073797 33 MN694016 Marine virus AFVG_250M811, complete genome 5413-5445 11 0.667
NZ_CP017631_1 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073765-1073797 33 MN694190 Marine virus AFVG_250M608, complete genome 5350-5382 11 0.667
NZ_CP017631_1 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073765-1073797 33 MN693920 Marine virus AFVG_250M810, complete genome 5422-5454 11 0.667
NZ_CP017631_1 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073765-1073797 33 MN693800 Marine virus AFVG_250M813, complete genome 5404-5436 11 0.667
NZ_CP017631_1 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073765-1073797 33 MN694554 Marine virus AFVG_250M812, complete genome 5416-5448 11 0.667
NZ_CP017631_1 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073765-1073797 33 MN694404 Marine virus AFVG_250M623, complete genome 5369-5401 11 0.667
NZ_CP017631_1 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073765-1073797 33 MN694355 Marine virus AFVG_250M627, complete genome 26039-26071 11 0.667
NZ_CP017631_1 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073948-1073980 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
NZ_CP017631_1 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder 1073948-1073980 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667
NZ_CP017631_1 1.9|1073766|32|NZ_CP017631|CRT 1073766-1073797 32 MN694191 Marine virus AFVG_250M444, complete genome 10652-10683 11 0.656
NZ_CP017631_1 1.9|1073766|32|NZ_CP017631|CRT 1073766-1073797 32 MN694065 Marine virus AFVG_250M443, complete genome 44541-44572 11 0.656
NZ_CP017631_2 2.7|1100197|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100197-1100228 32 MT344105 Acinetobacter phage fLi-Aba03, complete genome 32699-32730 11 0.656
NZ_CP017631_2 2.7|1100197|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100197-1100228 32 MT344104 Acinetobacter phage fLi-Aba02, complete genome 32861-32892 11 0.656
NZ_CP017631_2 2.7|1100197|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT 1100197-1100228 32 MT344103 Acinetobacter phage fEg-Aba01, complete genome 31614-31645 11 0.656

1. spacer 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042584 (Escherichia coli strain LD91-1 plasmid pLD91-1-76kb, complete sequence) position: , mismatch: 0, identity: 1.0

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tcatgaatatggggaaaacgaacaatctgttt	Protospacer
********************************

2. spacer 4.1|3238688|40|NZ_CP017631|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

3. spacer 2.13|1100563|32|NZ_CP017631|CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactggatgcgatgatggacatcacttg	Protospacer
***********************.********

4. spacer 1.12|1073949|32|NZ_CP017631|CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

5. spacer 1.12|1073949|32|NZ_CP017631|CRT matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

6. spacer 1.12|1073949|32|NZ_CP017631|CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

7. spacer 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

8. spacer 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

9. spacer 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

10. spacer 1.12|1073949|32|NZ_CP017631|CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 5, identity: 0.844

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggttgtgcggcgttaacgctgaccagcatttc	Protospacer
*  * ******.******** ***********

11. spacer 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NC_014108 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_B, complete sequence) position: , mismatch: 5, identity: 0.844

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tcatgaatatggcgaaaatgaacaatcagcct	Protospacer
************ *****.******** *..*

12. spacer 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030922 (Escherichia coli strain KL53 plasmid pKL53-S, complete sequence) position: , mismatch: 5, identity: 0.844

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tcatgaatatggcgaaaatgaacaatcagcct	Protospacer
************ *****.******** *..*

13. spacer 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038659 (Citrobacter freundii strain 680 plasmid p680_1, complete sequence) position: , mismatch: 5, identity: 0.844

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tcatgaatatggcgaaaatgaacaatcagcct	Protospacer
************ *****.******** *..*

14. spacer 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to MN699848 (Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence) position: , mismatch: 5, identity: 0.844

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tcatgaatatggcgaaaatgaacaatcagcct	Protospacer
************ *****.******** *..*

15. spacer 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.818

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
aggttgtgcggcgttaacgctgaccagcatttc	Protospacer
 *  * ******.******** ***********

16. spacer 2.4|1100014|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018520 (Sphingobium sp. YG1 plasmid pYGP1, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgagtccgtcagcggtgcgccgctg-caaca	CRISPR spacer
gtcgagtaagtcagcggtgcgccgcgatcaac-	Protospacer
* *****  **************** . **** 

17. spacer 1.13|1074010|32|NZ_CP017631|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
ccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
 *******.**************** *.. *.

18. spacer 2.13|1100563|32|NZ_CP017631|CRISPRCasFinder,CRT matches to MK455769 (Aeromonas phage MJG, complete genome) position: , mismatch: 7, identity: 0.781

gacgcactggatgcgatgatggatatcacttg-	CRISPR spacer
gacgcactgtatgcaatgatgga-atcggaggc	Protospacer
********* ****.******** ***.   * 

19. spacer 1.5|1074009|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

gacgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
tccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
  *******.**************** *.. *.

20. spacer 1.13|1074010|32|NZ_CP017631|CRT matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
atgcggtcatggatgctgatgttgcagtgatg	Protospacer
*.*.********.***** ******** * ..

21. spacer 1.16|1074193|32|NZ_CP017631|CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

22. spacer 2.3|1099953|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NC_018454 (Cronobacter phage phiES15, complete genome) position: , mismatch: 8, identity: 0.75

atccgccgccggttaacgctggaccagttccg	CRISPR spacer
gcgtggccccggttaacgctggacacgttccg	Protospacer
.. .* * ****************  ******

23. spacer 2.3|1099953|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to JQ780327 (Cronobacter phage phiES15, complete sequence) position: , mismatch: 8, identity: 0.75

atccgccgccggttaacgctggaccagttccg	CRISPR spacer
gcgtggccccggttaacgctggacacgttccg	Protospacer
.. .* * ****************  ******

24. spacer 2.11|1100441|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 8, identity: 0.75

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
aatctacaggccgtgacggttgtcatggaggc	Protospacer
     *****************.*** *** *

25. spacer 1.11|1073888|32|NZ_CP017631|CRT matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

gcaaaaaccgggcaatcgcaaaaaggcgtaat	CRISPR spacer
gaaaaaaccgcccaatcgcaaaaagatgacga	Protospacer
* ********  *************..*  . 

26. spacer 2.5|1100075|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 9, identity: 0.719

ggacaatgtgaaaagcttaatattcattacat	CRISPR spacer
aaggaaaatgaaaagaataatattcattacag	Protospacer
... ** .*******  ************** 

27. spacer 2.5|1100075|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 9, identity: 0.719

ggacaatgtgaaaagcttaatattcattacat	CRISPR spacer
aaggaaaatgaaaagaataatattcattacag	Protospacer
... ** .*******  ************** 

28. spacer 2.5|1100075|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ggacaatgtgaaaagcttaatattcattacat	CRISPR spacer
aaggaaaatgaaaagaataatattcattacag	Protospacer
... ** .*******  ************** 

29. spacer 2.5|1100075|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ggacaatgtgaaaagcttaatattcattacat	CRISPR spacer
aaggaaaatgaaaagaataatattcattacag	Protospacer
... ** .*******  ************** 

30. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatatcacccagcactccggg	Protospacer
  *  ******************** ** .  

31. spacer 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tctgctgcatgggggaaacgatcaatctgttg	Protospacer
**    ..******.****** ********* 

32. spacer 2.9|1100319|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to AP014022 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C112A-MedDCM-OCT-S32-C75, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719

ccagccgaaacaacgccagcaaaatcgaccgc	CRISPR spacer
ccagccaaaacatcgccagcaaaaccttggag	Protospacer
******.***** ***********.*    . 

33. spacer 2.9|1100319|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to AP014023 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C112A-MedDCM-OCT-S35-C64, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719

ccagccgaaacaacgccagcaaaatcgaccgc	CRISPR spacer
ccagccaaaacatcgccagcaaaaccctggag	Protospacer
******.***** ***********.*    . 

34. spacer 2.11|1100441|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 9, identity: 0.719

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gctgcacagggtgtgacggttgccattgccga	Protospacer
 * * ***** .****************    

35. spacer 2.13|1100563|32|NZ_CP017631|CRISPRCasFinder,CRT matches to NC_047954 (Pseudomonas phage Njord, complete genome) position: , mismatch: 9, identity: 0.719

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactcgatgcgatgatggaggccgaggc	Protospacer
******** ************** ..*.    

36. spacer 1.9|1073766|32|NZ_CP017631|CRT matches to MN694016 (Marine virus AFVG_250M811, complete genome) position: , mismatch: 10, identity: 0.688

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatactt	Protospacer
.  .*********.***********.**.   

37. spacer 1.9|1073766|32|NZ_CP017631|CRT matches to MN694190 (Marine virus AFVG_250M608, complete genome) position: , mismatch: 10, identity: 0.688

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatacct	Protospacer
.  .*********.***********.**.   

38. spacer 1.9|1073766|32|NZ_CP017631|CRT matches to MN693920 (Marine virus AFVG_250M810, complete genome) position: , mismatch: 10, identity: 0.688

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatactt	Protospacer
.  .*********.***********.**.   

39. spacer 1.9|1073766|32|NZ_CP017631|CRT matches to MN693800 (Marine virus AFVG_250M813, complete genome) position: , mismatch: 10, identity: 0.688

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatactt	Protospacer
.  .*********.***********.**.   

40. spacer 1.9|1073766|32|NZ_CP017631|CRT matches to MN694355 (Marine virus AFVG_250M627, complete genome) position: , mismatch: 10, identity: 0.688

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatactt	Protospacer
.  .*********.***********.**.   

41. spacer 1.9|1073766|32|NZ_CP017631|CRT matches to MN694554 (Marine virus AFVG_250M812, complete genome) position: , mismatch: 10, identity: 0.688

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatactt	Protospacer
.  .*********.***********.**.   

42. spacer 1.9|1073766|32|NZ_CP017631|CRT matches to MN694404 (Marine virus AFVG_250M623, complete genome) position: , mismatch: 10, identity: 0.688

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatacct	Protospacer
.  .*********.***********.**.   

43. spacer 1.12|1073949|32|NZ_CP017631|CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 10, identity: 0.688

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctccccaagtgccg	Protospacer
 *******.************ ***.   .. 

44. spacer 1.12|1073949|32|NZ_CP017631|CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 10, identity: 0.688

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctctccaagtgccg	Protospacer
 *******.************ ***.   .. 

45. spacer 2.2|1099892|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcacggaattgttatgctgttcccctgaccg	CRISPR spacer
tcttcggaattgccatgctgttccccttccat	Protospacer
  . ********..*************  *  

46. spacer 2.4|1100014|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgagtccgtcagcggtgcgccgctgcaaca	CRISPR spacer
ttggagtccgacatcggtgcgccgcttttcga	Protospacer
   ******* ** ************ .   *

47. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

48. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

49. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

50. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

51. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

52. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

53. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

54. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

55. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

56. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

57. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

58. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

59. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

60. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

61. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

62. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

63. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

64. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

65. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

66. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

67. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

68. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

69. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

70. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

71. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

72. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

73. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

74. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

75. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

76. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

77. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

78. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

79. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

80. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

81. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

82. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

83. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

84. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

85. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

86. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

87. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

88. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

89. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

90. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

91. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

92. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

93. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

94. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

95. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

96. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

97. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

98. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

99. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

100. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

101. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

102. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

103. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

104. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

105. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

106. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

107. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

108. spacer 2.6|1100136|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

109. spacer 2.8|1100258|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.688

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
agctgaatatggggaaaatgcacaatatcccc	Protospacer
   ***************.* ***** * ...

110. spacer 2.11|1100441|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041349 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence) position: , mismatch: 10, identity: 0.688

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gacggacaggccgccacggttgccatcaggaa	Protospacer
   **********. ***********...*  

111. spacer 2.11|1100441|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041350 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pB, complete sequence) position: , mismatch: 10, identity: 0.688

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gatggacaggctgtgacggtcgccatcaggaa	Protospacer
   ********.********.*****...*  

112. spacer 2.11|1100441|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP004365 (Komagataeibacter xylinus E25 plasmid pGX5, complete sequence) position: , mismatch: 10, identity: 0.688

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gatggacaggctgtgacggtcgccatcaggaa	Protospacer
   ********.********.*****...*  

113. spacer 2.13|1100563|32|NZ_CP017631|CRISPRCasFinder,CRT matches to NC_047894 (Pseudomonas phage uligo, complete genome) position: , mismatch: 10, identity: 0.688

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactcgatgcgatgatggaggcagaagc	Protospacer
******** ************** .. .    

114. spacer 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to MN694016 (Marine virus AFVG_250M811, complete genome) position: , mismatch: 11, identity: 0.667

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatactt	Protospacer
 .  .*********.***********.**.   

115. spacer 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to MN694190 (Marine virus AFVG_250M608, complete genome) position: , mismatch: 11, identity: 0.667

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatacct	Protospacer
 .  .*********.***********.**.   

116. spacer 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to MN693920 (Marine virus AFVG_250M810, complete genome) position: , mismatch: 11, identity: 0.667

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatactt	Protospacer
 .  .*********.***********.**.   

117. spacer 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to MN693800 (Marine virus AFVG_250M813, complete genome) position: , mismatch: 11, identity: 0.667

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatactt	Protospacer
 .  .*********.***********.**.   

118. spacer 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to MN694554 (Marine virus AFVG_250M812, complete genome) position: , mismatch: 11, identity: 0.667

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatactt	Protospacer
 .  .*********.***********.**.   

119. spacer 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to MN694404 (Marine virus AFVG_250M623, complete genome) position: , mismatch: 11, identity: 0.667

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatacct	Protospacer
 .  .*********.***********.**.   

120. spacer 1.1|1073765|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to MN694355 (Marine virus AFVG_250M627, complete genome) position: , mismatch: 11, identity: 0.667

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatactt	Protospacer
 .  .*********.***********.**.   

121. spacer 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctccccaagtgccg	Protospacer
  *******.************ ***.   .. 

122. spacer 1.4|1073948|33|NZ_CP017631|PILER-CR,CRISPRCasFinder matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctctccaagtgccg	Protospacer
  *******.************ ***.   .. 

123. spacer 1.9|1073766|32|NZ_CP017631|CRT matches to MN694191 (Marine virus AFVG_250M444, complete genome) position: , mismatch: 11, identity: 0.656

cggcccataatattaatataatccacatgagg	CRISPR spacer
gttaatgtaatattattataatcaacatgacc	Protospacer
     ..******** ******* ******  

124. spacer 1.9|1073766|32|NZ_CP017631|CRT matches to MN694065 (Marine virus AFVG_250M443, complete genome) position: , mismatch: 11, identity: 0.656

cggcccataatattaatataatccacatgagg	CRISPR spacer
gttaatgtaatattattataatcaacatgacc	Protospacer
     ..******** ******* ******  

125. spacer 2.7|1100197|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to MT344105 (Acinetobacter phage fLi-Aba03, complete genome) position: , mismatch: 11, identity: 0.656

atttcatcaaagcattaagggatggaataaag	CRISPR spacer
ctttcatcaaagtattaatggatgatggttca	Protospacer
 ***********.***** *****. .    .

126. spacer 2.7|1100197|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to MT344104 (Acinetobacter phage fLi-Aba02, complete genome) position: , mismatch: 11, identity: 0.656

atttcatcaaagcattaagggatggaataaag	CRISPR spacer
ctttcatcaaagtattaatggatgatggttca	Protospacer
 ***********.***** *****. .    .

127. spacer 2.7|1100197|32|NZ_CP017631|PILER-CR,CRISPRCasFinder,CRT matches to MT344103 (Acinetobacter phage fEg-Aba01, complete genome) position: , mismatch: 11, identity: 0.656

atttcatcaaagcattaagggatggaataaag	CRISPR spacer
ctttcatcaaagtattaatggatgatggttca	Protospacer
 ***********.***** *****. .    .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 818774 : 886639 59 Staphylococcus_phage(40.0%) transposase,integrase,tRNA,protease attL 836783:836800|attR 884795:884812
DBSCAN-SWA_2 1107987 : 1121170 12 Escherichia_phage(40.0%) NA NA
DBSCAN-SWA_3 1772536 : 1781978 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 1820477 : 1882999 76 Enterobacteria_phage(35.71%) terminase,tail,protease,holin,lysis,capsid,transposase,integrase,tRNA,head,portal attL 1812811:1812827|attR 1839086:1839102
DBSCAN-SWA_5 1996740 : 2103549 100 Enterobacteria_phage(39.34%) terminase,tail,holin,capsid,transposase,integrase,tRNA,head,portal attL 2087496:2087521|attR 2097987:2098012
DBSCAN-SWA_6 2206072 : 2264269 67 Enterobacteria_phage(42.55%) terminase,tail,protease,holin,integrase,portal attL 2205908:2205930|attR 2248425:2248447
DBSCAN-SWA_7 2339252 : 2409914 73 Escherichia_phage(41.07%) terminase,coat,tail,holin,lysis,transposase,tRNA NA
DBSCAN-SWA_8 3038159 : 3091283 67 Enterobacteria_phage(40.38%) terminase,tail,holin,capsid,transposase,integrase,head,portal attL 3052407:3052422|attR 3101961:3101976
DBSCAN-SWA_9 3177044 : 3207447 28 Stx2-converting_phage(23.08%) transposase NA
DBSCAN-SWA_10 3379055 : 3454423 58 Pseudomonas_phage(12.5%) transposase,integrase,tRNA,protease attL 3393869:3393887|attR 3455836:3455854
DBSCAN-SWA_11 3530825 : 3636666 120 Escherichia_phage(31.71%) terminase,tail,protease,holin,lysis,capsid,transposase,integrase,head,portal attL 3550053:3550087|attR 3638100:3638134
DBSCAN-SWA_12 4145744 : 4158200 13 Enterobacteria_phage(33.33%) integrase attL 4150330:4150342|attR 4154244:4154256
DBSCAN-SWA_13 4841765 : 4888180 56 Enterobacteria_phage(46.3%) terminase,tail,protease,lysis,transposase,tRNA,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage