Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015369 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 1 crisprs c2c4_V-U1 0 1 1 0
NZ_CP015367 Methylobacterium phyllosphaerae strain CBMB27 chromosome, complete genome 2 crisprs WYL,DEDDh,RT,csa3 0 0 2 0
NZ_CP015370 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP015368
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015368_1 126475-126581 TypeV-U1 NA
1 spacers
c2c4_V-U1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015368_1 1.1|126499|59|NZ_CP015368|CRISPRCasFinder 126499-126557 59 NZ_JX627580 Methylobacterium oryzae CBMB20 plasmid pMOC1, complete sequence 23497-23555 0 1.0
NZ_CP015368_1 1.1|126499|59|NZ_CP015368|CRISPRCasFinder 126499-126557 59 NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 126499-126557 0 1.0
NZ_CP015368_1 1.1|126499|59|NZ_CP015368|CRISPRCasFinder 126499-126557 59 NZ_JX627580 Methylobacterium oryzae CBMB20 plasmid pMOC1, complete sequence 23414-23472 1 0.983
NZ_CP015368_1 1.1|126499|59|NZ_CP015368|CRISPRCasFinder 126499-126557 59 NZ_JX627580 Methylobacterium oryzae CBMB20 plasmid pMOC1, complete sequence 23580-23638 2 0.966

1. spacer 1.1|126499|59|NZ_CP015368|CRISPRCasFinder matches to NZ_JX627580 (Methylobacterium oryzae CBMB20 plasmid pMOC1, complete sequence) position: , mismatch: 0, identity: 1.0

acacgatcctgacagctgtcaggatccggctgtcgccttcgaactccctgatcgacctg	CRISPR spacer
acacgatcctgacagctgtcaggatccggctgtcgccttcgaactccctgatcgacctg	Protospacer
***********************************************************

2. spacer 1.1|126499|59|NZ_CP015368|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 0, identity: 1.0

acacgatcctgacagctgtcaggatccggctgtcgccttcgaactccctgatcgacctg	CRISPR spacer
acacgatcctgacagctgtcaggatccggctgtcgccttcgaactccctgatcgacctg	Protospacer
***********************************************************

3. spacer 1.1|126499|59|NZ_CP015368|CRISPRCasFinder matches to NZ_JX627580 (Methylobacterium oryzae CBMB20 plasmid pMOC1, complete sequence) position: , mismatch: 1, identity: 0.983

acacgatcctgacagctgtcaggatccggctgtcgccttcgaactccctgatcgacctg	CRISPR spacer
acacgatcctgacagctgtcaggatccggctgtcgccttcgagctccctgatcgacctg	Protospacer
******************************************.****************

4. spacer 1.1|126499|59|NZ_CP015368|CRISPRCasFinder matches to NZ_JX627580 (Methylobacterium oryzae CBMB20 plasmid pMOC1, complete sequence) position: , mismatch: 2, identity: 0.966

acacgatcctgacagctgtcaggatccggctgtcgccttcgaactccctgatcgacctg	CRISPR spacer
gcacgatcctgacagctgtcaggatccggctgtcgccttcgagctccctgatcgacctg	Protospacer
.*****************************************.****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 16970 : 69743 19 Enterobacteria_phage(28.57%) transposase,integrase attL 8760:8775|attR 39047:39062
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP015367
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015367_1 1642157-1642282 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015367_2 3297319-3297414 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1210973 : 1219784 8 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 4719426 : 4736742 20 Paracoccus_phage(36.36%) head,capsid,portal,protease,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage