Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018818 Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence 0 crisprs csa3,cas3,RT 0 0 1 0
NZ_CP018819 Klebsiella pneumoniae strain AR_0049 plasmid unitig_3, complete sequence 0 crisprs RT 0 0 3 0
NZ_CP018817 Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence 0 crisprs DEDDh 0 0 0 0
NZ_CP018816 Klebsiella pneumoniae strain AR_0049 chromosome, complete genome 2 crisprs cas3,csa3,RT,DEDDh,DinG,WYL 0 1 11 0

Results visualization

1. NZ_CP018816
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018816_1 4851300-4851395 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018816_2 5324521-5324615 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018816_1 1.1|4851330|36|NZ_CP018816|CRISPRCasFinder 4851330-4851365 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP018816_1 1.1|4851330|36|NZ_CP018816|CRISPRCasFinder 4851330-4851365 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP018816_1 1.1|4851330|36|NZ_CP018816|CRISPRCasFinder 4851330-4851365 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 1.1|4851330|36|NZ_CP018816|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 1.1|4851330|36|NZ_CP018816|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 1.1|4851330|36|NZ_CP018816|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 105380 : 111205 8 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_2 1203396 : 1236654 34 uncultured_Caudovirales_phage(75.0%) tRNA,tail,portal,terminase,head,capsid,integrase,protease attL 1221004:1221021|attR 1236999:1237016
DBSCAN-SWA_3 1991929 : 2038164 61 Salmonella_phage(83.72%) coat,tail,tRNA,portal,lysis,terminase,head,capsid,integrase,plate attL 1990223:1990269|attR 2026790:2026836
DBSCAN-SWA_4 2142880 : 2208964 72 Salmonella_phage(37.04%) transposase,tail,holin,terminase,head,integrase,protease attL 2143875:2143892|attR 2211712:2211729
DBSCAN-SWA_5 2552097 : 2570779 18 Shigella_phage(20.0%) transposase NA
DBSCAN-SWA_6 3537801 : 3547215 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_7 3772145 : 3813887 62 Klebsiella_phage(34.04%) integrase,terminase attL 3805000:3805014|attR 3811009:3811023
DBSCAN-SWA_8 3846820 : 3855390 8 Salmonella_phage(25.0%) transposase NA
DBSCAN-SWA_9 3858884 : 3872597 20 Enterobacteria_phage(43.75%) integrase,transposase attL 3860248:3860262|attR 3872360:3872374
DBSCAN-SWA_10 4277778 : 4370729 97 Salmonella_phage(57.63%) tail,tRNA,lysis,portal,terminase,head,capsid,integrase,protease,plate attL 4333304:4333322|attR 4370804:4370822
DBSCAN-SWA_11 4817145 : 4862420 65 Escherichia_phage(26.42%) head,lysis,tRNA,integrase attL 4810358:4810404|attR 4859492:4859538
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP018818
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 43824 : 85048 38 Escherichia_phage(44.44%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP018819
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 65193 65 Escherichia_phage(30.0%) transposase,integrase attL 24627:24686|attR 69118:69939
DBSCAN-SWA_2 69180 : 70748 2 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_3 76883 : 84613 9 Escherichia_phage(50.0%) integrase attL 70331:70344|attR 81730:81743
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage