Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018776 Staphylococcus condimenti strain StO 2014-01 chromosome, complete genome 1 crisprs csa3,WYL,cas14j,DEDDh,cas3,c2c9_V-U4,DinG 0 1 7 0
NZ_CP018777 Staphylococcus condimenti strain StO 2014-01 plasmid pStO2014-01, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP018776
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018776_1 2597862-2597940 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018776_1 1.1|2597887|29|NZ_CP018776|CRISPRCasFinder 2597887-2597915 29 NC_007021 Staphylococcus phage Twort, complete genome 81319-81347 7 0.759
NZ_CP018776_1 1.1|2597887|29|NZ_CP018776|CRISPRCasFinder 2597887-2597915 29 MT151386 Staphylococcus virus Twort, complete genome 123848-123876 7 0.759

1. spacer 1.1|2597887|29|NZ_CP018776|CRISPRCasFinder matches to NC_007021 (Staphylococcus phage Twort, complete genome) position: , mismatch: 7, identity: 0.759

taattattcatcaaactatatccttaatt	CRISPR spacer
aacccactcatcgaactatatccttaata	Protospacer
 * ..*.*****.*************** 

2. spacer 1.1|2597887|29|NZ_CP018776|CRISPRCasFinder matches to MT151386 (Staphylococcus virus Twort, complete genome) position: , mismatch: 7, identity: 0.759

taattattcatcaaactatatccttaatt	CRISPR spacer
aacccactcatcgaactatatccttaata	Protospacer
 * ..*.*****.*************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 645565 : 706107 52 Bacillus_phage(30.0%) protease,transposase,holin NA
DBSCAN-SWA_2 1085166 : 1100559 21 uncultured_Caudovirales_phage(55.56%) terminase,integrase,coat attL 1087098:1087115|attR 1103959:1103976
DBSCAN-SWA_3 1235323 : 1266830 32 Staphylococcus_phage(96.15%) tRNA NA
DBSCAN-SWA_4 1379942 : 1389083 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_5 1504935 : 1513512 11 Staphylococcus_phage(28.57%) transposase NA
DBSCAN-SWA_6 1943503 : 2016172 94 Staphylococcus_virus(31.25%) transposase,head,holin,plate,tail,terminase,capsid,portal NA
DBSCAN-SWA_7 2255675 : 2264532 7 uncultured_Caudovirales_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage