Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010234 Escherichia coli strain S30 plasmid C, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP010231 Escherichia coli strain S30 chromosome, complete genome 6 crisprs cas3,c2c9_V-U4,DEDDh,DinG,WYL,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK,RT 0 12 6 0
NZ_CP010233 Escherichia coli strain S30 plasmid B, complete sequence 0 crisprs csa3,DEDDh 0 0 1 0
NZ_CP010232 Escherichia coli strain S30 plasmid A, complete sequence 0 crisprs DEDDh 0 0 2 0

Results visualization

1. NZ_CP010234
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 817 : 99387 58 Escherichia_phage(55.88%) integrase,protease,transposase,plate attL 24035:24094|attR 98103:99433
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP010231
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010231_1 1676984-1677110 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010231_2 2181309-2181703 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010231_3 2208753-2209269 Orphan I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010231_4 3941317-3941458 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010231_5 4351906-4352050 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010231_6 4492193-4492289 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
NZ_CP010231_2 2.1|2181338|32|NZ_CP010231|CRT 2181338-2181369 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 2 0.938
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
NZ_CP010231_2 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181399-2181430 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
NZ_CP010231_3 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT 2208965-2208996 32 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3605 3 0.906
NZ_CP010231_3 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT 2208965-2208996 32 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3598 3 0.906
NZ_CP010231_3 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT 2208965-2208996 32 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21074 3 0.906
NZ_CP010231_3 3.12|2208965|33|NZ_CP010231|PILER-CR 2208965-2208997 33 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3606 4 0.879
NZ_CP010231_3 3.12|2208965|33|NZ_CP010231|PILER-CR 2208965-2208997 33 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3599 4 0.879
NZ_CP010231_3 3.12|2208965|33|NZ_CP010231|PILER-CR 2208965-2208997 33 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21075 4 0.879
NZ_CP010231_3 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT 2208965-2208996 32 KY653119 Morganella phage IME1369_02, complete genome 18217-18248 5 0.844
NZ_CP010231_3 3.12|2208965|33|NZ_CP010231|PILER-CR 2208965-2208997 33 KY653119 Morganella phage IME1369_02, complete genome 18216-18248 6 0.818
NZ_CP010231_2 2.1|2181338|32|NZ_CP010231|CRT 2181338-2181369 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
NZ_CP010231_3 3.3|2208904|32|NZ_CP010231|CRISPRCasFinder,CRT 2208904-2208935 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755173-755204 7 0.781
NZ_CP010231_2 2.1|2181338|32|NZ_CP010231|CRT 2181338-2181369 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 8 0.75
NZ_CP010231_2 2.1|2181338|32|NZ_CP010231|CRT 2181338-2181369 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
NZ_CP010231_2 2.6|2181643|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181643-2181674 32 MF773750 Mycobacterium phage OKCentral2016, complete genome 32038-32069 8 0.75
NZ_CP010231_2 2.6|2181643|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder 2181643-2181674 32 JX307704 Mycobacterium virus Goose, complete genome 32135-32166 8 0.75
NZ_CP010231_3 3.3|2208904|32|NZ_CP010231|CRISPRCasFinder,CRT 2208904-2208935 32 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 191920-191951 8 0.75
NZ_CP010231_3 3.7|2209148|32|NZ_CP010231|CRISPRCasFinder,CRT 2209148-2209179 32 NZ_CP015231 Epibacterium mobile F1926 plasmid unnamed1, complete sequence 965187-965218 8 0.75
NZ_CP010231_3 3.11|2208904|33|NZ_CP010231|PILER-CR 2208904-2208936 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
NZ_CP010231_4 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder 3941358-3941417 60 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4158-4217 8 0.867
NZ_CP010231_4 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder 3941358-3941417 60 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4157-4216 8 0.867
NZ_CP010231_4 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder 3941358-3941417 60 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 115798-115857 8 0.867
NZ_CP010231_4 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder 3941358-3941417 60 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4157-4216 8 0.867
NZ_CP010231_4 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder 3941358-3941417 60 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4157-4216 8 0.867
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229083-229131 9 0.816
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229184-229232 9 0.816
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229285-229333 9 0.816
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239577-239625 9 0.816
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239678-239726 9 0.816
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239779-239827 9 0.816
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230489-230537 9 0.816
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230590-230638 9 0.816
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230691-230739 9 0.816
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211459-211507 9 0.816
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211560-211608 9 0.816
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211661-211709 9 0.816
NZ_CP010231_3 3.5|2209026|32|NZ_CP010231|CRISPRCasFinder,CRT 2209026-2209057 32 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 246573-246604 9 0.719
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229386-229434 10 0.796
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239880-239928 10 0.796
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230792-230840 10 0.796
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211762-211810 10 0.796
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7442-7490 10 0.796
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84266-84314 10 0.796
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386508-386556 10 0.796
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14196-14244 10 0.796
NZ_CP010231_3 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT 2208965-2208996 32 MF158039 Shigella phage Sf12, complete genome 4975-5006 10 0.688
NZ_CP010231_3 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT 2208965-2208996 32 MF158042 Shigella phage Sd1, complete genome 938-969 10 0.688
NZ_CP010231_5 5.1|4351949|59|NZ_CP010231|CRISPRCasFinder 4351949-4352007 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194003-194051 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194096-194144 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194282-194330 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204497-204545 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204590-204638 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204776-204824 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195331-195379 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195424-195472 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195610-195658 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176286-176334 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176379-176427 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176565-176613 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27282-27330 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27381-27429 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51834-51882 11 0.776
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 19389-19437 11 0.776
NZ_CP010231_3 3.12|2208965|33|NZ_CP010231|PILER-CR 2208965-2208997 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
NZ_CP010231_3 3.12|2208965|33|NZ_CP010231|PILER-CR 2208965-2208997 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667
NZ_CP010231_4 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder 3941358-3941417 60 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7435-7494 11 0.817
NZ_CP010231_4 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder 3941358-3941417 60 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84259-84318 11 0.817
NZ_CP010231_5 5.1|4351949|59|NZ_CP010231|CRISPRCasFinder 4351949-4352007 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211730-211778 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211930-211978 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194189-194237 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222224-222272 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222424-222472 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204683-204731 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213058-213106 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213258-213306 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195517-195565 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194013-194061 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194213-194261 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176472-176520 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 11511-11559 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397088-397136 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404133-404181 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 27994-28042 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31299-31347 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 33059-33107 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 141016-141064 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 MF374379 Escherichia phage DN1, complete genome 31158-31206 12 0.755
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14105-14153 13 0.735
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 6859-6907 13 0.735
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NC_049343 Escherichia phage 500465-2, complete genome 31797-31845 13 0.735
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 94-142 13 0.735
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 82842-82890 14 0.714
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313592-313640 14 0.714
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 63889-63937 14 0.714
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 110186-110234 14 0.714
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 198909-198957 14 0.714
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40305-40353 14 0.714
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 91418-91466 14 0.714
NZ_CP010231_4 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder 3941358-3941417 60 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40377-40436 14 0.767
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 102544-102592 15 0.694
NZ_CP010231_1 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder 1677023-1677071 49 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56031-56079 15 0.694

1. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

2. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

3. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

4. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

5. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

6. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

7. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

8. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

9. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

10. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

11. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

12. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

13. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

14. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

15. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

16. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

17. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

18. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

19. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

20. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

21. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

22. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

23. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

24. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

25. spacer 2.1|2181338|32|NZ_CP010231|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

caagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
********.*********************.*

26. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc	Protospacer
******************* ********.***

27. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc	Protospacer
******************* ********.***

28. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc	Protospacer
********* *****.****************

29. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc	Protospacer
********* *****.****************

30. spacer 2.2|2181399|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcataacgtgtttttacc	Protospacer
***************** * ************

31. spacer 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaaccc	Protospacer
********************.*****.*** *

32. spacer 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 3, identity: 0.906

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaaccc	Protospacer
********************.*****.*** *

33. spacer 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 3, identity: 0.906

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaaccc	Protospacer
********************.*****.*** *

34. spacer 3.12|2208965|33|NZ_CP010231|PILER-CR matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

35. spacer 3.12|2208965|33|NZ_CP010231|PILER-CR matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

36. spacer 3.12|2208965|33|NZ_CP010231|PILER-CR matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

37. spacer 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 5, identity: 0.844

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
gaaatgctggtcagcgttaacgccgcacaacc	Protospacer
*********** ********.****** *  *

38. spacer 3.12|2208965|33|NZ_CP010231|PILER-CR matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.818

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtcagcgttaacgccgcacaacct	Protospacer
*********** ********.****** *  * 

39. spacer 2.1|2181338|32|NZ_CP010231|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

caagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

40. spacer 3.3|2208904|32|NZ_CP010231|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

tggctctgcaacagcagcacccatgaccacgt	CRISPR spacer
cgctccagcaacagcagcacccacgaccacgg	Protospacer
.* ..* ****************.******* 

41. spacer 2.1|2181338|32|NZ_CP010231|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75

caagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
*  .* ..***********  ***********

42. spacer 2.1|2181338|32|NZ_CP010231|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

caagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

43. spacer 2.6|2181643|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to MF773750 (Mycobacterium phage OKCentral2016, complete genome) position: , mismatch: 8, identity: 0.75

cgtccggatcggtttcgagaatctctacgctc	CRISPR spacer
cgccgagatcggcttcgaggatctctacgagg	Protospacer
**.* .******.******.*********   

44. spacer 2.6|2181643|32|NZ_CP010231|CRT,PILER-CR,CRISPRCasFinder matches to JX307704 (Mycobacterium virus Goose, complete genome) position: , mismatch: 8, identity: 0.75

cgtccggatcggtttcgagaatctctacgctc	CRISPR spacer
cgccgagatcggcttcgaggatctctacgagg	Protospacer
**.* .******.******.*********   

45. spacer 3.3|2208904|32|NZ_CP010231|CRISPRCasFinder,CRT matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggctctgcaacagcagcacccatgaccacgt	CRISPR spacer
catcactgcaacatcagcatccatgaccgcat	Protospacer
.. * ******** *****.********.*.*

46. spacer 3.7|2209148|32|NZ_CP010231|CRISPRCasFinder,CRT matches to NZ_CP015231 (Epibacterium mobile F1926 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgaatcacgccccgctttttaccgcgtcagcg	CRISPR spacer
caatgcccgctccgccttttaccgcgtcagtc	Protospacer
*.*  * ***.****.**************. 

47. spacer 3.11|2208904|33|NZ_CP010231|PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

tggctctgcaacagcagcacccatgaccacgtc	CRISPR spacer
cgctccagcaacagcagcacccacgaccacgga	Protospacer
.* ..* ****************.*******  

48. spacer 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.867

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

49. spacer 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.867

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

50. spacer 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 8, identity: 0.867

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

51. spacer 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.867

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

52. spacer 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.867

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

53. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

54. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

55. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

56. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

57. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

58. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

59. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

60. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

61. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

62. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

63. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

64. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

65. spacer 3.5|2209026|32|NZ_CP010231|CRISPRCasFinder,CRT matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

attacgcctttttgcgattgcccggtttttgc	CRISPR spacer
tcgtcatctttttgcgattgggcggttttttc	Protospacer
 .  *..*************  ******** *

66. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

67. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

68. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

69. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

70. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

71. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

72. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga--	CRISPR spacer
cacaagtgccggatgcggcgtaaacgccttatccggcctacg--ccagact	Protospacer
. *..***********.****.********************  .*.**  

73. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gctggttgccggatgcggcgtgaacgccttatccggcctacattcggca	Protospacer
 *.** **********.************************. .. * *

74. spacer 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 10, identity: 0.688

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
cggcacttggggagcgttaatgctgcaaacaa	Protospacer
 ..   .*** ************.******* 

75. spacer 3.4|2208965|32|NZ_CP010231|CRISPRCasFinder,CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 10, identity: 0.688

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
cggcacttggagagcgttaatgctgcaaacaa	Protospacer
 ..   .*** ************.******* 

76. spacer 5.1|4351949|59|NZ_CP010231|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831

ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg-	CRISPR spacer
gagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgat-cgtgcactga	Protospacer
*.   ************ ****************************.**  **** *.* 

77. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

78. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

79. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

80. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

81. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

82. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

83. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

84. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

85. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

86. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

87. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

88. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

89. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagc	Protospacer
. *.. .*********.************************** * .* 

90. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagt	Protospacer
. *.. .*********.************************** * .* 

91. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agctggtgccggatgcggcgtaaacgccttatccggcctacaaatgcgc	Protospacer
  * ************.****.*******************.. *  * 

92. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggtgtgaacgccttatccggcctacggatggcc	Protospacer
* .  .**********.*.************************ * *  

93. spacer 3.12|2208965|33|NZ_CP010231|PILER-CR matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
cggcacttggggagcgttaatgctgcaaacaat	Protospacer
 ..   .*** ************.*******  

94. spacer 3.12|2208965|33|NZ_CP010231|PILER-CR matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
cggcacttggagagcgttaatgctgcaaacaat	Protospacer
 ..   .*** ************.*******  

95. spacer 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 11, identity: 0.817

ggtttgtgccgaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgcac	CRISPR spacer
aaactgcactcaaccgtaggccggataaggcgttcacgccgcatccggcaatt-gtgcac	Protospacer
.. .**..*. ***************************************.** *.****

96. spacer 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 11, identity: 0.817

ggtttgtgccgaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgcac	CRISPR spacer
aaactgcactcaaccgtaggccggataaggcgttcacgccgcatccggcaatt-gtgcac	Protospacer
.. .**..*. ***************************************.** *.****

97. spacer 5.1|4351949|59|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814

-ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg	CRISPR spacer
tcgcacca-aaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgtacc	Protospacer
  *..*** ***********************.**************** ***.  * * 

98. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

99. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

100. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

101. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

102. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

103. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

104. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

105. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

106. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

107. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

108. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

109. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

110. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
aatttttgccggatgcggcgtgaacgccttatccggcctacaacgggca	Protospacer
  .   **********.************************..*  * *

111. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga---	CRISPR spacer
cacaattgccggatgcggcgtaaacgccttatccggcctaca---tggataa	Protospacer
. *.. **********.****.*******************.   .***   

112. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttttcttgccggatgcggcgtaaacgccttatccggcctacaggacgtg	Protospacer
*..   **********.****.*******************.*  ** .

113. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ctcaaatgccggatgcggcgtgaacgccttatccggcctacgcacacta	Protospacer
..*...**********.*************************  .   *

114. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agcaaatgccggatgcggcgtaaacgccttatccggcctacatttggca	Protospacer
  *...**********.****.*******************. .* * *

115. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

116. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

117. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to MF374379 (Escherichia phage DN1, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtgaacgccttatccggcctacaaaccgcg	Protospacer
* .  .**********.************************.. .** .

118. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gttgattgccggatgcggcgtaaacgccttatccggcctacattcggca	Protospacer
 ..*. **********.****.*******************. .. * *

119. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttgttttgccggatgcggcgtgaacgccttatccggcctacaaaaccat	Protospacer
*.    **********.************************..  * . 

120. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtgtttgccggatgcggcgtgaacgccttatccgacctacgtgtgacg	Protospacer
  .*  **********.******************.******  * . .

121. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttatgttgccggatgcggcgtaaacgccttatccggcctacaaaagcaa	Protospacer
*.  * **********.****.*******************..    .*

122. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gtaaaatgccggatgcggcgtgaacgccttatccggcctacaaaccaag	Protospacer
 . ...**********.************************.. .*...

123. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acaaaatgccggatgcggcgtaaacgccttatccggcctacaaaatcgt	Protospacer
 * ...**********.****.*******************..  . * 

124. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

125. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

126. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

127. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtaaacgccttatccggcctacaaaaagcg	Protospacer
* .  .**********.****.*******************..   * .

128. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

129. spacer 4.1|3941358|60|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.767

ggtttgtgccgaaccgtaggccggataaggcgttcacgccgcatccggcagttgg-cgca	CRISPR spacer
cactcgcaccaaaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgta	Protospacer
 ..*.*..**.***********************.***************.  .* **.*

130. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtcaatgccggatgcggcgtgaacgccttatccggcctacaaaagcat	Protospacer
  . ..**********.************************..    . 

131. spacer 1.1|1677023|49|NZ_CP010231|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtaaacgccttatccggcctacaaaaaacg	Protospacer
. * . **********.****.*******************..   . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 454156 : 501626 63 Enterobacteria_phage(36.54%) tail,tRNA,integrase,terminase,lysis,holin,protease attL 457887:457909|attR 508215:508237
DBSCAN-SWA_2 896593 : 922086 31 Enterobacteria_phage(22.73%) lysis,tail,integrase attL 888292:888305|attR 921686:921699
DBSCAN-SWA_3 1539447 : 1548888 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 2160761 : 2173944 12 Escherichia_phage(40.0%) NA NA
DBSCAN-SWA_5 3888330 : 3968641 84 Enterobacteria_phage(44.07%) tail,tRNA,integrase,head,terminase,lysis,portal,capsid attL 3881773:3881788|attR 3908771:3908786
DBSCAN-SWA_6 4222654 : 4234487 12 Enterobacteria_phage(77.78%) integrase attL 4217790:4217802|attR 4230865:4230877
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP010233
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6776 : 13109 8 Escherichia_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP010232
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5258 : 25667 23 Escherichia_phage(62.5%) protease,integrase,transposase attL 5207:5266|attR 11420:12240
DBSCAN-SWA_2 76129 : 132194 31 Macacine_betaherpesvirus(21.43%) protease,integrase,transposase,bacteriocin attL 83191:83205|attR 98325:98339
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage