Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010154 Escherichia coli strain D9 plasmid B, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP010156 Escherichia coli strain D9 plasmid D, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010153 Escherichia coli strain D9 plasmid A, complete sequence 0 crisprs DEDDh 0 0 3 0
NZ_CP010152 Escherichia coli strain D9 chromosome, complete genome 6 crisprs DEDDh,DinG,cas3,c2c9_V-U4,csa3,cas2,cas1,cas6e,cas5,PD-DExK 0 10 7 0
NZ_CP010155 Escherichia coli strain D9 plasmid C, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP010154
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 41847 : 59074 13 Enterobacteria_phage(54.55%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP010153
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2277 : 35151 35 Salmonella_phage(100.0%) terminase,portal,tail NA
DBSCAN-SWA_2 42730 : 95549 51 Salmonella_phage(82.98%) integrase attL 54136:54159|attR 106624:106647
DBSCAN-SWA_3 102344 : 112030 14 Salmonella_phage(72.73%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP010152
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010152_1 444680-444813 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010152_2 970698-970842 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010152_3 1110884-1110980 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010152_4 2961578-2961704 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010152_5 3453998-3454514 Unclear I-E
8 spacers
cas2,cas1,cas6e,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010152_6 3476671-3477064 Orphan I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010152_6 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT 3476943-3476975 33 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3606 4 0.879
NZ_CP010152_6 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT 3476943-3476975 33 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3599 4 0.879
NZ_CP010152_6 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT 3476943-3476975 33 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21075 4 0.879
NZ_CP010152_5 5.7|3454393|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454393-3454424 32 NC_021229 Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919 65474-65505 5 0.844
NZ_CP010152_6 6.5|3476941|35|NZ_CP010152|PILER-CR 3476941-3476975 35 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3572-3606 5 0.857
NZ_CP010152_6 6.5|3476941|35|NZ_CP010152|PILER-CR 3476941-3476975 35 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3565-3599 5 0.857
NZ_CP010152_6 6.5|3476941|35|NZ_CP010152|PILER-CR 3476941-3476975 35 KY271401 Klebsiella phage 1 LV-2017, complete genome 21041-21075 5 0.857
NZ_CP010152_5 5.7|3454393|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454393-3454424 32 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 208287-208318 6 0.812
NZ_CP010152_5 5.8|3454454|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454454-3454485 32 NZ_CP009293 Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence 152196-152227 6 0.812
NZ_CP010152_6 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT 3476943-3476975 33 KY653119 Morganella phage IME1369_02, complete genome 18216-18248 6 0.818
NZ_CP010152_5 5.5|3454271|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454271-3454302 32 MF351863 Synechococcus phage Bellamy, complete genome 123998-124029 7 0.781
NZ_CP010152_5 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454332-3454363 32 MK416018 Klebsiella phage ST147-VIM1phi7.1, complete genome 24790-24821 7 0.781
NZ_CP010152_6 6.5|3476941|35|NZ_CP010152|PILER-CR 3476941-3476975 35 KY653119 Morganella phage IME1369_02, complete genome 18216-18250 7 0.8
NZ_CP010152_5 5.1|3454027|32|NZ_CP010152|CRISPRCasFinder,CRT 3454027-3454058 32 NZ_AP018516 Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence 48296-48327 8 0.75
NZ_CP010152_5 5.7|3454393|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454393-3454424 32 MK113951 Phage 5P_3, complete genome 11967-11998 8 0.75
NZ_CP010152_5 5.7|3454393|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454393-3454424 32 AP017924 Ralstonia phage RP12 DNA, complete genome 11643-11674 8 0.75
NZ_CP010152_5 5.8|3454454|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454454-3454485 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 750410-750441 8 0.75
NZ_CP010152_6 6.10|3476882|33|NZ_CP010152|CRISPRCasFinder,CRT 3476882-3476914 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229083-229131 9 0.816
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229184-229232 9 0.816
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229285-229333 9 0.816
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239577-239625 9 0.816
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239678-239726 9 0.816
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239779-239827 9 0.816
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230489-230537 9 0.816
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230590-230638 9 0.816
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230691-230739 9 0.816
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211459-211507 9 0.816
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211560-211608 9 0.816
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211661-211709 9 0.816
NZ_CP010152_5 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454332-3454363 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 1143591-1143622 9 0.719
NZ_CP010152_5 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454332-3454363 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 891493-891524 9 0.719
NZ_CP010152_5 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454332-3454363 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 1143594-1143625 9 0.719
NZ_CP010152_5 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454332-3454363 32 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 315030-315061 9 0.719
NZ_CP010152_5 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454332-3454363 32 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 1123532-1123563 9 0.719
NZ_CP010152_5 5.8|3454454|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454454-3454485 32 MN234174 Mycobacterium phage Efra2, complete genome 35614-35645 9 0.719
NZ_CP010152_5 5.8|3454454|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454454-3454485 32 MN234165 Mycobacterium phage Yunkel11, complete genome 35570-35601 9 0.719
NZ_CP010152_5 5.8|3454454|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454454-3454485 32 MN234201 Mycobacterium phage Guanica15, complete genome 35571-35602 9 0.719
NZ_CP010152_2 2.1|970741|59|NZ_CP010152|CRISPRCasFinder 970741-970799 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229386-229434 10 0.796
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239880-239928 10 0.796
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230792-230840 10 0.796
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211762-211810 10 0.796
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7442-7490 10 0.796
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84266-84314 10 0.796
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386508-386556 10 0.796
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14196-14244 10 0.796
NZ_CP010152_5 5.7|3454393|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR 3454393-3454424 32 NC_002580 Propionibacterium freudenreichii plasmid p545, complete sequence 2898-2929 10 0.688
NZ_CP010152_2 2.1|970741|59|NZ_CP010152|CRISPRCasFinder 970741-970799 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194003-194051 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194096-194144 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194282-194330 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204497-204545 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204590-204638 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204776-204824 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195331-195379 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195424-195472 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195610-195658 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176286-176334 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176379-176427 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176565-176613 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27282-27330 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27381-27429 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51834-51882 11 0.776
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 19389-19437 11 0.776
NZ_CP010152_6 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT 3476943-3476975 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
NZ_CP010152_6 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT 3476943-3476975 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211730-211778 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211930-211978 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194189-194237 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222224-222272 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222424-222472 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204683-204731 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213058-213106 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213258-213306 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195517-195565 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194013-194061 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194213-194261 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176472-176520 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 11511-11559 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397088-397136 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404133-404181 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 27994-28042 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31299-31347 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 33059-33107 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 141016-141064 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 MF374379 Escherichia phage DN1, complete genome 31158-31206 12 0.755
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14105-14153 13 0.735
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 6859-6907 13 0.735
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NC_049343 Escherichia phage 500465-2, complete genome 31797-31845 13 0.735
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 94-142 13 0.735
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 82842-82890 14 0.714
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313592-313640 14 0.714
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 63889-63937 14 0.714
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 110186-110234 14 0.714
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 198909-198957 14 0.714
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40305-40353 14 0.714
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 91418-91466 14 0.714
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 102544-102592 15 0.694
NZ_CP010152_4 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder 2961617-2961665 49 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56031-56079 15 0.694

1. spacer 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

2. spacer 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

3. spacer 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

4. spacer 5.7|3454393|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 5, identity: 0.844

tgggcggcttgccttgcagccagctccagcag-	CRISPR spacer
tgggcggcttgcgttgcagcctgc-cgagcgga	Protospacer
************ ******** ** * ***.* 

5. spacer 6.5|3476941|35|NZ_CP010152|PILER-CR matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 5, identity: 0.857

acgaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
atgaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
*.********************.*****.*** * 

6. spacer 6.5|3476941|35|NZ_CP010152|PILER-CR matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 5, identity: 0.857

acgaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
atgaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
*.********************.*****.*** * 

7. spacer 6.5|3476941|35|NZ_CP010152|PILER-CR matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 5, identity: 0.857

acgaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
atgaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
*.********************.*****.*** * 

8. spacer 5.7|3454393|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 6, identity: 0.812

tgggcggcttgccttgcagccagctccagcag-	CRISPR spacer
ggggcggcttgcgttgcagcctgc-cgagcgga	Protospacer
 *********** ******** ** * ***.* 

9. spacer 5.8|3454454|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009293 (Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence) position: , mismatch: 6, identity: 0.812

tgcgtgagcgtatcgccgcgcgtctgcgaaag	CRISPR spacer
agaatgagcgtgtcgccgcgcgtctgcgtgag	Protospacer
 * .*******.**************** .**

10. spacer 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.818

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtcagcgttaacgccgcacaacct	Protospacer
*********** ********.****** *  * 

11. spacer 5.5|3454271|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 7, identity: 0.781

atcgtccatattaacaatcgtggtgagttcaa	CRISPR spacer
atcgcccatatcaacaatcgtggtgatacctt	Protospacer
****.******.**************  .*  

12. spacer 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to MK416018 (Klebsiella phage ST147-VIM1phi7.1, complete genome) position: , mismatch: 7, identity: 0.781

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
tccatcacaccgccaaaaaacgcgctgatggg	Protospacer
 *.** .* *** **************.****

13. spacer 6.5|3476941|35|NZ_CP010152|PILER-CR matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 7, identity: 0.8

acgaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
atgaaatgctggtcagcgttaacgccgcacaacct	Protospacer
*.*********** ********.****** *  * 

14. spacer 5.1|3454027|32|NZ_CP010152|CRISPRCasFinder,CRT matches to NZ_AP018516 (Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence) position: , mismatch: 8, identity: 0.75

cagcgtcaggcgtgaaatctcaccgtcgttgc	CRISPR spacer
attctttaggcgtgacatcttaccgtcgttga	Protospacer
   * *.******** ****.********** 

15. spacer 5.7|3454393|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to MK113951 (Phage 5P_3, complete genome) position: , mismatch: 8, identity: 0.75

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
ggggcagcttgccttgcagccagccgatgctc	Protospacer
 ****.******************.   **  

16. spacer 5.7|3454393|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to AP017924 (Ralstonia phage RP12 DNA, complete genome) position: , mismatch: 8, identity: 0.75

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
tgggccgcttgccgtgcagccagcgcttccgc	Protospacer
***** ******* ********** *.  *. 

17. spacer 5.8|3454454|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgtgagcgtatcgccgcgcgtctgcgaaag-	CRISPR spacer
agcgagagcgtatcgccgcgc-ttcgtgaagcc	Protospacer
 *** **************** *..*.***.  

18. spacer 6.10|3476882|33|NZ_CP010152|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

tggctctgcaacagcagcacccatgaccacgtc	CRISPR spacer
cgctccagcaacagcagcacccacgaccacgga	Protospacer
.* ..* ****************.*******  

19. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

20. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

21. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

22. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

23. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

24. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

25. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

26. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

27. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

28. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

29. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

30. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

31. spacer 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

32. spacer 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

33. spacer 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

34. spacer 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

35. spacer 5.6|3454332|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

36. spacer 5.8|3454454|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to MN234174 (Mycobacterium phage Efra2, complete genome) position: , mismatch: 9, identity: 0.719

tgcgtgagcgtatcgccgcgcgtctgcgaaag	CRISPR spacer
gccgtgagcgtgacgccgcgcgtctggtgatc	Protospacer
  *********. *************  .*  

37. spacer 5.8|3454454|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to MN234165 (Mycobacterium phage Yunkel11, complete genome) position: , mismatch: 9, identity: 0.719

tgcgtgagcgtatcgccgcgcgtctgcgaaag	CRISPR spacer
gccgtgagcgtgacgccgcgcgtctggtgatc	Protospacer
  *********. *************  .*  

38. spacer 5.8|3454454|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to MN234201 (Mycobacterium phage Guanica15, complete genome) position: , mismatch: 9, identity: 0.719

tgcgtgagcgtatcgccgcgcgtctgcgaaag	CRISPR spacer
gccgtgagcgtgacgccgcgcgtctggtgatc	Protospacer
  *********. *************  .*  

39. spacer 2.1|970741|59|NZ_CP010152|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831

ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg-	CRISPR spacer
gagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgat-cgtgcactga	Protospacer
*.   ************ ****************************.**  **** *.* 

40. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

41. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

42. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

43. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

44. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

45. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

46. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga--	CRISPR spacer
cacaagtgccggatgcggcgtaaacgccttatccggcctacg--ccagact	Protospacer
. *..***********.****.********************  .*.**  

47. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gctggttgccggatgcggcgtgaacgccttatccggcctacattcggca	Protospacer
 *.** **********.************************. .. * *

48. spacer 5.7|3454393|32|NZ_CP010152|CRISPRCasFinder,CRT,PILER-CR matches to NC_002580 (Propionibacterium freudenreichii plasmid p545, complete sequence) position: , mismatch: 10, identity: 0.688

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
ccagcggcttgcgtggcagccagctctcaggg	Protospacer
. .********* * ***********. . .*

49. spacer 2.1|970741|59|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814

-ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg	CRISPR spacer
tcgcacca-aaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgtacc	Protospacer
  *..*** ***********************.**************** ***.  * * 

50. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

51. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

52. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

53. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

54. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

55. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

56. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

57. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

58. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

59. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

60. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

61. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

62. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagc	Protospacer
. *.. .*********.************************** * .* 

63. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagt	Protospacer
. *.. .*********.************************** * .* 

64. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agctggtgccggatgcggcgtaaacgccttatccggcctacaaatgcgc	Protospacer
  * ************.****.*******************.. *  * 

65. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggtgtgaacgccttatccggcctacggatggcc	Protospacer
* .  .**********.*.************************ * *  

66. spacer 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
cggcacttggggagcgttaatgctgcaaacaat	Protospacer
 ..   .*** ************.*******  

67. spacer 6.11|3476943|33|NZ_CP010152|CRISPRCasFinder,CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
cggcacttggagagcgttaatgctgcaaacaat	Protospacer
 ..   .*** ************.*******  

68. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

69. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

70. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

71. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

72. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

73. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

74. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

75. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

76. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

77. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

78. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

79. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

80. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
aatttttgccggatgcggcgtgaacgccttatccggcctacaacgggca	Protospacer
  .   **********.************************..*  * *

81. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga---	CRISPR spacer
cacaattgccggatgcggcgtaaacgccttatccggcctaca---tggataa	Protospacer
. *.. **********.****.*******************.   .***   

82. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttttcttgccggatgcggcgtaaacgccttatccggcctacaggacgtg	Protospacer
*..   **********.****.*******************.*  ** .

83. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ctcaaatgccggatgcggcgtgaacgccttatccggcctacgcacacta	Protospacer
..*...**********.*************************  .   *

84. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agcaaatgccggatgcggcgtaaacgccttatccggcctacatttggca	Protospacer
  *...**********.****.*******************. .* * *

85. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

86. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

87. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to MF374379 (Escherichia phage DN1, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtgaacgccttatccggcctacaaaccgcg	Protospacer
* .  .**********.************************.. .** .

88. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gttgattgccggatgcggcgtaaacgccttatccggcctacattcggca	Protospacer
 ..*. **********.****.*******************. .. * *

89. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttgttttgccggatgcggcgtgaacgccttatccggcctacaaaaccat	Protospacer
*.    **********.************************..  * . 

90. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtgtttgccggatgcggcgtgaacgccttatccgacctacgtgtgacg	Protospacer
  .*  **********.******************.******  * . .

91. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttatgttgccggatgcggcgtaaacgccttatccggcctacaaaagcaa	Protospacer
*.  * **********.****.*******************..    .*

92. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gtaaaatgccggatgcggcgtgaacgccttatccggcctacaaaccaag	Protospacer
 . ...**********.************************.. .*...

93. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acaaaatgccggatgcggcgtaaacgccttatccggcctacaaaatcgt	Protospacer
 * ...**********.****.*******************..  . * 

94. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

95. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

96. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

97. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtaaacgccttatccggcctacaaaaagcg	Protospacer
* .  .**********.****.*******************..   * .

98. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

99. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtcaatgccggatgcggcgtgaacgccttatccggcctacaaaagcat	Protospacer
  . ..**********.************************..    . 

100. spacer 4.1|2961617|49|NZ_CP010152|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtaaacgccttatccggcctacaaaaaacg	Protospacer
. * . **********.****.*******************..   . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 797542 : 851608 46 Shigella_phage(35.29%) plate,transposase,tail NA
DBSCAN-SWA_2 1344661 : 1374815 37 Enterobacteria_phage(59.46%) lysis,capsid,terminase,tail,head,portal NA
DBSCAN-SWA_3 1457594 : 1530857 85 Salmonella_phage(66.67%) plate,lysis,integrase,capsid,protease,tRNA,terminase,tail,head,portal attL 1448524:1448538|attR 1479869:1479883
DBSCAN-SWA_4 2001632 : 2045245 49 Escherichia_phage(43.59%) lysis,integrase,transposase,tRNA,terminase attL 2001267:2001282|attR 2038067:2038082
DBSCAN-SWA_5 2823993 : 2833434 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_6 2959241 : 2967850 7 Stx2-converting_phage(42.86%) transposase NA
DBSCAN-SWA_7 3433388 : 3446571 12 Escherichia_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage