Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010142 Escherichia coli strain D3 plasmid B, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010141 Escherichia coli strain D3 plasmid A, complete sequence 0 crisprs csa3 0 0 1 0
NZ_CP010140 Escherichia coli strain D3 chromosome, complete genome 7 crisprs RT,DEDDh,DinG,cas3,c2c9_V-U4,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 17 11 0

Results visualization

1. NZ_CP010140
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010140_1 286277-286424 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010140_2 584942-585057 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010140_3 794784-794937 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010140_4 2798053-2798187 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010140_5 3579900-3580721 TypeI-E I-E
13 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010140_6 3606420-3606936 Unclear I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010140_7 4056298-4056437 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010140_3 3.1|794837|48|NZ_CP010140|CRISPRCasFinder 794837-794884 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4089-4136 3 0.938
NZ_CP010140_3 3.1|794837|48|NZ_CP010140|CRISPRCasFinder 794837-794884 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4088-4135 3 0.938
NZ_CP010140_3 3.1|794837|48|NZ_CP010140|CRISPRCasFinder 794837-794884 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4088-4135 3 0.938
NZ_CP010140_3 3.1|794837|48|NZ_CP010140|CRISPRCasFinder 794837-794884 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4088-4135 3 0.938
NZ_CP010140_5 5.1|3579929|32|NZ_CP010140|CRT 3579929-3579960 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
NZ_CP010140_5 5.1|3579929|32|NZ_CP010140|CRT 3579929-3579960 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
NZ_CP010140_6 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT 3606510-3606541 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
NZ_CP010140_6 6.10|3606511|32|NZ_CP010140|PILER-CR 3606511-3606542 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
NZ_CP010140_7 7.1|4056347|42|NZ_CP010140|CRISPRCasFinder 4056347-4056388 42 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30214-30255 7 0.833
NZ_CP010140_5 5.1|3579929|32|NZ_CP010140|CRT 3579929-3579960 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
NZ_CP010140_5 5.3|3580051|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580051-3580082 32 MK448454 Streptococcus satellite phage Javan361, complete genome 9192-9223 8 0.75
NZ_CP010140_5 5.5|3580173|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580173-3580204 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 532343-532374 8 0.75
NZ_CP010140_5 5.6|3580234|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580234-3580265 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148991-149022 8 0.75
NZ_CP010140_5 5.6|3580234|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580234-3580265 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530640-530671 8 0.75
NZ_CP010140_5 5.8|3580356|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580356-3580387 32 NZ_CP044456 Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence 83495-83526 8 0.75
NZ_CP010140_5 5.8|3580356|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580356-3580387 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 301179-301210 8 0.75
NZ_CP010140_5 5.11|3580539|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580539-3580570 32 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18008 8 0.75
NZ_CP010140_5 5.11|3580539|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580539-3580570 32 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97497-97528 8 0.75
NZ_CP010140_5 5.13|3580661|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580661-3580692 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62713 8 0.75
NZ_CP010140_5 5.13|3580661|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580661-3580692 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222137 8 0.75
NZ_CP010140_5 5.13|3580661|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580661-3580692 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467671-2467702 8 0.75
NZ_CP010140_5 5.13|3580661|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580661-3580692 32 NC_008759 Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence 12670-12701 8 0.75
NZ_CP010140_6 6.3|3606571|32|NZ_CP010140|CRISPRCasFinder,CRT 3606571-3606602 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
NZ_CP010140_6 6.11|3606572|32|NZ_CP010140|PILER-CR 3606572-3606603 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
NZ_CP010140_7 7.1|4056347|42|NZ_CP010140|CRISPRCasFinder 4056347-4056388 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24899-24940 8 0.81
NZ_CP010140_5 5.1|3579929|32|NZ_CP010140|CRT 3579929-3579960 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
NZ_CP010140_5 5.5|3580173|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580173-3580204 32 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35771 9 0.719
NZ_CP010140_5 5.6|3580234|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580234-3580265 32 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14984 9 0.719
NZ_CP010140_5 5.6|3580234|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580234-3580265 32 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15014 9 0.719
NZ_CP010140_5 5.6|3580234|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580234-3580265 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3485 9 0.719
NZ_CP010140_5 5.11|3580539|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580539-3580570 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405906 9 0.719
NZ_CP010140_7 7.1|4056347|42|NZ_CP010140|CRISPRCasFinder 4056347-4056388 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24786-24827 9 0.786
NZ_CP010140_5 5.11|3580539|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580539-3580570 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248362-2248393 10 0.688
NZ_CP010140_5 5.12|3580600|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580600-3580631 32 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244717 10 0.688
NZ_CP010140_5 5.12|3580600|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580600-3580631 32 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78567 10 0.688
NZ_CP010140_5 5.13|3580661|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder 3580661-3580692 32 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86181-86212 10 0.688
NZ_CP010140_6 6.8|3606876|32|NZ_CP010140|CRISPRCasFinder,CRT 3606876-3606907 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
NZ_CP010140_6 6.16|3606877|32|NZ_CP010140|PILER-CR 3606877-3606908 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
NZ_CP010140_4 4.1|2798100|41|NZ_CP010140|CRISPRCasFinder 2798100-2798140 41 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 41434-41474 11 0.732

1. spacer 3.1|794837|48|NZ_CP010140|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

2. spacer 3.1|794837|48|NZ_CP010140|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

3. spacer 3.1|794837|48|NZ_CP010140|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

4. spacer 3.1|794837|48|NZ_CP010140|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

5. spacer 5.1|3579929|32|NZ_CP010140|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

6. spacer 5.1|3579929|32|NZ_CP010140|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

7. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

8. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

9. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

10. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

11. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

12. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

13. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

14. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

15. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

16. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

17. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

18. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

19. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

20. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

21. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

22. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

23. spacer 6.2|3606510|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

24. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

25. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

26. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

27. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

28. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

29. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

30. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

31. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

32. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

33. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

34. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

35. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

36. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

37. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

38. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

39. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

40. spacer 6.10|3606511|32|NZ_CP010140|PILER-CR matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

41. spacer 7.1|4056347|42|NZ_CP010140|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.833

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
gcgtaggccagataaggcgtttacgccgcatccggcatttgt	Protospacer
.******.*********.****************.*  .***

42. spacer 5.1|3579929|32|NZ_CP010140|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

43. spacer 5.3|3580051|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to MK448454 (Streptococcus satellite phage Javan361, complete genome) position: , mismatch: 8, identity: 0.75

tgaagcatcaaacatttggtggaccaaacgga	CRISPR spacer
tgaagaatcaaaaatttggtggattgataaga	Protospacer
***** ****** **********...*  .**

44. spacer 5.5|3580173|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75

ggatctgccagcgcctctgcggggcggtaaac	CRISPR spacer
ggatcggccagcgcatctgcgggaggatgatg	Protospacer
***** ******** ********. *.*.*  

45. spacer 5.6|3580234|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tacgccagccacctgcttcgccagccgttcgg	CRISPR spacer
ttccgcagccgcctccttcgccagccgtaccc	Protospacer
* *  *****.*** ************* *  

46. spacer 5.6|3580234|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

tacgccagccacctgcttcgccagccgttcgg	CRISPR spacer
ctggcccatcacctgcttcgccacctgttcgg	Protospacer
.  *** ..************** *.******

47. spacer 5.8|3580356|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044456 (Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence) position: , mismatch: 8, identity: 0.75

atcagcagccaattccgccaatgtggcgttag	CRISPR spacer
atagtaagccaattcagccaatgtcgcgtcaa	Protospacer
** .  ********* ******** ****.*.

48. spacer 5.8|3580356|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 8, identity: 0.75

atcagcagccaattccgccaatgtggcgttag	CRISPR spacer
atagtaagccaattcagccaatgtcgcgtcaa	Protospacer
** .  ********* ******** ****.*.

49. spacer 5.11|3580539|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
agttggtagcggccctgcgcgtcggtgacgct	Protospacer
   .******* * ****************  

50. spacer 5.11|3580539|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
ttgaagaagcgcgactgcgcgtcggtgacgtc	Protospacer
*.. .* ***** *****************  

51. spacer 5.13|3580661|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

aattgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
gattgcggatgctgccggcattgcgataggga	Protospacer
.************ **** ******  .* .*

52. spacer 5.13|3580661|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

aattgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
tgatggcgctgctcacggaattgcgcgcgcaa	Protospacer
 . **  * ***** ************ ****

53. spacer 5.13|3580661|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

aattgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
tgatggcgctgctcacggaattgcgcgcgcaa	Protospacer
 . **  * ***** ************ ****

54. spacer 5.13|3580661|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NC_008759 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence) position: , mismatch: 8, identity: 0.75

aattgcggatgctcccggaa-----ttgcgcgggcaa	CRISPR spacer
aaatgcggatgctcccggaaatgagtttcacg-----	Protospacer
** *****************     ** *.**     

55. spacer 6.3|3606571|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggttcactcacgcaacgtctgagcgcgttga	CRISPR spacer
cggggtaatcacgcaacgtccgaccgcgttgt	Protospacer
.**  .* ************.** ******* 

56. spacer 6.11|3606572|32|NZ_CP010140|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggttcactcacgcaacgtctgagcgcgttga	CRISPR spacer
cggggtaatcacgcaacgtccgaccgcgttgt	Protospacer
.**  .* ************.** ******* 

57. spacer 7.1|4056347|42|NZ_CP010140|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 8, identity: 0.81

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
ttgtaggtcggataaggcgtttacgccgcatccgacatcaat	Protospacer
 .*******.*******.******************  * .*

58. spacer 5.1|3579929|32|NZ_CP010140|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

59. spacer 5.5|3580173|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

ggatctgccagcgcctctgcggggcggtaaac	CRISPR spacer
gtcgctgccagcgcctcggcgaggcggtctcg	Protospacer
*   ************* ***.******    

60. spacer 5.6|3580234|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 9, identity: 0.719

tacgccagccacctgcttcgccagccgttcgg	CRISPR spacer
cacgcaagccacctgcatcgccagctgccgct	Protospacer
.**** ********** ********.*..   

61. spacer 5.6|3580234|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 9, identity: 0.719

tacgccagccacctgcttcgccagccgttcgg	CRISPR spacer
cacgcaagccacctgcatcgccagctgccgct	Protospacer
.**** ********** ********.*..   

62. spacer 5.6|3580234|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

tacgccagccacctgcttcgccagccgttcgg	CRISPR spacer
ctcggcagccacctgctgcgccagctgcgcaa	Protospacer
. ** ************ *******.*. *..

63. spacer 5.11|3580539|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
ttgaagaagcgcgactgcgcgtcagtgacgtc	Protospacer
*.. .* ***** **********.******  

64. spacer 7.1|4056347|42|NZ_CP010140|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.786

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
ttgtaggtcggataaggcgtttacgccgcatccgacatcaac	Protospacer
 .*******.*******.******************  * ..

65. spacer 5.11|3580539|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
gggacgtcgcgccactgggcgtcggtgatgtc	Protospacer
  .  ** ********* **********.*  

66. spacer 5.12|3580600|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ataattcgcaaatcaatatatattttgtccgt	CRISPR spacer
tattttcggaaatcaatctatattttgcctca	Protospacer
    **** ******** *********.*.  

67. spacer 5.12|3580600|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 10, identity: 0.688

ataattcgcaaatcaatatatattttgtccgt	CRISPR spacer
ccagaagtaaaatcaatatataatttttccgt	Protospacer
 .*.     ************* *** *****

68. spacer 5.13|3580661|32|NZ_CP010140|CRT,PILER-CR,CRISPRCasFinder matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 10, identity: 0.688

aattgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
cccagcggatgctcctcgaattgcgcggtagc	Protospacer
  . ***********. ***********  . 

69. spacer 6.8|3606876|32|NZ_CP010140|CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

actaaacttaatgatggccgttacagcgtgga	CRISPR spacer
gagtaacttaatgatgggcgtcacagcagcgg	Protospacer
.   ************* ***.*****.  *.

70. spacer 6.16|3606877|32|NZ_CP010140|PILER-CR matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

actaaacttaatgatggccgttacagcgtgga	CRISPR spacer
gagtaacttaatgatgggcgtcacagcagcgg	Protospacer
.   ************* ***.*****.  *.

71. spacer 4.1|2798100|41|NZ_CP010140|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 11, identity: 0.732

ctgccgcgtcttatcaggcctacaaaaccgaaccgtaggtc	CRISPR spacer
ctggcgcgtcttatcagacctacaaaaccccccggcgaatg	Protospacer
*** *************.***********   * *....* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 260078 : 327758 56 Vibrio_phage(18.75%) transposase,protease,tRNA NA
DBSCAN-SWA_2 340560 : 345698 8 Stx2-converting_phage(33.33%) transposase NA
DBSCAN-SWA_3 439928 : 517745 85 Enterobacteria_phage(44.26%) capsid,terminase,lysis,tail,portal,head,tRNA,integrase attL 432552:432567|attR 496708:496723
DBSCAN-SWA_4 734109 : 849475 116 Shigella_phage(53.23%) capsid,terminase,holin,transposase,plate,protease,tail,portal,tRNA,head,integrase attL 786197:786212|attR 854287:854302
DBSCAN-SWA_5 1924753 : 1978248 55 Escherichia_phage(47.62%) terminase,holin,lysis,tail,tRNA,integrase attL 1919137:1919153|attR 1959421:1959437
DBSCAN-SWA_6 2187593 : 2243160 65 Enterobacteria_phage(51.02%) terminase,protease,lysis,tail,portal,integrase attL 2205673:2205688|attR 2243251:2243266
DBSCAN-SWA_7 2611176 : 2707282 97 Escherichia_phage(34.55%) capsid,terminase,holin,transposase,protease,lysis,tail,portal,head,integrase attL 2687743:2687802|attR 2715160:2715239
DBSCAN-SWA_8 2782386 : 2790538 7 Prochlorococcus_phage(16.67%) NA NA
DBSCAN-SWA_9 2882292 : 2891733 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_10 3358516 : 3468603 131 Salmonella_phage(55.43%) capsid,terminase,holin,lysis,plate,tail,portal,tRNA,head,integrase attL 3397592:3397606|attR 3472434:3472448
DBSCAN-SWA_11 3559352 : 3572535 12 Escherichia_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP010141
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3482 : 39551 36 Escherichia_phage(38.46%) transposase,integrase attL 8398:8457|attR 39546:40368
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage