Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018152 Bacillus amyloliquefaciens strain LM2303 chromosome, complete genome 1 crisprs DinG,csa3,cas3,DEDDh,WYL 0 1 8 0

Results visualization

1. NZ_CP018152
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018152_1 652108-652190 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018152_1 1.1|652131|37|NZ_CP018152|CRISPRCasFinder 652131-652167 37 CP003950 Rhodococcus opacus PD630 plasmid 1, complete sequence 117646-117682 10 0.73

1. spacer 1.1|652131|37|NZ_CP018152|CRISPRCasFinder matches to CP003950 (Rhodococcus opacus PD630 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.73

atatcctccgaagccgccgtagccgccaaaaccgccg	CRISPR spacer
atatcctccgatgccgccgaagccgcgcagtccctac	Protospacer
*********** ******* ******  *. ** .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8841 : 21774 21 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_2 106495 : 142065 46 Bacillus_phage(34.38%) portal,plate,holin,terminase,tail NA
DBSCAN-SWA_3 688745 : 698636 9 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_4 1585632 : 1637009 56 Bacillus_phage(42.86%) lysis,coat,tRNA,holin NA
DBSCAN-SWA_5 2988183 : 2994436 9 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_6 3137624 : 3143511 8 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_7 3439865 : 3446079 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_8 3904980 : 3983471 110 Bacillus_phage(45.59%) integrase,portal,protease,holin,terminase,capsid,tail attL 3915747:3915766|attR 3980409:3980428
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage