Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018155 Tenacibaculum todarodis strain LPB0136 chromosome, complete genome 1 crisprs cas3,DEDDh,PrimPol,WYL,RT 0 1 1 0

Results visualization

1. NZ_CP018155
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018155_1 503793-504160 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018155_1 1.2|503870|34|NZ_CP018155|CRT 503870-503903 34 NZ_CP046030 Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence 13708-13741 9 0.735
NZ_CP018155_1 1.2|503870|34|NZ_CP018155|CRT 503870-503903 34 NZ_CP031279 Staphylococcus hominis strain 19A plasmid unnamed2, complete sequence 33431-33464 9 0.735
NZ_CP018155_1 1.2|503870|34|NZ_CP018155|CRT 503870-503903 34 NZ_CP031273 Staphylococcus chromogenes strain 17A plasmid unnamed1 24528-24561 9 0.735

1. spacer 1.2|503870|34|NZ_CP018155|CRT matches to NZ_CP046030 (Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

tactcgctttaattttattgctaacatttgtttt	CRISPR spacer
gagacaaattaattttattgataatatttgtttc	Protospacer
 *  *.  ************ ***.********.

2. spacer 1.2|503870|34|NZ_CP018155|CRT matches to NZ_CP031279 (Staphylococcus hominis strain 19A plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

tactcgctttaattttattgctaacatttgtttt	CRISPR spacer
gagacaaattaattttattgataatatttgtttc	Protospacer
 *  *.  ************ ***.********.

3. spacer 1.2|503870|34|NZ_CP018155|CRT matches to NZ_CP031273 (Staphylococcus chromogenes strain 17A plasmid unnamed1) position: , mismatch: 9, identity: 0.735

tactcgctttaattttattgctaacatttgtttt	CRISPR spacer
gagacaaattaattttattgataatatttgtttc	Protospacer
 *  *.  ************ ***.********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1885761 : 1948679 54 Staphylococcus_phage(25.0%) protease,transposase,integrase attL 1907727:1907746|attR 1952714:1952733
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage