Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018126 Escherichia coli strain MRSN346355 plasmid pMRSN346355_5.3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP018123 Escherichia coli strain MRSN346355 plasmid pMRSN346355_67.9, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP018122 Escherichia coli strain MRSN346355 plasmid pMRSN346355_120.3, complete sequence 0 crisprs DEDDh,csa3,cas14j 0 0 1 0
NZ_CP018125 Escherichia coli strain MRSN346355 plasmid pMRSN346355_61.1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP018121 Escherichia coli strain MRSN346355 chromosome, complete genome 5 crisprs DinG,cas3,c2c9_V-U4,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK,RT 0 11 9 0
NZ_CP018124 Escherichia coli strain MRSN346355 plasmid pMRSN346355_65.5, complete sequence 0 crisprs c2c9_V-U4 0 0 1 0

Results visualization

1. NZ_CP018121
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018121_1 468474-468618 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018121_2 608663-608759 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018121_3 3033589-3033861 TypeI-E I-E
4 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018121_4 3062348-3062986 Orphan I-E
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018121_5 4667635-4667784 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018121_3 3.1|3033618|32|NZ_CP018121|CRT 3033618-3033649 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 0 1.0
NZ_CP018121_4 4.2|3062438|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR 3062438-3062469 32 KT898133 Aeromonas phage phiARM81ld, complete genome 45655-45686 2 0.938
NZ_CP018121_3 3.5|3033681|29|NZ_CP018121|PILER-CR 3033681-3033709 29 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 295848-295876 6 0.793
NZ_CP018121_3 3.6|3033742|29|NZ_CP018121|PILER-CR 3033742-3033770 29 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 347859-347887 6 0.793
NZ_CP018121_4 4.8|3062804|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR 3062804-3062835 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
NZ_CP018121_3 3.1|3033618|32|NZ_CP018121|CRT 3033618-3033649 32 MK455769 Aeromonas phage MJG, complete genome 10369-10400 7 0.781
NZ_CP018121_4 4.6|3062682|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR 3062682-3062713 32 KC821619 Cellulophaga phage phi18:1, complete genome 6924-6955 7 0.781
NZ_CP018121_4 4.6|3062682|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR 3062682-3062713 32 KC821627 Cellulophaga phage phi18:2, complete genome 6924-6955 7 0.781
NZ_CP018121_3 3.1|3033618|32|NZ_CP018121|CRT 3033618-3033649 32 NZ_CP028965 Burkholderia sp. IDO3 plasmid p1, complete sequence 163306-163337 8 0.75
NZ_CP018121_3 3.3|3033740|32|NZ_CP018121|CRT 3033740-3033771 32 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 347859-347890 8 0.75
NZ_CP018121_4 4.2|3062438|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR 3062438-3062469 32 MN901520 Halorubrum coriense virus Hardycor2, complete genome 16524-16555 8 0.75
NZ_CP018121_4 4.7|3062743|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR 3062743-3062774 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
NZ_CP018121_4 4.10|3062926|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR 3062926-3062957 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
NZ_CP018121_4 4.10|3062926|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR 3062926-3062957 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
NZ_CP018121_3 3.1|3033618|32|NZ_CP018121|CRT 3033618-3033649 32 NC_047954 Pseudomonas phage Njord, complete genome 11435-11466 9 0.719
NZ_CP018121_3 3.2|3033679|32|NZ_CP018121|CRT 3033679-3033710 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 11267-11298 9 0.719
NZ_CP018121_4 4.6|3062682|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR 3062682-3062713 32 NZ_CP020483 Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence 383-414 9 0.719
NZ_CP018121_1 1.1|468517|59|NZ_CP018121|CRISPRCasFinder 468517-468575 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
NZ_CP018121_3 3.1|3033618|32|NZ_CP018121|CRT 3033618-3033649 32 NC_047894 Pseudomonas phage uligo, complete genome 11353-11384 10 0.688
NZ_CP018121_1 1.1|468517|59|NZ_CP018121|CRISPRCasFinder 468517-468575 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814

1. spacer 3.1|3033618|32|NZ_CP018121|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

caagtgatgtccatcatcgcatccagtgcgtc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
********************************

2. spacer 4.2|3062438|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR matches to KT898133 (Aeromonas phage phiARM81ld, complete genome) position: , mismatch: 2, identity: 0.938

acgaacgcggcacaccagggcgtctcatcgtc	CRISPR spacer
acgaacgcggcgcaccagggcgtctcgtcgtc	Protospacer
***********.**************.*****

3. spacer 3.5|3033681|29|NZ_CP018121|PILER-CR matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 6, identity: 0.793

gtcaataggcggcgtcccgtagccgtccc	CRISPR spacer
gtgttttcgcggcgtcccgtagccgcccc	Protospacer
**   *  *****************.***

4. spacer 3.6|3033742|29|NZ_CP018121|PILER-CR matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793

gttgaggtcgataagtacgaacggtttcc	CRISPR spacer
gaagaggtcgatgagtacgaatggttaca	Protospacer
*  *********.********.**** * 

5. spacer 4.8|3062804|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812

gagagcgaggggagattccggcagggcgtgca	CRISPR spacer
aatcgtgaggggatcttccggcagggcgtgca	Protospacer
.*  *.*******  *****************

6. spacer 3.1|3033618|32|NZ_CP018121|CRT matches to MK455769 (Aeromonas phage MJG, complete genome) position: , mismatch: 7, identity: 0.781

-caagtgatgtccatcatcgcatccagtgcgtc	CRISPR spacer
gcctccgat-tccatcattgcatacagtgcgtc	Protospacer
 *   .*** ********.**** *********

7. spacer 4.6|3062682|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR matches to KC821619 (Cellulophaga phage phi18:1, complete genome) position: , mismatch: 7, identity: 0.781

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
gcggttttattttccctgaaaagaaaaaagag	Protospacer
** *. **************** ** ****  

8. spacer 4.6|3062682|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR matches to KC821627 (Cellulophaga phage phi18:2, complete genome) position: , mismatch: 7, identity: 0.781

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
gcggttttattttccctgaaaagaaaaaagag	Protospacer
** *. **************** ** ****  

9. spacer 3.1|3033618|32|NZ_CP018121|CRT matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

caagtgatgtccatcatcgcatccagtgcgtc	CRISPR spacer
gcacaggtgtcgatcatcgcatccagcgcgtg	Protospacer
  *  *.**** **************.**** 

10. spacer 3.3|3033740|32|NZ_CP018121|CRT matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgaggtcgataagtacgaacggtttccctg	CRISPR spacer
gaagaggtcgatgagtacgaatggttacagcg	Protospacer
*  *********.********.**** *  .*

11. spacer 4.2|3062438|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR matches to MN901520 (Halorubrum coriense virus Hardycor2, complete genome) position: , mismatch: 8, identity: 0.75

acgaacgcggcacaccagggcgtctcatcgtc--	CRISPR spacer
ccgaacgcggcacacccgagcg--tcggcggcgg	Protospacer
 *************** *.***  **. ** *  

12. spacer 4.7|3062743|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75

taatatccc----tggcgataatcaaccggcttact	CRISPR spacer
----acgccatggtggcgataatcatcctgcttact	Protospacer
    *. **    ************ ** *******

13. spacer 4.10|3062926|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.* 

14. spacer 4.10|3062926|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.* 

15. spacer 3.1|3033618|32|NZ_CP018121|CRT matches to NC_047954 (Pseudomonas phage Njord, complete genome) position: , mismatch: 9, identity: 0.719

caagtgatgtccatcatcgcatccagtgcgtc	CRISPR spacer
gcctcggcctccatcatcgcatcgagtgcgtc	Protospacer
    .*.. ************** ********

16. spacer 3.2|3033679|32|NZ_CP018121|CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

gtcaataggcggcgtcccgtagccgtcccctt	CRISPR spacer
gtgctctggcggcgtgccgtagccatccccga	Protospacer
**   . ******** ********.*****  

17. spacer 4.6|3062682|32|NZ_CP018121|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020483 (Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
tagcctttattttcactcaaaacaataaaagt	Protospacer
    * ******** ** ***********. *

18. spacer 1.1|468517|59|NZ_CP018121|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831

ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg-	CRISPR spacer
gagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgat-cgtgcactga	Protospacer
*.   ************ ****************************.**  **** *.* 

19. spacer 3.1|3033618|32|NZ_CP018121|CRT matches to NC_047894 (Pseudomonas phage uligo, complete genome) position: , mismatch: 10, identity: 0.688

caagtgatgtccatcatcgcatccagtgcgtc	CRISPR spacer
gcttctgcctccatcatcgcatcgagtgcgtc	Protospacer
    . .. ************** ********

20. spacer 1.1|468517|59|NZ_CP018121|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814

-ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg	CRISPR spacer
tcgcacca-aaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgtacc	Protospacer
  *..*** ***********************.**************** ***.  * * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 201313 : 274157 58 uncultured_Caudovirales_phage(20.0%) protease,plate,transposase,tRNA NA
DBSCAN-SWA_2 281337 : 338880 45 Enterobacteria_phage(45.45%) transposase,integrase attL 275762:275777|attR 307962:307977
DBSCAN-SWA_3 1237311 : 1328804 112 Escherichia_phage(29.55%) protease,terminase,portal,head,tail,transposase,tRNA,capsid,integrase,holin attL 1254151:1254166|attR 1309952:1309967
DBSCAN-SWA_4 1332034 : 1338474 10 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_5 2596011 : 2602384 8 Enterobacteria_phage(33.33%) transposase,integrase attL 2597072:2597094|attR 2609920:2609942
DBSCAN-SWA_6 2856241 : 2973853 112 Erwinia_phage(20.75%) plate,terminase,portal,head,tail,transposase,tRNA,capsid,integrase attL 2853180:2853195|attR 2936330:2936345
DBSCAN-SWA_7 3010154 : 3017294 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_8 3997606 : 4008196 12 Enterobacteria_phage(88.89%) integrase attL 3997424:3997446|attR 4008673:4008695
DBSCAN-SWA_9 4641410 : 4696143 49 Enterobacteria_phage(26.32%) protease,transposase,tRNA,integrase,holin attL 4650334:4650349|attR 4678237:4678252
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP018123
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 50697 : 61313 10 Escherichia_phage(71.43%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP018122
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5003 : 44114 37 Escherichia_phage(30.0%) integrase,transposase attL 12738:12753|attR 49339:49354
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP018124
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7521 : 33176 25 Escherichia_phage(18.18%) transposase,integrase attL 8132:8146|attR 35405:35419
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage