Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013152 Lactobacillus plantarum strain MF1298 plasmid unnamed1, partial sequence 0 crisprs csa3 0 0 0 0
NZ_CP013171 Lactobacillus plantarum strain MF1298 plasmid unnamed20, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013151 Lactobacillus plantarum strain MF1298 plasmid pMF1298-2, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP013162 Lactobacillus plantarum strain MF1298 plasmid unnamed11, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013150 Lactobacillus plantarum strain MF1298 plasmid pMF1298-1, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP013176 Lactobacillus plantarum strain MF1298 plasmid unnamed25, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013166 Lactobacillus plantarum strain MF1298 plasmid unnamed15, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013165 Lactobacillus plantarum strain MF1298 plasmid unnamed14, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013177 Lactobacillus plantarum strain MF1298 plasmid unnamed26, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013149 Lactobacillus plantarum strain MF1298, complete genome 1 crisprs csa3,cas9,cas1,cas2,csn2,DinG,cas3,DEDDh 0 21 6 0
NZ_CP013163 Lactobacillus plantarum strain MF1298 plasmid unnamed12, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013157 Lactobacillus plantarum strain MF1298 plasmid unnamed6, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013172 Lactobacillus plantarum strain MF1298 plasmid unnamed21, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013160 Lactobacillus plantarum strain MF1298 plasmid unnamed9, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013167 Lactobacillus plantarum strain MF1298 plasmid unnamed16, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013159 Lactobacillus plantarum strain MF1298 plasmid unnamed8, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013173 Lactobacillus plantarum strain MF1298 plasmid unnamed22, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013158 Lactobacillus plantarum strain MF1298 plasmid unnamed7, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013168 Lactobacillus plantarum strain MF1298 plasmid unnamed17, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013161 Lactobacillus plantarum strain MF1298 plasmid unnamed10, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013175 Lactobacillus plantarum strain MF1298 plasmid unnamed24, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013169 Lactobacillus plantarum strain MF1298 plasmid unnamed18, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013170 Lactobacillus plantarum strain MF1298 plasmid unnamed19, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013164 Lactobacillus plantarum strain MF1298 plasmid unnamed13, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013153 Lactobacillus plantarum strain MF1298 plasmid unnamed2, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013154 Lactobacillus plantarum strain MF1298 plasmid unnamed3, partial sequence 0 crisprs csa3 0 0 0 0
NZ_CP013155 Lactobacillus plantarum strain MF1298 plasmid unnamed4, partial sequence 0 crisprs RT 0 0 0 0
NZ_CP013174 Lactobacillus plantarum strain MF1298 plasmid unnamed23, partial sequence 0 crisprs NA 0 0 0 0
NZ_CP013156 Lactobacillus plantarum strain MF1298 plasmid unnamed5, partial sequence 1 crisprs NA 0 2 0 0

Results visualization

1. NZ_CP013149
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013149_1 116735-118846 TypeII NA
58 spacers
csn2,cas2,cas1,cas9,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013149_1 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117893-117922 30 NC_004305 Lactobacillus phage phig1e, complete genome 33581-33610 0 1.0
NZ_CP013149_1 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117893-117922 30 X98106 Lactobacillus bacteriophage phig1e complete genomic DNA 33581-33610 0 1.0
NZ_CP013149_1 1.13|117563|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117563-117592 30 NZ_CP025993 Lactobacillus plantarum subsp. plantarum strain LB1-2 plasmid pLB1-2B, complete sequence 35085-35114 1 0.967
NZ_CP013149_1 1.19|117959|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117959-117988 30 JX486087 Lactobacillus phage ATCC 8014-B1, complete genome 30242-30271 3 0.9
NZ_CP013149_1 1.11|117431|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117431-117460 30 JX486087 Lactobacillus phage ATCC 8014-B1, complete genome 8954-8983 4 0.867
NZ_CP013149_1 1.19|117959|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117959-117988 30 JN051154 Pediococcus phage clP1, complete genome 15025-15054 4 0.867
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 457051-457080 5 0.833
NZ_CP013149_1 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117893-117922 30 AY682195 Lactobacillus plantarum bacteriophage LP65, complete genome 7535-7564 5 0.833
NZ_CP013149_1 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117893-117922 30 NC_006565 Lactobacillus phage LP65, complete genome 7535-7564 5 0.833
NZ_CP013149_1 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117893-117922 30 NZ_CP014913 Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-1, complete sequence 43852-43881 5 0.833
NZ_CP013149_1 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117893-117922 30 NZ_CP014925 Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-1, complete sequence 1277-1306 5 0.833
NZ_CP013149_1 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117893-117922 30 KU052488 Lactobacillus phage SA-C12, complete genome 48107-48136 5 0.833
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 MN585972 Arthrobacter phage Edmundo, complete genome 37248-37277 6 0.8
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 226094-226123 6 0.8
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 MK894437 Microbacterium phage MonChoix, complete genome 5804-5833 6 0.8
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1460937-1460966 6 0.8
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1258097-1258126 6 0.8
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1461084-1461113 6 0.8
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1211727-1211756 6 0.8
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1250630-1250659 6 0.8
NZ_CP013149_1 1.7|117167|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117167-117196 30 NZ_AP018205 Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome 71233-71262 6 0.8
NZ_CP013149_1 1.7|117167|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117167-117196 30 NZ_AP014640 Leptolyngbya boryana IAM M-101 plasmid pLBX 434240-434269 6 0.8
NZ_CP013149_1 1.14|117629|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117629-117658 30 MN119376 Streptomyces phage Geostin, complete genome 10843-10872 6 0.8
NZ_CP013149_1 1.14|117629|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117629-117658 30 MH155868 Streptomyces phage FlowerPower, complete genome 10843-10872 6 0.8
NZ_CP013149_1 1.14|117629|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117629-117658 30 MN284894 Streptomyces phage Fabian, complete genome 10843-10872 6 0.8
NZ_CP013149_1 1.22|118157|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118157-118186 30 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 239270-239299 6 0.8
NZ_CP013149_1 1.22|118157|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118157-118186 30 NZ_CP017303 Rhodococcus sp. YL-1 plasmid pYLL1 sequence 104800-104829 6 0.8
NZ_CP013149_1 1.22|118157|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118157-118186 30 NZ_CP042915 Rhodococcus qingshengii strain RL1 plasmid unnamed2 184929-184958 6 0.8
NZ_CP013149_1 1.33|118648|31|NZ_CP013149|PILER-CR 118648-118678 31 NC_047953 Pseudomonas phage vB_PaeP_130_113, complete genome 6092-6122 6 0.806
NZ_CP013149_1 1.33|118648|31|NZ_CP013149|PILER-CR 118648-118678 31 KR054031 Pseudomonas phage DL62, complete genome 5937-5967 6 0.806
NZ_CP013149_1 1.33|118648|31|NZ_CP013149|PILER-CR 118648-118678 31 AM910651 Pseudomonas phage LUZ19, complete genome 5989-6019 6 0.806
NZ_CP013149_1 1.33|118648|31|NZ_CP013149|PILER-CR 118648-118678 31 MN901924 Pseudomonas phage vB_PaeP_PE3, complete genome 5942-5972 6 0.806
NZ_CP013149_1 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116771-116800 30 KX961630 Bacillus phage QCM8, complete genome 50060-50089 7 0.767
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1676275-1676304 7 0.767
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 AX955019 Sequence 1 from Patent WO03093461 24256-24285 7 0.767
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 566335-566364 7 0.767
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 265258-265287 7 0.767
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_KU140623 Sinorhizobium sp. M14 plasmid pSinB, complete sequence 185121-185150 7 0.767
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 MF614628 Sinorhizobium phage phi3LM21, complete genome 5122-5151 7 0.767
NZ_CP013149_1 1.4|116969|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116969-116998 30 KX507046 Vibrio phage S4-7, complete genome 56857-56886 7 0.767
NZ_CP013149_1 1.7|117167|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117167-117196 30 MH669013 Gordonia phage Skysand, complete genome 27210-27239 7 0.767
NZ_CP013149_1 1.7|117167|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117167-117196 30 MK977699 Gordonia Phage Lollipop1437, complete genome 27754-27783 7 0.767
NZ_CP013149_1 1.17|117827|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117827-117856 30 LR215721 Staphylococcus phage Stab22 genome assembly, chromosome: I 2364-2393 7 0.767
NZ_CP013149_1 1.17|117827|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117827-117856 30 LR215721 Staphylococcus phage Stab22 genome assembly, chromosome: I 144638-144667 7 0.767
NZ_CP013149_1 1.20|118025|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118025-118054 30 NC_014389 Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence 275012-275041 7 0.767
NZ_CP013149_1 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118289-118318 30 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 173494-173523 7 0.767
NZ_CP013149_1 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118289-118318 30 NZ_LN868941 Nocardia farcinica strain NCTC11134 plasmid 4, complete sequence 83638-83667 7 0.767
NZ_CP013149_1 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118289-118318 30 NZ_CP031419 Nocardia farcinica strain W6977 plasmid unnamed1, complete sequence 25519-25548 7 0.767
NZ_CP013149_1 1.31|118781|30|NZ_CP013149|CRISPRCasFinder,CRT 118781-118810 30 NZ_CP015089 Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence 37190-37219 7 0.767
NZ_CP013149_1 1.32|118487|30|NZ_CP013149|CRT 118487-118516 30 NZ_CP024791 Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence 197362-197391 7 0.767
NZ_CP013149_1 1.32|118487|30|NZ_CP013149|CRT 118487-118516 30 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 122733-122762 7 0.767
NZ_CP013149_1 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116771-116800 30 MN013089 Bacillus phage vB_BspM_MarvelLand, complete genome 137765-137794 8 0.733
NZ_CP013149_1 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116771-116800 30 MH688040 Salmonella phage Mooltan, complete genome 70183-70212 8 0.733
NZ_CP013149_1 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116771-116800 30 NC_025446 Escherichia phage ECML-4, complete genome 125647-125676 8 0.733
NZ_CP013149_1 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116771-116800 30 MN342150 Escherichia phage vB_EcoM_3HA11, complete genome 38164-38193 8 0.733
NZ_CP013149_1 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116771-116800 30 NC_023856 Salmonella phage vB_SalM_SJ2, complete genome 146281-146310 8 0.733
NZ_CP013149_1 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116771-116800 30 MH427377 Escherichia phage vB_EcoM Sa157lw, complete genome 38644-38673 8 0.733
NZ_CP013149_1 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116771-116800 30 FQ312032 Salmonella phage Vi01 complete sequence 90217-90246 8 0.733
NZ_CP013149_1 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116771-116800 30 NC_015296 Salmonella phage Vi01, complete genome 90217-90246 8 0.733
NZ_CP013149_1 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116771-116800 30 MN066127 Salmonella phage Matapan, complete genome 70171-70200 8 0.733
NZ_CP013149_1 1.2|116837|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116837-116866 30 NC_004349 Shewanella oneidensis MR-1 megaplasmid, complete sequence 34495-34524 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 44384-44413 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 JN106173 Uncultured bacterium plasmid pAKD31, complete sequence 48838-48867 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 JN106174 Uncultured bacterium plasmid pAKD33, complete sequence 52672-52701 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 JN106165 Uncultured bacterium plasmid pAKD14, complete sequence 43322-43351 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 JN106166 Uncultured bacterium plasmid pAKD15, complete sequence 61248-61277 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 JN106168 Uncultured bacterium plasmid pAKD17, complete sequence 46452-46481 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 32603-32632 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 613932-613961 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NC_019320 Variovorax sp. DB1 plasmid pDB1, complete sequence 31677-31706 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 KY676784 Streptomyces phage ToastyFinz, complete genome 4751-4780 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 KY092482 Streptomyces phage Mojorita, complete genome 4976-5005 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 KY092480 Streptomyces phage Picard, complete genome 4976-5005 8 0.733
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_LR134463 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence 98986-99015 8 0.733
NZ_CP013149_1 1.7|117167|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117167-117196 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 708167-708196 8 0.733
NZ_CP013149_1 1.8|117233|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117233-117262 30 MH617654 Caudovirales sp. isolate ctbf53, complete genome 22891-22920 8 0.733
NZ_CP013149_1 1.11|117431|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117431-117460 30 KM879463 Arthrobacter phage vB_ArtM-ArV1, complete genome 15860-15889 8 0.733
NZ_CP013149_1 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117893-117922 30 MT104467 Pseudomonas phage MR4, complete genome 6493-6522 8 0.733
NZ_CP013149_1 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117893-117922 30 NC_047802 Pectobacterium phage PP99, complete genome 9391-9420 8 0.733
NZ_CP013149_1 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117893-117922 30 KJ749827 Escherichia phage ECBP5, complete genome 7250-7279 8 0.733
NZ_CP013149_1 1.22|118157|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118157-118186 30 MH616711 Inoviridae sp. isolate ctbe45, complete genome 1436-1465 8 0.733
NZ_CP013149_1 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118289-118318 30 NC_015729 Roseobacter litoralis Och 149 plasmid pRLO149_63, complete sequence 59709-59738 8 0.733
NZ_CP013149_1 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118289-118318 30 NZ_CP027408 Roseobacter denitrificans strain FDAARGOS_309 plasmid unnamed2, complete sequence 61691-61720 8 0.733
NZ_CP013149_1 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118289-118318 30 NZ_CP026745 Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence 90557-90586 8 0.733
NZ_CP013149_1 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118289-118318 30 NC_008387 Roseobacter denitrificans OCh 114 plasmid pTB2, complete sequence 30719-30748 8 0.733
NZ_CP013149_1 1.35|118780|31|NZ_CP013149|PILER-CR 118780-118810 31 NZ_CP015089 Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence 37189-37219 8 0.742
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NZ_CP010801 Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence 183710-183739 9 0.7
NZ_CP013149_1 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 116903-116932 30 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 909914-909943 9 0.7
NZ_CP013149_1 1.6|117101|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117101-117130 30 MN693509 Marine virus AFVG_25M367, complete genome 54175-54204 9 0.7
NZ_CP013149_1 1.6|117101|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117101-117130 30 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 20801-20830 9 0.7
NZ_CP013149_1 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 117893-117922 30 NZ_CP032091 Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence 270177-270206 9 0.7
NZ_CP013149_1 1.23|118223|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT 118223-118252 30 MN582058 Caudovirales sp. ctOwN3, complete genome 16148-16177 9 0.7

1. spacer 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_004305 (Lactobacillus phage phig1e, complete genome) position: , mismatch: 0, identity: 1.0

acgtctttcagcccagtaaactgctcaagt	CRISPR spacer
acgtctttcagcccagtaaactgctcaagt	Protospacer
******************************

2. spacer 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to X98106 (Lactobacillus bacteriophage phig1e complete genomic DNA) position: , mismatch: 0, identity: 1.0

acgtctttcagcccagtaaactgctcaagt	CRISPR spacer
acgtctttcagcccagtaaactgctcaagt	Protospacer
******************************

3. spacer 1.13|117563|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP025993 (Lactobacillus plantarum subsp. plantarum strain LB1-2 plasmid pLB1-2B, complete sequence) position: , mismatch: 1, identity: 0.967

atagtgacagcatctgttttcggaccaatc	CRISPR spacer
atagtgacagcatctgtttttggaccaatc	Protospacer
********************.*********

4. spacer 1.19|117959|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to JX486087 (Lactobacillus phage ATCC 8014-B1, complete genome) position: , mismatch: 3, identity: 0.9

ttgaataccattccttgtttatactccatc	CRISPR spacer
gtgaataccataccttgtttataatccatc	Protospacer
 ********** *********** ******

5. spacer 1.11|117431|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to JX486087 (Lactobacillus phage ATCC 8014-B1, complete genome) position: , mismatch: 4, identity: 0.867

gcggccacgaccgccatgggtgtcagcgcc	CRISPR spacer
gcggccacgaccgctatgggtgtcagttca	Protospacer
**************.***********. * 

6. spacer 1.19|117959|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to JN051154 (Pediococcus phage clP1, complete genome) position: , mismatch: 4, identity: 0.867

ttgaataccattccttgtttatactccatc	CRISPR spacer
gtaaataccataccttgtttataatccatc	Protospacer
 *.******** *********** ******

7. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 5, identity: 0.833

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacacggccaccgaagaagccggcgagcag	Protospacer
 *** *********.************* .

8. spacer 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to AY682195 (Lactobacillus plantarum bacteriophage LP65, complete genome) position: , mismatch: 5, identity: 0.833

acgtctttcagcccagtaaactgctcaagt	CRISPR spacer
ttgtctttcagcccagtaaactgttcaacg	Protospacer
 .*********************.****  

9. spacer 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_006565 (Lactobacillus phage LP65, complete genome) position: , mismatch: 5, identity: 0.833

acgtctttcagcccagtaaactgctcaagt	CRISPR spacer
ttgtctttcagcccagtaaactgttcaacg	Protospacer
 .*********************.****  

10. spacer 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP014913 (Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-1, complete sequence) position: , mismatch: 5, identity: 0.833

acgtctttcagcccagtaaactgctcaagt	CRISPR spacer
acgtctttcaggccggtaaactgctccaaa	Protospacer
*********** **.*********** *. 

11. spacer 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP014925 (Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-1, complete sequence) position: , mismatch: 5, identity: 0.833

acgtctttcagcccagtaaactgctcaagt	CRISPR spacer
acgtctttcaggccggtaaactgctccaaa	Protospacer
*********** **.*********** *. 

12. spacer 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to KU052488 (Lactobacillus phage SA-C12, complete genome) position: , mismatch: 5, identity: 0.833

acgtctttcagcccagtaaactgctcaagt	CRISPR spacer
aagtctttcagtccagtaaactgttcaaca	Protospacer
* *********.***********.****  

13. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MN585972 (Arthrobacter phage Edmundo, complete genome) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
cgcaaggccaccgaggaagccgtcgataag	Protospacer
*.******************** ***   .

14. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
caccaggccacccaggaagccggcgcccat	Protospacer
*** ******** ************  *  

15. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MK894437 (Microbacterium phage MonChoix, complete genome) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gtcaaggccacggaggaagccgtcgaggtc	Protospacer
  ********* ********** **** * 

16. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta-	CRISPR spacer
ggcaaggccaccgaggcacccggcg-cctat	Protospacer
 .************** * ******  *** 

17. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta-	CRISPR spacer
ggcaaggccaccgaggcacccggcg-cctat	Protospacer
 .************** * ******  *** 

18. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta-	CRISPR spacer
ggcaaggccaccgaggcacccggcg-cctat	Protospacer
 .************** * ******  *** 

19. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta-	CRISPR spacer
ggcaaggccaccgaggcacccggcg-cctat	Protospacer
 .************** * ******  *** 

20. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta-	CRISPR spacer
ggcaaggccaccgaggcacccggcg-cctat	Protospacer
 .************** * ******  *** 

21. spacer 1.7|117167|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_AP018205 (Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome) position: , mismatch: 6, identity: 0.8

ttaggttgagctggatcgggatcaggatcg	CRISPR spacer
tccgtttgggctgaatcgggatcaggatgg	Protospacer
*. * ***.****.************** *

22. spacer 1.7|117167|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_AP014640 (Leptolyngbya boryana IAM M-101 plasmid pLBX) position: , mismatch: 6, identity: 0.8

ttaggttgagctggatcgggatcaggatcg	CRISPR spacer
tccgtttgggctgaatcgggatcaggatgg	Protospacer
*. * ***.****.************** *

23. spacer 1.14|117629|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MN119376 (Streptomyces phage Geostin, complete genome) position: , mismatch: 6, identity: 0.8

gaggcttgcactagtgagttcaatcgttat-	CRISPR spacer
gaggcttggactcgtgagttcaa-caagatg	Protospacer
******** *** ********** *.  ** 

24. spacer 1.14|117629|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MH155868 (Streptomyces phage FlowerPower, complete genome) position: , mismatch: 6, identity: 0.8

gaggcttgcactagtgagttcaatcgttat-	CRISPR spacer
gaggcttggactcgtgagttcaa-caagatg	Protospacer
******** *** ********** *.  ** 

25. spacer 1.14|117629|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MN284894 (Streptomyces phage Fabian, complete genome) position: , mismatch: 6, identity: 0.8

gaggcttgcactagtgagttcaatcgttat-	CRISPR spacer
gaggcttggactcgtgagttcaa-caagatg	Protospacer
******** *** ********** *.  ** 

26. spacer 1.22|118157|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 6, identity: 0.8

caatcagaaagaagatgacgactataatgc	CRISPR spacer
cgatcagaaagaagaagacgaccatcaacc	Protospacer
*.************* ******.** *  *

27. spacer 1.22|118157|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 6, identity: 0.8

caatcagaaagaagatgacgactataatgc	CRISPR spacer
cgatcagaaagaagaagacgaccatcaacc	Protospacer
*.************* ******.** *  *

28. spacer 1.22|118157|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 6, identity: 0.8

caatcagaaagaagatgacgactataatgc	CRISPR spacer
cgatcagaaagaagaagacgaccatcaacc	Protospacer
*.************* ******.** *  *

29. spacer 1.33|118648|31|NZ_CP013149|PILER-CR matches to NC_047953 (Pseudomonas phage vB_PaeP_130_113, complete genome) position: , mismatch: 6, identity: 0.806

cgtgacgtgctcccatgtgaccc--gaattgac	CRISPR spacer
cgtgccgtgctcccaggtgaccccggagatg--	Protospacer
**** ********** *******  **. **  

30. spacer 1.33|118648|31|NZ_CP013149|PILER-CR matches to KR054031 (Pseudomonas phage DL62, complete genome) position: , mismatch: 6, identity: 0.806

cgtgacgtgctcccatgtgaccc--gaattgac	CRISPR spacer
cgtgccgtgctcccaggtgaccccggagatg--	Protospacer
**** ********** *******  **. **  

31. spacer 1.33|118648|31|NZ_CP013149|PILER-CR matches to AM910651 (Pseudomonas phage LUZ19, complete genome) position: , mismatch: 6, identity: 0.806

cgtgacgtgctcccatgtgaccc--gaattgac	CRISPR spacer
cgtgccgtgctcccaggtgaccccggagatg--	Protospacer
**** ********** *******  **. **  

32. spacer 1.33|118648|31|NZ_CP013149|PILER-CR matches to MN901924 (Pseudomonas phage vB_PaeP_PE3, complete genome) position: , mismatch: 6, identity: 0.806

cgtgacgtgctcccatgtgaccc--gaattgac	CRISPR spacer
cgtgccgtgctcccaggtgaccccggagatg--	Protospacer
**** ********** *******  **. **  

33. spacer 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to KX961630 (Bacillus phage QCM8, complete genome) position: , mismatch: 7, identity: 0.767

aaaatggatttctgagcattactgtccgac	CRISPR spacer
taaatggatttctgagcattactacggaaa	Protospacer
 **********************..  .* 

34. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
tacacggccaccgaggcagccggcgcgtcg	Protospacer
.*** *********** ******** *...

35. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to AX955019 (Sequence 1 from Patent WO03093461) position: , mismatch: 7, identity: 0.767

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacgccaccaccgaggaagccgccgagctc	Protospacer
 **.  .*************** ****** 

36. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 7, identity: 0.767

cacaag---gccaccgaggaagccggcgagcta	CRISPR spacer
---atgcttgccaccgaggaaaccggcaagctc	Protospacer
   * *   ************.*****.**** 

37. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 7, identity: 0.767

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gaacaggccaccgagatagccggcgagtga	Protospacer
 *  ***********. **********. *

38. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_KU140623 (Sinorhizobium sp. M14 plasmid pSinB, complete sequence) position: , mismatch: 7, identity: 0.767

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
atcaacgccaccgaggaagccgccgcggtt	Protospacer
  *** **************** ** * * 

39. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MF614628 (Sinorhizobium phage phi3LM21, complete genome) position: , mismatch: 7, identity: 0.767

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaaggccgccgaggaaaccggcctgccg	Protospacer
 ********.********.*****  **..

40. spacer 1.4|116969|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to KX507046 (Vibrio phage S4-7, complete genome) position: , mismatch: 7, identity: 0.767

taggtttactcatggtaaatcctcctatgt	CRISPR spacer
caggtttccacatggtaaatcctctagtgg	Protospacer
.****** * **************. .** 

41. spacer 1.7|117167|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MH669013 (Gordonia phage Skysand, complete genome) position: , mismatch: 7, identity: 0.767

ttaggttgagctggatcgggatcaggatcg	CRISPR spacer
cgagcaggcgcaggatcgggatcaggatcg	Protospacer
. **   * ** ******************

42. spacer 1.7|117167|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MK977699 (Gordonia Phage Lollipop1437, complete genome) position: , mismatch: 7, identity: 0.767

ttaggttgagctggatcgggatcaggatcg	CRISPR spacer
cgagcaggcgcaggatcgggatcaggatcg	Protospacer
. **   * ** ******************

43. spacer 1.17|117827|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to LR215721 (Staphylococcus phage Stab22 genome assembly, chromosome: I) position: , mismatch: 7, identity: 0.767

aggatatatgaaattagtacatgtactagt	CRISPR spacer
attttatatgaaattagtatatgaactcat	Protospacer
*   ***************.*** *** .*

44. spacer 1.17|117827|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to LR215721 (Staphylococcus phage Stab22 genome assembly, chromosome: I) position: , mismatch: 7, identity: 0.767

aggatatatgaaattagtacatgtactagt	CRISPR spacer
attttatatgaaattagtatatgaactcat	Protospacer
*   ***************.*** *** .*

45. spacer 1.20|118025|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_014389 (Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence) position: , mismatch: 7, identity: 0.767

agttcataatcatatgatctaagtgacggt	CRISPR spacer
ggtatcgaatcatatgatgtaagagacggt	Protospacer
.** .  *********** **** ******

46. spacer 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 7, identity: 0.767

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
gcacgggagcggtcgacaccccgggctgtt	Protospacer
.  .**********.*******.****** 

47. spacer 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_LN868941 (Nocardia farcinica strain NCTC11134 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.767

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
gcacgggagcggtcgacaccccgggctgtt	Protospacer
.  .**********.*******.****** 

48. spacer 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP031419 (Nocardia farcinica strain W6977 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
gcacgggagcggtcgacaccccgggctgtt	Protospacer
.  .**********.*******.****** 

49. spacer 1.31|118781|30|NZ_CP013149|CRISPRCasFinder,CRT matches to NZ_CP015089 (Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence) position: , mismatch: 7, identity: 0.767

gatggtgctgttgcacgtgatcccgcgctt	CRISPR spacer
ctccgagctgttccaggtgatcccgcgctt	Protospacer
  . * ****** ** **************

50. spacer 1.32|118487|30|NZ_CP013149|CRT matches to NZ_CP024791 (Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence) position: , mismatch: 7, identity: 0.767

caataccatagtagtcaattattacacgtc	CRISPR spacer
ccataccatcgtattcaattattactttcc	Protospacer
* ******* *** *********** . .*

51. spacer 1.32|118487|30|NZ_CP013149|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 7, identity: 0.767

caataccatagtagtcaattattacacgtc	CRISPR spacer
aaataccatagtcgtcaattatcatatttt	Protospacer
 *********** *********.*.*. *.

52. spacer 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MN013089 (Bacillus phage vB_BspM_MarvelLand, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
taaatggatttccgagcattactacggaaa	Protospacer
 ***********.**********..  .* 

53. spacer 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MH688040 (Salmonella phage Mooltan, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

54. spacer 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_025446 (Escherichia phage ECML-4, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

55. spacer 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MN342150 (Escherichia phage vB_EcoM_3HA11, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

56. spacer 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_023856 (Salmonella phage vB_SalM_SJ2, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

57. spacer 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MH427377 (Escherichia phage vB_EcoM Sa157lw, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

58. spacer 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to FQ312032 (Salmonella phage Vi01 complete sequence) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

59. spacer 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_015296 (Salmonella phage Vi01, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

60. spacer 1.1|116771|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MN066127 (Salmonella phage Matapan, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

61. spacer 1.2|116837|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_004349 (Shewanella oneidensis MR-1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733

gactataccaatgaggtcgaagcatggtta	CRISPR spacer
gactgtaccaatgaggtggaagcgccctgt	Protospacer
****.************ *****..  *  

62. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacgaggccgccgaggaagccggcggcaag	Protospacer
 **.*****.***************.   .

63. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

64. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

65. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

66. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

67. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

68. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

69. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gagaaggccgccgaggaagccggcatgacg	Protospacer
 * ******.**************. * ..

70. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

71. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to KY676784 (Streptomyces phage ToastyFinz, complete genome) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gcgaaggccgccgaggacgccggcgacgaa	Protospacer
   ******.******* ********   *

72. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to KY092482 (Streptomyces phage Mojorita, complete genome) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gagcaggccgccgaggaggccggcgagaag	Protospacer
 *  *****.*******.*********  .

73. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to KY092480 (Streptomyces phage Picard, complete genome) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gagcaggccgccgaggaggccggcgagaag	Protospacer
 *  *****.*******.*********  .

74. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
ttccgcgccgccgagaaagccggcgagctc	Protospacer
. * . ***.*****.************* 

75. spacer 1.7|117167|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttaggttgagctggatcgggatcaggatcg	CRISPR spacer
gcgggttgagctggaacgggatcaggccga	Protospacer
 ..************ ********** . .

76. spacer 1.8|117233|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MH617654 (Caudovirales sp. isolate ctbf53, complete genome) position: , mismatch: 8, identity: 0.733

tctgttgtttaatttgttttagattgttac	CRISPR spacer
attgttgtttaatttgtttaacatttacag	Protospacer
 .***************** * ***  .* 

77. spacer 1.11|117431|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to KM879463 (Arthrobacter phage vB_ArtM-ArV1, complete genome) position: , mismatch: 8, identity: 0.733

gcggccacgaccgccatgggtgtcagcgcc	CRISPR spacer
ggtttccaaaccgccatgggtgtcagcacc	Protospacer
*   .*  .******************.**

78. spacer 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MT104467 (Pseudomonas phage MR4, complete genome) position: , mismatch: 8, identity: 0.733

acgtctttcagcccagtaaactgctcaagt	CRISPR spacer
agtgacttcagcccattgaactgctcaagc	Protospacer
*    .********* *.***********.

79. spacer 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_047802 (Pectobacterium phage PP99, complete genome) position: , mismatch: 8, identity: 0.733

acgtctttcagcccagtaaactgctcaagt	CRISPR spacer
agtgacttcagcccattgaactgctcaagc	Protospacer
*    .********* *.***********.

80. spacer 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to KJ749827 (Escherichia phage ECBP5, complete genome) position: , mismatch: 8, identity: 0.733

acgtctttcagcccagtaaactgctcaagt	CRISPR spacer
agtgacttcagcccattgaactgctcaagc	Protospacer
*    .********* *.***********.

81. spacer 1.22|118157|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MH616711 (Inoviridae sp. isolate ctbe45, complete genome) position: , mismatch: 8, identity: 0.733

caatcagaaagaagatgacgactataatgc	CRISPR spacer
gtggcagaaagaagatgacgcctatgcttc	Protospacer
  . **************** ****. * *

82. spacer 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_015729 (Roseobacter litoralis Och 149 plasmid pRLO149_63, complete sequence) position: , mismatch: 8, identity: 0.733

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
ttctgggagaggtcaacacccccggcctgc	Protospacer
  ******* ************ ***.   

83. spacer 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP027408 (Roseobacter denitrificans strain FDAARGOS_309 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
ttctgggagaggtcaacacccccggcctgc	Protospacer
  ******* ************ ***.   

84. spacer 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP026745 (Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
gcacaggagcggtcgacaccccgggctgtt	Protospacer
.  ..*********.*******.****** 

85. spacer 1.24|118289|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_008387 (Roseobacter denitrificans OCh 114 plasmid pTB2, complete sequence) position: , mismatch: 8, identity: 0.733

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
ttctgggagaggtcaacacccccggcctgc	Protospacer
  ******* ************ ***.   

86. spacer 1.35|118780|31|NZ_CP013149|PILER-CR matches to NZ_CP015089 (Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggtgctgttgcacgtgatcccgcgctt	CRISPR spacer
tctccgagctgttccaggtgatcccgcgctt	Protospacer
.  . * ****** ** **************

87. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 9, identity: 0.7

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
atccccttcaccgaggaagccggcgtgctc	Protospacer
  *    .***************** *** 

88. spacer 1.3|116903|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.7

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
aagcgcgccaccgaggatgccggcgagggc	Protospacer
 *  . *********** *********   

89. spacer 1.6|117101|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MN693509 (Marine virus AFVG_25M367, complete genome) position: , mismatch: 9, identity: 0.7

aactcatcataaatgacgtcttttaccgag	CRISPR spacer
tcatcatcataaacgacttcttttactcct	Protospacer
   **********.*** ********.   

90. spacer 1.6|117101|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 9, identity: 0.7

aactcatcataaatgacgtcttttaccgag	CRISPR spacer
tcatcatcataaatggcgtcttttttttat	Protospacer
   ************.******** .. * 

91. spacer 1.18|117893|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP032091 (Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

acgtctttcagcccagtaaactgctcaagt	CRISPR spacer
ttaaataagagcccaggaaactgctcaagt	Protospacer
 ..  *   ******* *************

92. spacer 1.23|118223|30|NZ_CP013149|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MN582058 (Caudovirales sp. ctOwN3, complete genome) position: , mismatch: 9, identity: 0.7

gacttataccagcagtaccgaagacggtta	CRISPR spacer
actagataccagcagtaccgaatacggcac	Protospacer
. .  ***************** ****.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 573390 : 582133 11 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 1145796 : 1218346 71 Lactobacillus_phage(77.55%) transposase,holin,terminase,capsid,integrase,portal,protease,tail,tRNA,head attL 1153027:1153043|attR 1196816:1196832
DBSCAN-SWA_3 1246933 : 1258899 9 Lactobacillus_phage(87.5%) NA NA
DBSCAN-SWA_4 1794495 : 1859546 60 Bacillus_phage(13.33%) transposase,protease,integrase attL 1787956:1787970|attR 1811438:1811452
DBSCAN-SWA_5 2091773 : 2145480 64 Lactobacillus_phage(39.47%) holin,transposase,terminase,capsid,integrase,tail,protease,portal,head attL 2132332:2132345|attR 2144271:2144284
DBSCAN-SWA_6 2346251 : 2354765 9 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP013156
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013156_1 14490-14720 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP017957 Lactobacillus plantarum strain C410L1 plasmid unnamed3, complete sequence 12233-12262 0 1.0
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP045050 Lactobacillus reuteri strain reuteri plasmid pLTR1318, complete sequence 512-541 0 1.0
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP013156 Lactobacillus plantarum strain MF1298 plasmid pMF1298-6, complete sequence 658-687 0 1.0
NZ_CP013156_1 1.3|14646|39|NZ_CP013156|CRT 14646-14684 39 NC_006530 Lactobacillus salivarius UCC118 plasmid pSF118-44, complete sequence 9547-9585 0 1.0
NZ_CP013156_1 1.3|14646|39|NZ_CP013156|CRT 14646-14684 39 NZ_CP017957 Lactobacillus plantarum strain C410L1 plasmid unnamed3, complete sequence 12104-12142 0 1.0
NZ_CP013156_1 1.3|14646|39|NZ_CP013156|CRT 14646-14684 39 CP002035 Lactobacillus salivarius CECT 5713 plasmid pHN1, complete sequence 9853-9891 0 1.0
NZ_CP013156_1 1.3|14646|39|NZ_CP013156|CRT 14646-14684 39 NC_011839 Lactobacillus gasseri plasmid pLgLA39, complete sequence 13014-13052 0 1.0
NZ_CP013156_1 1.3|14646|39|NZ_CP013156|CRT 14646-14684 39 NZ_CP045050 Lactobacillus reuteri strain reuteri plasmid pLTR1318, complete sequence 383-421 0 1.0
NZ_CP013156_1 1.3|14646|39|NZ_CP013156|CRT 14646-14684 39 NZ_CP013156 Lactobacillus plantarum strain MF1298 plasmid pMF1298-6, complete sequence 529-567 0 1.0
NZ_CP013156_1 1.3|14646|39|NZ_CP013156|CRT 14646-14684 39 NZ_CP012291 Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-3, complete sequence 132108-132146 0 1.0
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 CP002035 Lactobacillus salivarius CECT 5713 plasmid pHN1, complete sequence 9982-10011 1 0.967
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP040502 Lactobacillus paragasseri JV-V03 plasmid unnamed2, complete sequence 20599-20628 1 0.967
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NC_011839 Lactobacillus gasseri plasmid pLgLA39, complete sequence 13143-13172 1 0.967
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NC_006530 Lactobacillus salivarius UCC118 plasmid pSF118-44, complete sequence 9676-9705 2 0.933
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_AP014682 Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-2, complete sequence 512-541 4 0.867
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP014931 Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-7, complete sequence 68-97 5 0.833
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP014914 Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-2, complete sequence 8445-8474 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_KM063576 Lactobacillus reuteri strain LU4 plasmid pLU4, complete sequence 512-541 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP030883 Lactobacillus plantarum strain nF1 plasmid unnamed2, complete sequence 23107-23136 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP019031 Lactobacillus fermentum strain SNUV175 plasmid pSNU175-2, complete sequence 9206-9235 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP014916 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-1, complete sequence 905-934 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP017412 Lactobacillus plantarum strain RI-113 plasmid pRI113_6, complete sequence 13123-13152 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP015967 Lactobacillus plantarum strain LZ206 plasmid LZ206p2, complete sequence 13803-13832 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 CP031017 Lactobacillus helveticus isolate NWC_2_3 plasmid pNWC_2_3, complete sequence 6902-6931 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP032650 Lactobacillus plantarum strain ZFM4 plasmid unnamed2, complete sequence 8265-8294 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP047123 Lactobacillus hilgardii strain FLUB plasmid unnamed2 512-541 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP046661 Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence 22714-22743 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NC_021517 Lactobacillus plantarum 16 plasmid Lp16E, complete sequence 5165-5194 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP025283 Lactobacillus plantarum subsp. plantarum strain nF1-FD plasmid pnF1FD02, complete sequence 30312-30341 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NC_020820 Lactobacillus brevis KB290 plasmid pKB290-1, complete sequence 20091-20120 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP012290 Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-2, complete sequence 33654-33683 6 0.8
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP032746 Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed2, complete sequence 725-754 7 0.767
NZ_CP013156_1 1.1|14526|30|NZ_CP013156|CRT 14526-14555 30 NZ_CP014892 Lactobacillus backii strain TMW 1.1992 plasmid pL11992-2, complete sequence 6905-6934 7 0.767

1. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP017957 (Lactobacillus plantarum strain C410L1 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
cggtctcgtcaacggacttatgcggaagtg	Protospacer
******************************

2. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP045050 (Lactobacillus reuteri strain reuteri plasmid pLTR1318, complete sequence) position: , mismatch: 0, identity: 1.0

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
cggtctcgtcaacggacttatgcggaagtg	Protospacer
******************************

3. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP013156 (Lactobacillus plantarum strain MF1298 plasmid pMF1298-6, complete sequence) position: , mismatch: 0, identity: 1.0

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
cggtctcgtcaacggacttatgcggaagtg	Protospacer
******************************

4. spacer 1.3|14646|39|NZ_CP013156|CRT matches to NC_006530 (Lactobacillus salivarius UCC118 plasmid pSF118-44, complete sequence) position: , mismatch: 0, identity: 1.0

acacttttgggctatcttcaccgcgtaaatagacatcgg	CRISPR spacer
acacttttgggctatcttcaccgcgtaaatagacatcgg	Protospacer
***************************************

5. spacer 1.3|14646|39|NZ_CP013156|CRT matches to NZ_CP017957 (Lactobacillus plantarum strain C410L1 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acacttttgggctatcttcaccgcgtaaatagacatcgg	CRISPR spacer
acacttttgggctatcttcaccgcgtaaatagacatcgg	Protospacer
***************************************

6. spacer 1.3|14646|39|NZ_CP013156|CRT matches to CP002035 (Lactobacillus salivarius CECT 5713 plasmid pHN1, complete sequence) position: , mismatch: 0, identity: 1.0

acacttttgggctatcttcaccgcgtaaatagacatcgg	CRISPR spacer
acacttttgggctatcttcaccgcgtaaatagacatcgg	Protospacer
***************************************

7. spacer 1.3|14646|39|NZ_CP013156|CRT matches to NC_011839 (Lactobacillus gasseri plasmid pLgLA39, complete sequence) position: , mismatch: 0, identity: 1.0

acacttttgggctatcttcaccgcgtaaatagacatcgg	CRISPR spacer
acacttttgggctatcttcaccgcgtaaatagacatcgg	Protospacer
***************************************

8. spacer 1.3|14646|39|NZ_CP013156|CRT matches to NZ_CP045050 (Lactobacillus reuteri strain reuteri plasmid pLTR1318, complete sequence) position: , mismatch: 0, identity: 1.0

acacttttgggctatcttcaccgcgtaaatagacatcgg	CRISPR spacer
acacttttgggctatcttcaccgcgtaaatagacatcgg	Protospacer
***************************************

9. spacer 1.3|14646|39|NZ_CP013156|CRT matches to NZ_CP013156 (Lactobacillus plantarum strain MF1298 plasmid pMF1298-6, complete sequence) position: , mismatch: 0, identity: 1.0

acacttttgggctatcttcaccgcgtaaatagacatcgg	CRISPR spacer
acacttttgggctatcttcaccgcgtaaatagacatcgg	Protospacer
***************************************

10. spacer 1.3|14646|39|NZ_CP013156|CRT matches to NZ_CP012291 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-3, complete sequence) position: , mismatch: 0, identity: 1.0

acacttttgggctatcttcaccgcgtaaatagacatcgg	CRISPR spacer
acacttttgggctatcttcaccgcgtaaatagacatcgg	Protospacer
***************************************

11. spacer 1.1|14526|30|NZ_CP013156|CRT matches to CP002035 (Lactobacillus salivarius CECT 5713 plasmid pHN1, complete sequence) position: , mismatch: 1, identity: 0.967

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
cggtctcatcaacggacttatgcggaagtg	Protospacer
*******.**********************

12. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP040502 (Lactobacillus paragasseri JV-V03 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
cggtctcgttaacggacttatgcggaagtg	Protospacer
*********.********************

13. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NC_011839 (Lactobacillus gasseri plasmid pLgLA39, complete sequence) position: , mismatch: 1, identity: 0.967

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
cggcctcgtcaacggacttatgcggaagtg	Protospacer
***.**************************

14. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NC_006530 (Lactobacillus salivarius UCC118 plasmid pSF118-44, complete sequence) position: , mismatch: 2, identity: 0.933

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
cggtctcatcagcggacttatgcggaagtg	Protospacer
*******.***.******************

15. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_AP014682 (Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-2, complete sequence) position: , mismatch: 4, identity: 0.867

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
gggtgtcgtcaacgaacttatgcggaagtt	Protospacer
 *** *********.************** 

16. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP014931 (Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-7, complete sequence) position: , mismatch: 5, identity: 0.833

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
aggcgttgtcaacggacttatgcggaactg	Protospacer
 **. *.******************** **

17. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP014914 (Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-2, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

18. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_KM063576 (Lactobacillus reuteri strain LU4 plasmid pLU4, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

19. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP030883 (Lactobacillus plantarum strain nF1 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

20. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP019031 (Lactobacillus fermentum strain SNUV175 plasmid pSNU175-2, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

21. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP014916 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-1, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

22. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP017412 (Lactobacillus plantarum strain RI-113 plasmid pRI113_6, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

23. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP015967 (Lactobacillus plantarum strain LZ206 plasmid LZ206p2, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

24. spacer 1.1|14526|30|NZ_CP013156|CRT matches to CP031017 (Lactobacillus helveticus isolate NWC_2_3 plasmid pNWC_2_3, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
ggctgttgtcaacgaacttatgcggaagtc	Protospacer
 * * *.*******.************** 

25. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP032650 (Lactobacillus plantarum strain ZFM4 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

26. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP047123 (Lactobacillus hilgardii strain FLUB plasmid unnamed2) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

27. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP046661 (Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

28. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NC_021517 (Lactobacillus plantarum 16 plasmid Lp16E, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

29. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP025283 (Lactobacillus plantarum subsp. plantarum strain nF1-FD plasmid pnF1FD02, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

30. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NC_020820 (Lactobacillus brevis KB290 plasmid pKB290-1, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

31. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP012290 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-2, complete sequence) position: , mismatch: 6, identity: 0.8

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctgttgtcaacgaacttatgcggaagtt	Protospacer
 * * *.*******.************** 

32. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP032746 (Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
agctggtgtcaacgaacttatgcggaagtt	Protospacer
 * *  .*******.************** 

33. spacer 1.1|14526|30|NZ_CP013156|CRT matches to NZ_CP014892 (Lactobacillus backii strain TMW 1.1992 plasmid pL11992-2, complete sequence) position: , mismatch: 7, identity: 0.767

cggtctcgtcaacggacttatgcggaagtg	CRISPR spacer
ggctgctgtcaacgaacttatgcggaagtc	Protospacer
 * * ..*******.************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage