Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017855 Campylobacter jejuni strain ZP3204 plasmid pCJDM204S, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP017856 Campylobacter jejuni strain ZP3204 chromosome, complete genome 1 crisprs DEDDh,WYL,cas14j,cas2,cas1,cas9,csa3 0 0 3 0
NZ_CP017854 Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence 2 crisprs NA 0 1 0 0

Results visualization

1. NZ_CP017856
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017856_1 1564797-1564909 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 451556 : 460043 11 Campylobacter_phage(88.89%) NA NA
DBSCAN-SWA_2 930894 : 1002224 54 Phaeocystis_globosa_virus(20.0%) tRNA,integrase,plate,protease attL 933540:933558|attR 1009731:1009749
DBSCAN-SWA_3 1442080 : 1456514 18 Synechococcus_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP017854
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017854_1 3937-4035 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017854_2 4251-4316 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017854_1 1.1|3962|48|NZ_CP017854|CRISPRCasFinder 3962-4009 48 NZ_CP022078 Campylobacter jejuni strain FDAARGOS_265 plasmid unnamed1, complete sequence 956-1003 0 1.0
NZ_CP017854_1 1.1|3962|48|NZ_CP017854|CRISPRCasFinder 3962-4009 48 NZ_CP045046 Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence 18715-18762 0 1.0
NZ_CP017854_1 1.1|3962|48|NZ_CP017854|CRISPRCasFinder 3962-4009 48 NZ_CP017857 Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence 20867-20914 0 1.0
NZ_CP017854_1 1.1|3962|48|NZ_CP017854|CRISPRCasFinder 3962-4009 48 NZ_CP017854 Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence 3962-4009 0 1.0
NZ_CP017854_1 1.1|3962|48|NZ_CP017854|CRISPRCasFinder 3962-4009 48 NZ_CP028186 Campylobacter jejuni strain CFSAN054107 plasmid pGMI16-002, complete sequence 37797-37844 0 1.0
NZ_CP017854_1 1.1|3962|48|NZ_CP017854|CRISPRCasFinder 3962-4009 48 CP013735 Campylobacter coli strain OR12 plasmid pOR12TET, complete sequence 3665-3712 0 1.0
NZ_CP017854_1 1.1|3962|48|NZ_CP017854|CRISPRCasFinder 3962-4009 48 CP047483 Campylobacter jejuni strain CFSAN096297 plasmid CFSAN096297, complete sequence 46123-46170 0 1.0
NZ_CP017854_1 1.1|3962|48|NZ_CP017854|CRISPRCasFinder 3962-4009 48 NZ_CP044170 Campylobacter jejuni strain AR-0413 plasmid pAR-0413-1, complete sequence 19101-19148 0 1.0
NZ_CP017854_1 1.1|3962|48|NZ_CP017854|CRISPRCasFinder 3962-4009 48 NZ_MK541987 Campylobacter coli strain CVM N46788F plasmid pN46788F, complete sequence 22344-22391 0 1.0

1. spacer 1.1|3962|48|NZ_CP017854|CRISPRCasFinder matches to NZ_CP022078 (Campylobacter jejuni strain FDAARGOS_265 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

2. spacer 1.1|3962|48|NZ_CP017854|CRISPRCasFinder matches to NZ_CP045046 (Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

3. spacer 1.1|3962|48|NZ_CP017854|CRISPRCasFinder matches to NZ_CP017857 (Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

4. spacer 1.1|3962|48|NZ_CP017854|CRISPRCasFinder matches to NZ_CP017854 (Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

5. spacer 1.1|3962|48|NZ_CP017854|CRISPRCasFinder matches to NZ_CP028186 (Campylobacter jejuni strain CFSAN054107 plasmid pGMI16-002, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

6. spacer 1.1|3962|48|NZ_CP017854|CRISPRCasFinder matches to CP013735 (Campylobacter coli strain OR12 plasmid pOR12TET, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

7. spacer 1.1|3962|48|NZ_CP017854|CRISPRCasFinder matches to CP047483 (Campylobacter jejuni strain CFSAN096297 plasmid CFSAN096297, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

8. spacer 1.1|3962|48|NZ_CP017854|CRISPRCasFinder matches to NZ_CP044170 (Campylobacter jejuni strain AR-0413 plasmid pAR-0413-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

9. spacer 1.1|3962|48|NZ_CP017854|CRISPRCasFinder matches to NZ_MK541987 (Campylobacter coli strain CVM N46788F plasmid pN46788F, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage